ID: 1176117267

View in Genome Browser
Species Human (GRCh38)
Location 20:63438549-63438571
Sequence TGTTGAGGAGTGGAGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 300}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176117267_1176117282 16 Left 1176117267 20:63438549-63438571 CCAGCGGCCTCCACTCCTCAACA 0: 1
1: 0
2: 0
3: 25
4: 300
Right 1176117282 20:63438588-63438610 AGGGCTGTGCTGGTCCCCGGGGG 0: 1
1: 0
2: 1
3: 31
4: 255
1176117267_1176117283 24 Left 1176117267 20:63438549-63438571 CCAGCGGCCTCCACTCCTCAACA 0: 1
1: 0
2: 0
3: 25
4: 300
Right 1176117283 20:63438596-63438618 GCTGGTCCCCGGGGGACACCTGG 0: 1
1: 0
2: 0
3: 30
4: 243
1176117267_1176117279 13 Left 1176117267 20:63438549-63438571 CCAGCGGCCTCCACTCCTCAACA 0: 1
1: 0
2: 0
3: 25
4: 300
Right 1176117279 20:63438585-63438607 ACAAGGGCTGTGCTGGTCCCCGG 0: 1
1: 0
2: 2
3: 37
4: 246
1176117267_1176117275 -4 Left 1176117267 20:63438549-63438571 CCAGCGGCCTCCACTCCTCAACA 0: 1
1: 0
2: 0
3: 25
4: 300
Right 1176117275 20:63438568-63438590 AACAAGGTGGGACCAGGACAAGG 0: 1
1: 0
2: 2
3: 16
4: 238
1176117267_1176117276 -3 Left 1176117267 20:63438549-63438571 CCAGCGGCCTCCACTCCTCAACA 0: 1
1: 0
2: 0
3: 25
4: 300
Right 1176117276 20:63438569-63438591 ACAAGGTGGGACCAGGACAAGGG 0: 1
1: 0
2: 0
3: 15
4: 212
1176117267_1176117281 15 Left 1176117267 20:63438549-63438571 CCAGCGGCCTCCACTCCTCAACA 0: 1
1: 0
2: 0
3: 25
4: 300
Right 1176117281 20:63438587-63438609 AAGGGCTGTGCTGGTCCCCGGGG 0: 1
1: 0
2: 2
3: 23
4: 233
1176117267_1176117273 -10 Left 1176117267 20:63438549-63438571 CCAGCGGCCTCCACTCCTCAACA 0: 1
1: 0
2: 0
3: 25
4: 300
Right 1176117273 20:63438562-63438584 CTCCTCAACAAGGTGGGACCAGG 0: 1
1: 0
2: 1
3: 10
4: 155
1176117267_1176117277 6 Left 1176117267 20:63438549-63438571 CCAGCGGCCTCCACTCCTCAACA 0: 1
1: 0
2: 0
3: 25
4: 300
Right 1176117277 20:63438578-63438600 GACCAGGACAAGGGCTGTGCTGG 0: 1
1: 1
2: 2
3: 19
4: 247
1176117267_1176117280 14 Left 1176117267 20:63438549-63438571 CCAGCGGCCTCCACTCCTCAACA 0: 1
1: 0
2: 0
3: 25
4: 300
Right 1176117280 20:63438586-63438608 CAAGGGCTGTGCTGGTCCCCGGG 0: 1
1: 0
2: 1
3: 31
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176117267 Original CRISPR TGTTGAGGAGTGGAGGCCGC TGG (reversed) Intronic
903173102 1:21565609-21565631 AGATGAGGAGGGGGGGCCGCAGG + Intronic
903770904 1:25763789-25763811 TGCTGAGGATGGGAGGCAGCTGG - Intronic
904091807 1:27950143-27950165 TGTTGAGGAAAGGAAGCAGCGGG - Intronic
904754177 1:32759027-32759049 TGGTGGGGAGAGGAGGCTGCTGG + Intronic
906260519 1:44385060-44385082 TGTTGTGGAGTGGGGGGAGCGGG - Intergenic
906572214 1:46852471-46852493 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
909048283 1:70736923-70736945 TGTTGTGGGGTGGAGGGAGCGGG + Intergenic
909822097 1:80078330-80078352 TGTTGCGGAGTGGGGGCCTAGGG + Intergenic
910719495 1:90270610-90270632 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
912107610 1:106299416-106299438 TGTTGTGGAGTGGGGGGAGCGGG + Intergenic
912383089 1:109258032-109258054 TGTTGAGGTGTAGAGGCTGAGGG + Intronic
913328598 1:117649315-117649337 TGATGAGGAGCTGAGGCCTCTGG - Intergenic
