ID: 1176117717

View in Genome Browser
Species Human (GRCh38)
Location 20:63440274-63440296
Sequence GGCCAGGTTGGACCTCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176117700_1176117717 29 Left 1176117700 20:63440222-63440244 CCCCAGGGGTTGTGCTTAGTTTC 0: 1
1: 0
2: 1
3: 13
4: 125
Right 1176117717 20:63440274-63440296 GGCCAGGTTGGACCTCCCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 175
1176117702_1176117717 27 Left 1176117702 20:63440224-63440246 CCAGGGGTTGTGCTTAGTTTCTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1176117717 20:63440274-63440296 GGCCAGGTTGGACCTCCCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 175
1176117701_1176117717 28 Left 1176117701 20:63440223-63440245 CCCAGGGGTTGTGCTTAGTTTCT 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1176117717 20:63440274-63440296 GGCCAGGTTGGACCTCCCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176117717 Original CRISPR GGCCAGGTTGGACCTCCCCA AGG Intronic
900641607 1:3690369-3690391 GGCAAGGCTGGGCCACCCCAAGG - Intronic
901314681 1:8298379-8298401 GACCAGGTTGAATCTCTCCAAGG - Intergenic
902737694 1:18412208-18412230 AGCCTGGCTGTACCTCCCCAGGG - Intergenic
904466016 1:30707944-30707966 GGCCAGGAAGGAGCACCCCAAGG - Intergenic
904924815 1:34039197-34039219 GGCCAGGCCTGACCTCCACAGGG - Intronic
907728601 1:57044105-57044127 GGCCAGGTGTCACCTCCTCAGGG + Intronic
909819776 1:80047345-80047367 GGCCAGGTAGGAACTCCCAGGGG + Intergenic
912486732 1:110034893-110034915 GGCCAGGTTGGGCTTCCCGGAGG + Intronic
914974897 1:152352285-152352307 GGCCAGGCTGGATCTCAACATGG - Exonic
915724582 1:158008336-158008358 GACCAGGTGAGGCCTCCCCAAGG - Intronic
916683645 1:167126114-167126136 GGCCTGGGTGGCCTTCCCCAGGG - Exonic
917512997 1:175683593-175683615 GCCCAGGCTGGACATCCACAGGG + Intronic
917840121 1:178970574-178970596 GGCCAGGTGGGACATCTGCAAGG + Intergenic
920631750 1:207659362-207659384 GGGCAGGCTTGACATCCCCATGG + Intronic
921786122 1:219231696-219231718 AGTCTGGTTGGACTTCCCCAGGG - Intergenic
924259072 1:242211428-242211450 GGGCAGGATGGCCCTCTCCAGGG + Intronic
1064530647 10:16306061-16306083 CGCCAGCTTATACCTCCCCATGG + Intergenic
1066669147 10:37818403-37818425 GGCCTGGCTGGAGCTGCCCATGG + Intronic
1067567515 10:47349546-47349568 GGCCAGCATGGACTTCTCCACGG + Exonic
1067660413 10:48233090-48233112 GCCCAGCCTGGACCTCCCCCAGG + Intronic
1071747967 10:88443328-88443350 GGCCATCTTGGAACTGCCCATGG - Intronic
1073495354 10:103885741-103885763 GGCCAGCAAGGAGCTCCCCAGGG + Intronic
1074535977 10:114328920-114328942 GACCAGGTGGGACCTAGCCAGGG + Intronic
1076634775 10:131875202-131875224 GGCGAGTATGCACCTCCCCAGGG + Intergenic
1077332351 11:1989190-1989212 GACCAGGTGGGACTTTCCCACGG - Intergenic
1077486972 11:2843436-2843458 GACCAGGCAGGGCCTCCCCAGGG - Intronic
1078017261 11:7625566-7625588 GGCCATCCTGGCCCTCCCCACGG - Intronic
1078018998 11:7640006-7640028 GGGGAGGTGGGACCACCCCAAGG - Intronic