914417878 1:147501185-147501207 TGTGCACCAGTGGAGGCCGCAGG + Intergenic
914459250 1:147867594-147867616 TGTTGTGGAGTGGGGGCCTCGGG + Intergenic
915086373 1:153391679-153391701 TGTGGAGGAGTGTGGGCAGCAGG - Intergenic
915086494 1:153392666-153392688 TGTGGAGGAGTGTGGGCAGCAGG - Intergenic
915121888 1:153634448-153634470 TGTTGGAGCGTGGAGGCCCCGGG + Intronic
915358219 1:155269201-155269223 CATTAAAGAGTGGAGGCCGCTGG + Intronic
915893381 1:159792005-159792027 TGCTGAGGAGGGGAGGCCTGGGG + Intergenic
916166803 1:161972395-161972417 CGGTGAGGAGCGGAGGCCCCAGG - Intergenic
916210685 1:162357271-162357293 TGTTGGGGAGTGGGGGCAGCGGG + Intronic
918110977 1:181455294-181455316 TTTTGAGGAGTGGAGTGCTCAGG + Intronic
918351134 1:183657436-183657458 TGTTGTGGGGTGGAGGGAGCGGG - Intronic
918824699 1:189309475-189309497 TGTTGAGGCTAGGAGGCAGCAGG + Intergenic
920440850 1:205979514-205979536 TGGTGAGAAGTGGAGCCAGCTGG - Intronic
921439867 1:215173115-215173137 TGTTGTGGGGTGGAGGGAGCGGG - Intronic
923790708 1:237108652-237108674 TGTAGGGGCGTGGAGGCTGCAGG + Intronic
923954323 1:238997558-238997580 TGCTGAGCAGTGGCGGCGGCAGG + Intergenic
924022506 1:239799252-239799274 TGATGAGGAGTGGAGTGCACTGG + Intronic
1062874076 10:931460-931482 GGTTGAGGCGAGGAGCCCGCGGG - Exonic
1063189627 10:3681159-3681181 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
1066752032 10:38667833-38667855 TGTTGAGGGGTGGAGGGCTGGGG + Intergenic
1067805160 10:49386950-49386972 TGGTGTGGAGAGGAGGCTGCAGG - Intronic
1069344587 10:67453114-67453136 TGATGATCAGTGGAGGCAGCTGG - Intronic
1069368275 10:67716467-67716489 TGTTGAGGGGTGGAGGCTAGGGG - Intergenic
1071291814 10:84194427-84194449 TGTCCAGGACTGGGGGCCGCCGG + Intergenic
1071366230 10:84903202-84903224 TGGGGTGGAGTGGAGGCAGCAGG + Intergenic
1071836682 10:89425093-89425115 TGGGGAGGGGTGGAGGGCGCTGG + Intergenic
1072716336 10:97755267-97755289 GGTTCAGGAGCAGAGGCCGCAGG - Intronic
1074288943 10:112123941-112123963 TGTGGAGGAGAGGAGGGCACAGG - Intergenic
1074570752 10:114621986-114622008 TGATGGGGATTGGAGTCCGCAGG - Intronic
1076261044 10:129066527-129066549 TGTTGTGGAGTGGGGGGAGCGGG + Intergenic
1076520613 10:131078612-131078634 TGTTTAGAAGTGGAGGCTGTGGG - Intergenic
1076788418 10:132763321-132763343 TGTGGAGGTGAGGAGGCAGCAGG - Intronic
1076920096 10:133446642-133446664 TGCTGAGGAGTGGGGGCGTCCGG - Intergenic
1077099472 11:815735-815757 AGGTGAGGAGTGGAGGAGGCCGG + Intergenic
1077112048 11:866204-866226 TGGTGTGGGGTGGAGGCCGGTGG + Intronic
1077762867 11:5122444-5122466 TGTTGTGGGGTGGGGGCCGGGGG + Intergenic
1077767796 11:5179969-5179991 TGTTGTGGGGTGGGGGCCGGGGG - Intronic
1077870814 11:6259997-6260019 TGTTGAGGAGAGGCGCCCCCGGG - Exonic
1078706970 11:13753434-13753456 TGTTGAGGAGTGGTGACAGTGGG - Intergenic
1078946638 11:16075651-16075673 TGTTGGGGAGTGGGGGCTGGGGG + Intronic
1079253889 11:18809820-18809842 TGTTGTGGAGTGGGGGGAGCGGG - Intergenic
1079970060 11:27025831-27025853 TGTTGAGGGGTGGGGGGAGCGGG + Intergenic
1080113572 11:28596977-28596999 TGTTGGGGAGTGGAGGTTGTGGG + Intergenic
1081637976 11:44733613-44733635 TGGTGAGGAGGGGAGGTTGCAGG + Intronic
1083342521 11:61967750-61967772 TGTGGGGGAGGGGCGGCCGCTGG + Intergenic
1083996476 11:66275568-66275590 TGTTGAGGTGTTGGGGCAGCTGG + Intronic
1084411568 11:69009065-69009087 CGCTGTGGAGTGGCGGCCGCAGG - Intronic
1085344506 11:75759362-75759384 GGGAGAGGAGTGGAGGCGGCTGG + Intergenic
1085653817 11:78294064-78294086 TGTTGTGGGGTGGAGGGAGCGGG - Intronic
1089788023 11:120921965-120921987 TGGTGAGGTGTGGTGGCAGCAGG + Intronic
1090148271 11:124351831-124351853 TGTTGGGGAGTGGGGGCTGGGGG + Intergenic
1090642191 11:128739406-128739428 GGTTGAGGGGTGGGGGCAGCAGG - Intronic
1090730863 11:129572611-129572633 TGTTGAGGGGTGGAGGGAGGGGG - Intergenic
1091109625 11:132953710-132953732 TGTGGAGGAGAGAATGCCGCTGG + Intronic
1091742968 12:2973193-2973215 TCTTGAGTAGTGGAGACCACAGG + Intronic
1093081551 12:14817476-14817498 AGTTGAGGAGTGGGGGGCGAGGG - Intronic
1093256418 12:16873555-16873577 TGTTGGGGAGTGGGGGCCTGGGG - Intergenic
1093477675 12:19573687-19573709 TGGTGAAGAGTGGGGGCCGAGGG + Intronic
1093514183 12:19966474-19966496 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
1094486118 12:30926950-30926972 GGATGAGGAGTGGAGGAGGCAGG + Exonic
1095216948 12:39560156-39560178 TGTTGTGGGGTGGGGGCAGCAGG - Intronic
1095857931 12:46881706-46881728 TGTTGGGGAGTGGGGGACGAGGG + Intergenic
1096647555 12:53047089-53047111 TGGGGAGGAGAGGAGGCCGAGGG + Intronic
1096776616 12:53968200-53968222 TGTTCACGAGTGGAGGCCCAAGG - Intergenic
1097142464 12:56913750-56913772 TGTTGTGGAGTGGGGGGAGCGGG + Intergenic
1098664671 12:73147765-73147787 TGTTGTGGGGTGGAGGGAGCGGG - Intergenic
1099173774 12:79397158-79397180 TGTAGAGGTTTGGAGGCCACTGG + Intronic
1102057492 12:109907612-109907634 TGAAGAGGAGAGGAGGCAGCTGG + Exonic
1103238867 12:119397704-119397726 GGCTGAGGAGTGCAGGCAGCGGG - Intronic
1103960394 12:124605803-124605825 TGTTAAGCAGTGAAGGCAGCTGG + Intergenic
1104315951 12:127701900-127701922 TGTTGATGAGAGGAGGCTGAAGG + Intergenic
1104517708 12:129443150-129443172 TGTAGAGGAGAGGAGGAAGCCGG - Intronic
1110569601 13:76990202-76990224 TGTTCAGTGGTGGAGGCCTCTGG - Intergenic
1113164994 13:107430445-107430467 TGTTGTGGAGTGGAGGGAGCAGG - Intronic
1114044248 14:18708115-18708137 TGTTGTGGGGTGGAGGCAGGGGG + Intergenic
1114048527 14:18898565-18898587 TGTTGTGGGGTGGAGGCAGCGGG + Intergenic
1114113985 14:19503081-19503103 TGTTGTGGGGTGGAGGCAGCGGG - Intergenic
1114115684 14:19620833-19620855 TGTTGTGGGGTGGAGGCAGCGGG - Intergenic
1114901194 14:27061168-27061190 TGTTGAGGGGTGGAGGGCTGGGG - Intergenic
1117115721 14:52508900-52508922 TGTTGTGGGGTGGGGGCAGCGGG + Intronic
1119668029 14:76498746-76498768 CCTTCAGGAGTGGAGGCCACTGG + Intronic
1120604901 14:86562750-86562772 TGTTGGGGGGTGGGGGGCGCGGG - Intergenic
1121891298 14:97593722-97593744 GGTTGAGGAGTGGTGGCTGTAGG - Intergenic
1122206037 14:100148503-100148525 TGATGGGGAGTGGAAGCCCCGGG - Intronic
1123893230 15:24802388-24802410 TGTTGAGGGGAGGAGGCAGATGG - Intergenic
1124653576 15:31489794-31489816 TGTTGAGGGGAGGAGTCCCCAGG - Intronic
1130540161 15:84816711-84816733 TGCTGAGAAATGGAGGCCGAAGG + Exonic
1132038915 15:98508281-98508303 TGTTGTGGGGTGGAGGGAGCGGG - Intronic
1132747188 16:1441690-1441712 TGGGGAGGGGTGGAGGCGGCAGG + Intronic