1083284698 11:61650967-61650989 GGCCAGAGGGGACCTCCCCCAGG + Intergenic
1084474003 11:69378476-69378498 GTCCAGGCTGTGCCTCCCCATGG - Intergenic
1088595576 11:111438041-111438063 GGTCAGCTTGGACATCTCCAAGG - Intronic
1089581770 11:119485798-119485820 GGCCTGTTTGGAACTACCCATGG + Intergenic
1089824634 11:121264292-121264314 GGCATATTTGGACCTCCCCAGGG - Intergenic
1090086396 11:123654407-123654429 GGCCCCGCTGCACCTCCCCAGGG - Exonic
1090420500 11:126572076-126572098 GACCAGGCTGAGCCTCCCCAGGG - Intronic
1202815332 11_KI270721v1_random:44366-44388 GACCAGGTGGGACTTTCCCACGG - Intergenic
1096059665 12:48686054-48686076 GGACAGGTTGGAAGTACCCAAGG - Intergenic
1097573144 12:61357085-61357107 AGCCAGGTGGGACCTGCCCCAGG - Intergenic
1099104627 12:78483272-78483294 ATCAAGGCTGGACCTCCCCAAGG + Intergenic
1104729193 12:131095602-131095624 GGCCAGACTGGACGTTCCCAGGG + Intronic
1105288893 13:19033304-19033326 AGCCAGTGTGGCCCTCCCCAGGG + Intergenic
1106766528 13:32918914-32918936 GGTAAGGCTGGTCCTCCCCAGGG - Intergenic
1113952858 13:114081324-114081346 GTCCAGGCCGGGCCTCCCCAGGG + Intronic
1116869252 14:50056019-50056041 GGCCTGGTTTGACCTAACCATGG - Intergenic
1122889706 14:104726598-104726620 GGTCTGGCTGGATCTCCCCAGGG + Intronic
1123035437 14:105469987-105470009 GACCAGGTGGGGCCTTCCCAGGG + Exonic
1123116949 14:105899162-105899184 GGCAGGGTTGGGTCTCCCCAGGG + Intergenic
1123121232 14:105918027-105918049 GGCAGGGTTGGGCCTCCCCAGGG + Intronic
1123403960 15:20009691-20009713 GGCAGGGTTGGGCGTCCCCAGGG + Intergenic
1123513300 15:21016337-21016359 GGCAGGGTTGGGCGTCCCCAGGG + Intergenic
1128773523 15:70301607-70301629 GGCCAGGGTGGGGCTGCCCAGGG - Intergenic
1132615684 16:840227-840249 GGCCAGGCTGCCCCTCCACAGGG - Intergenic
1133277576 16:4648054-4648076 GGCCAGGTGGGCCCTTCCCGGGG - Intronic
1133395083 16:5440552-5440574 GGCCAGATTGGAACTCTCCATGG + Intergenic
1134215034 16:12310817-12310839 GGCAAGGTGGGAACTGCCCAGGG + Intronic
1136621999 16:31435812-31435834 GGCCAGGTTGGACCTCCGGCTGG + Exonic
1136687322 16:32003001-32003023 GGGCAAGCTGGACTTCCCCAGGG - Intergenic
1136787934 16:32946552-32946574 GGGCAAGCTGGACTTCCCCAGGG - Intergenic
1136881848 16:33907237-33907259 GGGCAAGCTGGACTTCCCCAGGG + Intergenic
1140010826 16:71129927-71129949 GGCAAGGAGGGACCACCCCAGGG - Intronic
1203090163 16_KI270728v1_random:1208209-1208231 GGGCAAGCTGGACTTCCCCAGGG - Intergenic
1143351382 17:6290795-6290817 GGCCAGGTAGGAATACCCCATGG + Intergenic
1143796639 17:9342330-9342352 AGCCAGGTTGGAGCTCTCCAAGG + Intronic
1144025878 17:11275276-11275298 GGCAAGGTTGGACCCTCCAAAGG + Intronic
1144452326 17:15391355-15391377 GGCCAGCTGGGGCCTCCCCTGGG - Intergenic
1145717759 17:27038833-27038855 AGCCAGTGTGGTCCTCCCCAGGG + Intergenic
1146353547 17:32115856-32115878 GACCACGGTGGCCCTCCCCAAGG + Intergenic
1148189718 17:45670011-45670033 GGGGAGCTTGGACCTCCTCAGGG - Intergenic
1148955931 17:51353605-51353627 GGCCAGGTGGGGCATCCTCATGG + Intergenic