1134251433 16:12577011-12577033 TGGTGAGGCGTGGAGGGTGCTGG - Intergenic
1135075696 16:19391767-19391789 TGTTGAGAGGTGGAGCCAGCTGG - Intergenic
1135796547 16:25449280-25449302 TGTTGTGGGGTGGAGGGAGCGGG - Intergenic
1135954621 16:26945783-26945805 TGTTTAGTAGTGGATGCCACTGG - Intergenic
1136041191 16:27580234-27580256 TCTTGAGTAGTGGAGACCACAGG + Intronic
1137546831 16:49410589-49410611 TGGTGAGGACTGGAGACCACAGG + Intergenic
1137876068 16:51997749-51997771 TGTTGAGAGGTGAAGGCAGCTGG + Intergenic
1138202156 16:55097408-55097430 TGTTGAGGGGTGGAGGTTGAGGG - Intergenic
1139128890 16:64115839-64115861 TGTTGTGGGGTGGAGGGAGCGGG + Intergenic
1139960059 16:70712336-70712358 TGGTGGGGAGTGGAGGGAGCAGG - Intronic
1142112102 16:88338427-88338449 TGATGAGGAGAGGTGGCCTCGGG + Intergenic
1142206240 16:88784579-88784601 CGCTGCGGAGAGGAGGCCGCCGG - Intronic
1143053252 17:4143757-4143779 TGTTGAGGTGCGGAGGCCGTGGG + Exonic
1143297111 17:5879456-5879478 TATTGAGGAGTGGAGGAAGGTGG - Intronic
1143365476 17:6405722-6405744 TGGTGAATAGTGGAGGCCGTGGG - Intronic
1143495219 17:7308435-7308457 TTTTGAGGAGTGGAAGCCGGAGG + Intronic
1144204160 17:12967448-12967470 TGTTGAGGAATTGAGGCAGGAGG - Intronic
1144359365 17:14477328-14477350 TGTTGAGCAGTGGGGGGCGAGGG + Intergenic
1145939797 17:28737419-28737441 TGTGGCTGAGTGGTGGCCGCTGG - Exonic
1145939919 17:28737901-28737923 TGTTGAGCATTGGCAGCCGCAGG - Exonic
1146930256 17:36771898-36771920 TGTTGATCAGTGGAGGCACCAGG - Intergenic
1147175634 17:38654565-38654587 GCTGGAGGAGTGGAGGCGGCAGG + Intergenic
1147466985 17:40617865-40617887 TATCAAGGAGTGGAGGTCGCAGG + Intergenic
1147979300 17:44264959-44264981 TGTTGAGCACTGGAGGCTGTGGG + Intronic
1148143625 17:45345672-45345694 TGTTGACAAGTAGAGGCCGTGGG + Intergenic
1149620324 17:58039959-58039981 TTTTGAGGCAAGGAGGCCGCTGG + Intergenic
1149659350 17:58326272-58326294 TGGTGAGGAAAGGAGGCTGCTGG - Exonic
1150908466 17:69363261-69363283 TTTTGAGGAGAGGAGGGCCCAGG - Intergenic
1153831138 18:8923748-8923770 TGTTGTGGGGTGGAGGGAGCGGG + Intergenic
1155768904 18:29672454-29672476 TGTTGAGGAGTAGGGGCTGGGGG - Intergenic
1157646787 18:49281798-49281820 TGTTGTGGAGTGGGGGCAGGGGG + Intronic
1157794389 18:50560541-50560563 TGTTTAGGGGAGGAGGACGCAGG + Intronic
1158730536 18:60017849-60017871 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
1158931115 18:62325541-62325563 TTTTGGGGAGCGGAGGCCGTGGG + Intronic
1159387639 18:67746138-67746160 TGTTGTGGAGTGGGGGGAGCGGG + Intergenic
1159446832 18:68551193-68551215 TGGTGAGGCTTGGAGGCCACTGG - Intergenic
1160693762 19:472605-472627 TGGTGAGGATTGGGGGCCCCGGG + Intronic
1161769124 19:6221958-6221980 TAGTGAGGCGTGGAGGCCCCAGG + Intronic
1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG + Exonic
1163584012 19:18154302-18154324 TGAGGAGGAGGGGAGGCTGCCGG - Intronic
1165250617 19:34530880-34530902 TTTTGAGGAGTGGAAGCCTTGGG - Intergenic
1168717599 19:58538549-58538571 TGATGGGGACTGGGGGCCGCGGG - Intronic
1202656524 1_KI270708v1_random:28190-28212 TGTTGAGGGGTGGGGGCAGGGGG + Intergenic
925060339 2:885689-885711 TGTGGAGGACTGGAGGGCTCGGG + Intergenic
925132891 2:1505728-1505750 TGTTGAGGGGTGGAGGATGAGGG - Intronic
925456855 2:4023368-4023390 GGGTGAGAAGTGGAGGCCGGGGG + Intergenic
926231477 2:11007433-11007455 TGTTGAGAAGGAGAGGCTGCAGG + Intergenic
926615746 2:14995206-14995228 TGTTGTGGAGTGGGGGCAGGGGG - Intergenic
930081677 2:47454833-47454855 TGTTGAGGGGTGGAGGGAGGGGG - Intronic
933696678 2:85223933-85223955 TGTTGGGGAGTGGGGGCTGGGGG - Intronic
934941614 2:98507063-98507085 TTTTGTGGAATGGTGGCCGCTGG + Intronic
935215291 2:100971046-100971068 TGCTGAGGAGTGGAGGGCCTCGG - Exonic
938425894 2:131187071-131187093 TGTTGTGGGGTGGAGGCAGGGGG + Intronic
938532471 2:132202137-132202159 TGTTGTGGGGTGGAGGCAGGGGG + Intronic
941391232 2:164917492-164917514 TTTAGAGTAGTGGAGGCAGCAGG - Intronic
942097195 2:172544710-172544732 TGTTGAGGGGTGGAGGGCTTGGG + Intergenic
942130216 2:172871289-172871311 TTTTGAGGTGTGGAGGCCCTTGG + Intronic
943463615 2:188200454-188200476 TGTTGAGGAGTGAAGGAAGTTGG - Intergenic
943501791 2:188699228-188699250 TGTTGAGGGGTGGAGGGCAAGGG + Intergenic
944644686 2:201766937-201766959 TGTTGTGGGGTGGAGGGAGCGGG + Intronic
944806842 2:203290884-203290906 TGTTGAGAGGTGGAGGCAGGTGG - Intronic
944806916 2:203291824-203291846 TGTTGTGGCGTGGAGGGAGCGGG - Intronic
945196950 2:207245643-207245665 TGTTGGGGAGTGAAGGCAGCAGG - Intergenic
946037500 2:216755599-216755621 GGTTGAGGAGGAGAGGCCGTGGG + Intergenic
947492728 2:230609968-230609990 TGTTGAGGTGTGGGGGCTGGGGG + Intergenic
947742429 2:232490813-232490835 TGGGGAGGAGTGGAGGCCTGGGG - Intergenic
948942493 2:241203359-241203381 GGTTGAGGCGTGGAGCCTGCGGG - Exonic
1170719292 20:18861356-18861378 TGTTGTGGAGTGGCGGTGGCGGG - Intergenic
1171253836 20:23671200-23671222 TGTTGAGGACTGGGGACTGCTGG - Intergenic
1171260331 20:23726488-23726510 TGTTGAGGACTGGGGACTGCTGG - Intergenic
1171269444 20:23802310-23802332 TGTTGAGGACTGGGGACTGCTGG - Intergenic
1173104823 20:40123930-40123952 GGTTGTGCAGTGGGGGCCGCTGG - Intergenic
1175029603 20:55938909-55938931 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
1175558215 20:59890393-59890415 TGTTGGGGGGTGGAGGCCTAGGG + Intronic
1176117267 20:63438549-63438571 TGTTGAGGAGTGGAGGCCGCTGG - Intronic
1176285085 21:5015237-5015259 TGTTGAGGGGCGGGGGCAGCTGG - Intergenic
1179766432 21:43577114-43577136 GGTTGAGAAGTGGAGGTCGAGGG - Intronic
1179872096 21:44248238-44248260 TGTTGAGGGGCGGGGGCAGCTGG + Intronic
1180176497 21:46093013-46093035 TGTTGAGGTGTGGTGTCCGCAGG + Intergenic
1180467067 22:15621227-15621249 TGTTGTGGGGTGGAGGCAGCGGG + Intergenic
1180715134 22:17866408-17866430 GGTGGAGGCGTGGAGGCTGCAGG + Intronic
1181085743 22:20438556-20438578 AGTTGAGGAGTGAAGGGGGCTGG + Intronic
1182321415 22:29480393-29480415 TGTCCACGAGTGGAAGCCGCTGG - Exonic
1183063125 22:35347464-35347486 TGCTGAGAAGTGGAGGCCCCAGG + Exonic
1183165062 22:36141274-36141296 TGCTGAGGAGCTGAGGCGGCAGG - Exonic
1183456769 22:37927167-37927189 TGTGGGGAAGTGGAGGCAGCAGG + Intronic
1184138126 22:42561500-42561522 TGTTGTGGAGTTGAGGGTGCAGG + Intronic
1185377904 22:50490679-50490701 GGTTCAGGGGTGGTGGCCGCAGG - Intergenic
1185384741 22:50526538-50526560 TGTAGGGGAGCGGAGGCGGCGGG - Intronic
951197560 3:19841070-19841092 TGTTGAGGGGTGGAGGGCAAGGG - Intergenic