1149662676 17:58343449-58343471 TGCCCGCTTTGACCTCCCCAAGG + Intergenic
1149991788 17:61387595-61387617 GGCCAGGATGGACAGCCCCCAGG - Intronic
1150259378 17:63775634-63775656 GGCCAGCTTTGTCCTCCTCAAGG - Intronic
1150376004 17:64682141-64682163 GGTAAGGCTGGACTTCCCCAGGG + Intergenic
1150595723 17:66602789-66602811 GGCCAGGTTGGAGGTTCTCAGGG - Intronic
1152458162 17:80427824-80427846 GGCCAGGCTGGGCCGCTCCAGGG + Intronic
1152918951 17:83056083-83056105 GACCTGGTTCGACCTCCCCTAGG + Intergenic
1153059360 18:979857-979879 GCCCAGTTTGAACTTCCCCATGG + Intergenic
1154470828 18:14699324-14699346 AGCCAGTGTGGCCCTCCCCAGGG - Intergenic
1158114541 18:53979827-53979849 GGCCATCTTGGAACTGCCCACGG + Intergenic
1158409257 18:57190177-57190199 GGTCAGGCTGGACCTCCAGATGG + Intergenic
1160809710 19:1008092-1008114 GGCCAGGTGGGACAGCCCCAGGG - Intronic
1161404274 19:4082966-4082988 AGCCAGGCTGGGCCTCTCCAAGG + Intergenic
1161591789 19:5132264-5132286 GGGGAGCTTGTACCTCCCCATGG + Intronic
1161848448 19:6725776-6725798 GGAGGGGTTGGACCTTCCCAGGG - Intronic
1162464082 19:10830336-10830358 GGCCAGTTCGGATCCCCCCAGGG + Exonic
1163488976 19:17605963-17605985 GCCTTGGTGGGACCTCCCCAGGG - Exonic
1167786080 19:51637220-51637242 GGCCAGGCTGGCCCACCTCAGGG + Intronic
926212344 2:10880355-10880377 GAACAGGATGGAGCTCCCCATGG + Intergenic
927574626 2:24190853-24190875 GGCCAGGTTGGCCCTCACCTCGG - Exonic
930065034 2:47321398-47321420 GGTCACTTTGGACCTCACCATGG + Intergenic
932294453 2:70612807-70612829 GGCCAGGGTGGAACTTCTCATGG - Intronic
934751493 2:96797006-96797028 GGCCAGGTGGGACTTCCCTGTGG - Exonic
934755966 2:96825052-96825074 GGCCAGGTGGGACTTCCCTGTGG - Exonic
935123520 2:100202388-100202410 GGCCAGGTTGGTCTTCCTCAAGG - Intergenic
935226063 2:101054228-101054250 GGCCAGGTTCAACTTCCCCGAGG - Exonic
938237804 2:129720916-129720938 GCACTGGTTGGACCTCCACACGG - Intergenic
943116549 2:183679062-183679084 GGACAGGATGGCCCTCTCCAGGG + Intergenic
945486878 2:210406957-210406979 GCCCAGTTTGAACTTCCCCATGG + Intergenic
948723505 2:239918288-239918310 GGCCAGGGAGGCCCTCACCAAGG + Intronic
1172029744 20:31973566-31973588 GGTCAGGGTGGACCTCTCCAAGG + Intronic
1172962968 20:38811665-38811687 GGGCAGTTTGACCCTCCCCAGGG + Intronic
1173923318 20:46762084-46762106 AGGCAGGTTGGAACACCCCAAGG + Intergenic
1173989653 20:47292024-47292046 GACCAATTTGGAGCTCCCCACGG - Intronic
1174452021 20:50626281-50626303 GGCCAGGTGGGGGCTGCCCAGGG + Intronic
1175243039 20:57563626-57563648 GGCCAGGTTGGTCTTCCCGCAGG - Exonic
1175877339 20:62236643-62236665 GGGCAGGTTGGATCCCCTCAAGG + Intronic
1175981402 20:62740599-62740621 GGCCAGGTGGGGGCTCCCCTGGG - Intronic
1176117717 20:63440274-63440296 GGCCAGGTTGGACCTCCCCAAGG + Intronic
1176419162 21:6500087-6500109 TGCCAGGTGCGACCTCCCCGGGG + Intergenic
1176803656 21:13458613-13458635 AGCCAGTGTGGCCCTCCCCAGGG + Intergenic
1177544299 21:22535908-22535930 GGCCTGGTTCCAACTCCCCAGGG + Intergenic