951685046 3:25334524-25334546 TGTTGTGGGGTGGAGGGAGCGGG + Intronic
954477537 3:50762101-50762123 TGTTGTGGGGTGGGGGCAGCGGG + Intronic
954718301 3:52538237-52538259 AGATGAGGAGTGGAGGCTTCTGG + Intronic
955276996 3:57556296-57556318 AGCTGAGGAGCCGAGGCCGCCGG - Exonic
956234384 3:67052545-67052567 TGTTGGGGAGTGGAGGGCAAGGG - Intergenic
956665013 3:71633657-71633679 TGTGGTGGAGTGGAGGGCGTGGG + Intergenic
956718002 3:72095241-72095263 TGTTGAGGGGTGGAGGGTGAGGG + Intergenic
956888729 3:73588081-73588103 TGTTGAGGGGTGGAGGGTGAGGG - Intronic
957218505 3:77351942-77351964 TGTTGTGGAGTGGGGGCAGGGGG + Intronic
958641724 3:96814361-96814383 TGAAGAGGCGTGGGGGCCGCGGG - Intergenic
958756263 3:98252888-98252910 TGTTGGGGTGTGGGGGCCGTAGG + Intergenic
960127639 3:114017729-114017751 TGTTGAGGGGTGGAGGATGAGGG + Intronic
960146650 3:114210893-114210915 TGTTGAGGGGTGGAGGGCTGGGG + Intergenic
961558728 3:127714318-127714340 TGCTCAGGAGTGGAGGCAGAAGG + Intronic
962363742 3:134763226-134763248 TGTTGTGGGGTGGAGGGAGCGGG - Intronic
963330584 3:143910481-143910503 TGTCGACGAGTGGTGGCCACAGG + Intergenic
963847494 3:150174237-150174259 TGTTGAGGAGTGCAGGCATTTGG - Intergenic
964700053 3:159555912-159555934 TGTTGAGGGGTGGAGGGCTAGGG + Intronic
967104368 3:186243442-186243464 CGGTGTGGAGTGGGGGCCGCAGG - Intronic
967225616 3:187288389-187288411 TGCTGAGGAGGGGAGGGCACTGG + Intronic
967860773 3:194149786-194149808 TCTTAAGGAGTGGGGGCTGCAGG + Intergenic
968054186 3:195678579-195678601 TGTGGAGGAGAGGGAGCCGCAGG + Intergenic
968765757 4:2468414-2468436 TGTGGAGGATTGGAGGACTCAGG - Intronic
969167884 4:5332642-5332664 TGTTGTGGGGTGGAGGCAGCGGG - Intronic
969649911 4:8459907-8459929 TGTTGTGTAGTGGCCGCCGCTGG + Intronic
972312786 4:37896319-37896341 TGTGAAGGAGTGGAGGGGGCTGG + Intronic
973348276 4:49080431-49080453 TGTTGAGGGGTGGGGGAAGCGGG + Intergenic
973568958 4:52218366-52218388 TGTTGTGGAGTGGGGGGAGCGGG - Intergenic
973599542 4:52528187-52528209 TGTTGAGGAGTGGGGGGCTAGGG + Intergenic
974922191 4:68255535-68255557 TGTTGAGGGGTGGAGGGCAAGGG + Intergenic
975064111 4:70039938-70039960 TGTTGTGGAGTGGGGGCTGAGGG - Intergenic
975574521 4:75849581-75849603 CGCAGAGCAGTGGAGGCCGCCGG + Intergenic
975805968 4:78112973-78112995 TGTTGTGGGGTGGAGGGAGCGGG - Intronic
977941996 4:102869057-102869079 GGGAGAGGAGTGGACGCCGCTGG + Exonic
977995995 4:103497788-103497810 TGTTGATGAGTGCAGCCAGCTGG + Intergenic
978642969 4:110893103-110893125 TGTTGAGGGGTGGAGGCAAGGGG + Intergenic
980162402 4:129181753-129181775 TGTTGTGGGGTGGAGGGAGCGGG - Intergenic
980350421 4:131676676-131676698 TGTTGTGGGGTGGAGGGAGCGGG - Intergenic
982219224 4:153110774-153110796 TGGAGAGGAGTGGAGGGTGCTGG + Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985548369 5:521057-521079 TCTTTAGCAGTGGAGGCGGCAGG - Intronic
985906464 5:2841454-2841476 TGGGGAGGGGTGGAGGCAGCTGG - Intergenic
987523470 5:19017613-19017635 TGTTGTGGGGTGGAGGCTGGGGG + Intergenic
988357469 5:30197736-30197758 TGTTGAGGGGTGAAGCCAGCTGG + Intergenic
993191886 5:84694235-84694257 TGTTGTGGAGTGGGGGAAGCGGG - Intergenic
993818646 5:92585141-92585163 TGTTGTGGAGTGGGGGTAGCGGG + Intergenic
994087551 5:95776848-95776870 TGAAGAGGAGTGGAGTCTGCAGG - Intronic
995923171 5:117338400-117338422 TGTTGTGGGGTGGAGGGCGGGGG - Intergenic
996161854 5:120176190-120176212 TGTTGTGGGGTGGGGGCCGGGGG - Intergenic
997406529 5:133653305-133653327 TGCTGAGGAGATGAGGCCCCAGG - Intergenic
999370450 5:151052118-151052140 GGGTGAGGAGTGGGGGCTGCAGG - Intronic
1000556929 5:162737382-162737404 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
1001732647 5:173971901-173971923 TTTTGTGGTGTGGAGGCAGCAGG + Intergenic
1003397799 6:5768037-5768059 TGGTCAGGAGTGGAGGACCCTGG - Intronic
1005134679 6:22554520-22554542 TGTTGTGGGGTGGAGGACGCGGG - Intergenic
1006100019 6:31680832-31680854 GGGTCAAGAGTGGAGGCCGCCGG + Intronic
1006882907 6:37354712-37354734 TGTCGAGGAGGGGAGGGCGGGGG + Intronic
1007335678 6:41153660-41153682 TCTTGAGGAGTGGGGGCCCCTGG - Intronic
1007636001 6:43300065-43300087 TGGTGAGGACTGCAGGCAGCTGG + Exonic
1009829470 6:68912514-68912536 TGTTGTGGGGTGGAGGGAGCGGG - Intronic
1010404916 6:75493797-75493819 TGTTGAGGAGCTGAGCTCGCGGG + Intergenic
1010672304 6:78700303-78700325 TGTTGTGGGGTGGAGGCAGCAGG + Intergenic
1011571432 6:88740756-88740778 TGTTGAGGGGTGGAGGACGAGGG + Intronic
1015340396 6:132093239-132093261 TGTTGTGGAGTGGGGGGAGCAGG - Intergenic
1015367128 6:132408553-132408575 TGTTGTGGGGTGGAGGGAGCGGG + Intergenic
1015992280 6:138958493-138958515 TGTTGGGGAGTGGGGGGCGAGGG - Intronic
1016633546 6:146260155-146260177 TGTTGAGGGGTGGGGGCCTAGGG - Intronic
1016916386 6:149247905-149247927 TGTTGAGGGGTAGGGGCAGCGGG + Intronic
1018307354 6:162471509-162471531 TGGTGAGGAGTGGAAGCCACAGG - Intronic
1018382746 6:163274176-163274198 TGTTGGGGGGTGGAGGGAGCGGG - Intronic
1019940793 7:4288293-4288315 TGTTGAGGGGTGGGGGGAGCGGG - Intergenic
1020756666 7:12211506-12211528 TGACAAGGAGGGGAGGCCGCTGG + Intronic
1021148264 7:17116853-17116875 TGTTGAGGGGTGGAGGGTGAGGG - Intergenic
1022672625 7:32470397-32470419 TGTTGTGGGGTGGAGGGAGCAGG + Intergenic
1023100844 7:36716818-36716840 TGTTGTGGGGTGGAGGGAGCGGG + Intronic
1024312409 7:47981024-47981046 TGTTGGGGGGTGGAGGCCTGGGG + Intergenic
1026657456 7:72269354-72269376 TGTTGTGGAGTGGGGGCAGGGGG - Intronic
1027983529 7:85255714-85255736 TGTTGTGGAGTGGGGGCAGGGGG + Intergenic
1028077466 7:86534090-86534112 TGTTGAGGAGTGGAAGGTGAAGG + Intergenic
1029702307 7:102255109-102255131 TGGTGAGGAGCACAGGCCGCCGG - Exonic
1030566779 7:111167329-111167351 GGTTGATGAGTGGAGTCAGCAGG - Intronic
1030589770 7:111466170-111466192 TGTTGTGGGGTGGAGGGAGCGGG + Intronic
1031196474 7:118620897-118620919 TGTTGGGGAGTGGAGGGCTGGGG - Intergenic
1033125884 7:138706719-138706741 TGTTGTTGAGGGGAGGCCGTGGG + Intronic
1033899905 7:146124093-146124115 TGTTGAGGGGTGGAGGGCTAGGG + Intronic
1034155213 7:148950451-148950473 TGTTGCCGAGTGGAGGGCACTGG - Intergenic
1034543331 7:151773922-151773944 TGTTGAAGTGTGGAAGCGGCAGG + Intronic
1035519776 8:266743-266765 TGCGGAGGTGTGGGGGCCGCCGG + Intergenic
1035752130 8:2003142-2003164 TGGTGGGGAGTCGGGGCCGCTGG + Exonic
1036044428 8:5123530-5123552 TGTTGAGGGGTGGAGGGTGAGGG - Intergenic
1040780269 8:51098915-51098937 TGTTGAAGGGTGGAGGGCCCTGG + Intergenic
1042111491 8:65386000-65386022 TGTTGGGGTGTGGAGGCCTGGGG + Intergenic
1046153833 8:110261778-110261800 TGTTGTGGGGTGGAGGGAGCGGG + Intergenic
1048589023 8:135803816-135803838 TGTTGTGCAGTGGGGGCCGGGGG - Intergenic
1048684488 8:136888847-136888869 TGTTGTGGAGTGGGGGGAGCGGG - Intergenic
1049624211 8:143612840-143612862 GGTTGACGGGTGGTGGCCGCTGG + Exonic
1049654394 8:143791407-143791429 TGCTGAGGAGTTGAGGTCCCTGG - Exonic
1050444990 9:5711721-5711743 TGTTGTGGGGTGGGGGCAGCAGG - Intronic
1051324270 9:15947971-15947993 TGTTGTGGGGTGGGGGCAGCGGG - Intronic
1052082477 9:24224794-24224816 TGTTGTGGGGTGGAGGGAGCGGG - Intergenic
1052416371 9:28183299-28183321 TGTTGAGGGGTGGGGGGCGAGGG + Intronic
1053299061 9:36935922-36935944 GGTGGAGGAGTGGAGGCCCTGGG - Intronic
1054835498 9:69672009-69672031 TGCGGAGGAGCGGAGGCAGCAGG - Intronic
1054856076 9:69901011-69901033 TGTTGTGGAGTGGAGGGAGGCGG - Intronic
1055237598 9:74142758-74142780 TGTTGTGGAGTGGGGGGAGCGGG + Intergenic
1055513905 9:77018882-77018904 TGCTGAGGAGTGTGGGGCGCAGG - Intergenic
1060216243 9:121740139-121740161 TGTTGAGGAGGGGAGGGCCAGGG + Intronic
1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG + Exonic
1061876387 9:133546236-133546258 TGGTGGGGAGTGGGGGCTGCAGG + Intronic
1061904195 9:133688284-133688306 TGATGAAGAGTGGAGGGTGCTGG - Intronic
1062033473 9:134372386-134372408 TGGTGTGGAGTGGGGGCCGCAGG + Intronic
1062066151 9:134527404-134527426 TGATGAGGGCTGGAGGCTGCCGG + Intergenic
1062619344 9:137412516-137412538 GTTTGGGGAGTGGTGGCCGCGGG - Intronic
1186993502 X:15094393-15094415 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
1188584224 X:31752696-31752718 TTTTGGGGAGTGAAGGCTGCAGG + Intronic
1190357630 X:49620206-49620228 TGTTGTGGGGTGGAGGGAGCGGG - Intergenic
1191047578 X:56155450-56155472 TGTTGTGGGGTGGAGGAAGCGGG + Intergenic
1192054710 X:67761245-67761267 TGTTGTGGGGTGGAGGGAGCGGG - Intergenic
1192185774 X:68946005-68946027 GGTTGAGGAATGGCGGCAGCCGG - Intergenic
1192454505 X:71265883-71265905 GGTAGAGGAGTGGAGGCTGAGGG - Intergenic
1193784758 X:85747285-85747307 TGTTGAGGGGTGGGGCCCGAGGG - Intergenic
1194096270 X:89642892-89642914 TGTTGGGGGGTGGAGGCCTGGGG + Intergenic
1194613722 X:96075448-96075470 TGTTGAGGGGTGGAGGCCTGGGG - Intergenic
1195198791 X:102525940-102525962 TGTTGGGGAGTGGAGGTCGAGGG + Intergenic
1196044411 X:111242427-111242449 TGTTGAGGAGTGGGGGTCAAGGG - Intergenic
1196277432 X:113783358-113783380 TGTTGGGGGGTGGAGGCCCGGGG + Intergenic
1199095148 X:143729315-143729337 TGTTGAGGGGTGGAGGGTGAGGG + Intergenic
1199477087 X:148257712-148257734 TGTTGAGGGGTGGGGGCCTAGGG - Intergenic
1199662213 X:150063365-150063387 TGTGGTGGAATGGAGGCAGCTGG + Intergenic
1200101493 X:153690926-153690948 TGCTGAGGACTGGAGGCTACTGG + Intronic
1200225091 X:154412738-154412760 TGTTCAGGAGTGGAAGCCCCAGG - Intronic
1200449278 Y:3304261-3304283 TGTTGCGGGGTGGAGGCCTGGGG + Intergenic
1200532920 Y:4359394-4359416 GGTGGAGGAGTGGAGGCTGAGGG + Intergenic
1201238826 Y:11938181-11938203 TGTTGAGGGGTGGAGGGAGGGGG + Intergenic
1201248989 Y:12036710-12036732 TGTTGTGGGGTGGAGGAAGCGGG + Intergenic