1178898925 21:36583692-36583714 GGCCAGGTTGGGGGTGCCCATGG + Intergenic
1179580198 21:42338630-42338652 GGCCAGGCTGCACCTCCCTGTGG + Intergenic
1179694655 21:43108409-43108431 TGCCAGGTGCGACCTCCCCGGGG + Intergenic
1179913325 21:44461354-44461376 GGCCAGATTCCACTTCCCCAGGG - Exonic
1180085033 21:45504612-45504634 GGCCGGGCTGGACCTGCCCTCGG - Intronic
1180094972 21:45552254-45552276 GGCCAGGATGTAGCTCCCCTGGG - Intergenic
1180199611 21:46216372-46216394 CGCCAGGTAGGACCTCATCAGGG - Exonic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1182311999 22:29415958-29415980 GGTCAGATTGGACCTTCCCGTGG + Intronic
1182688260 22:32137285-32137307 GGTCAGATTGGACCTTCCCGTGG - Intergenic
1182695673 22:32198057-32198079 GGTCAGATTGGACCTTCCCACGG + Intronic
1182839549 22:33376999-33377021 TGCCAGGATGGACCTCTCCCAGG - Intronic
1183089127 22:35509503-35509525 GGTCAGGTTGCGCCTCTCCAGGG - Intergenic
1184045917 22:41972046-41972068 GGCTAGGTAGGAACTCACCAGGG - Intergenic
1185202695 22:49517708-49517730 GGCCAGGCTGGCCTTCACCATGG - Intronic
1185339833 22:50286337-50286359 GGCCAGGCTGGGCCTCCCCTGGG + Intronic
950038307 3:9902931-9902953 TGCCAGTCTGGAGCTCCCCATGG - Exonic
950117405 3:10460278-10460300 TGCCAGCTTTGTCCTCCCCAGGG - Intronic
950335445 3:12189271-12189293 GTACAGGCTGGGCCTCCCCATGG + Intronic
950521346 3:13499800-13499822 GGCCTGGATGGCCCTCCCCATGG + Intronic
951310928 3:21125234-21125256 GCCCAGTTTGAACTTCCCCATGG - Intergenic
952509694 3:34040568-34040590 TGCCTGGTTGGAGGTCCCCAGGG + Intergenic
952854030 3:37752739-37752761 AGGCAGGTTGGTCCTGCCCAGGG - Intronic
953574086 3:44098912-44098934 GGCCAGGACGCACCTCCCCCAGG + Intergenic
961166314 3:124766242-124766264 GGTCAGGTTGGACTTCCCACTGG + Exonic
963855566 3:150249837-150249859 GGCCAGGTTGGGCATACCAATGG - Intergenic
965849656 3:173009240-173009262 GGCCAAGTTGGAATTCACCAAGG + Intronic
968516502 4:1017802-1017824 GGCCAGGTGGCTCCTCCCCATGG - Intronic
968519175 4:1028026-1028048 GGACAGGCTGCCCCTCCCCAGGG + Intergenic
968911557 4:3479140-3479162 GGGCAGGAAGGACCTTCCCATGG - Intronic
974402600 4:61425617-61425639 GCCCAGGGTGGTGCTCCCCATGG + Intronic
974697068 4:65389897-65389919 GGCAAGGTTTGACCTCCCTGTGG - Intronic
979392653 4:120144776-120144798 GGCCTGGTAGGAGATCCCCAGGG + Intergenic
981459490 4:144996465-144996487 GGTCAGTTGGGACCTTCCCAGGG - Intronic
982321575 4:154082514-154082536 GTTCAGGTTGCATCTCCCCAAGG + Intergenic
985775324 5:1838134-1838156 GTCCAGGTGGGACCCTCCCAAGG - Intergenic
994346887 5:98697655-98697677 TGGGAGGTTGGACCTCCCCTGGG - Intergenic
996036283 5:118762518-118762540 CACCAGGTGGGGCCTCCCCATGG + Intergenic
997586953 5:135048954-135048976 GGCCAGGTGGGAACCCCACAAGG - Intronic
997740228 5:136246511-136246533 GGGCATGATGGACCTCTCCAGGG - Intronic
998495315 5:142583420-142583442 GGCCATGTTGGATTTGCCCAAGG + Intergenic
999421403 5:151447764-151447786 GGCGAGGTGGGTCCTGCCCAAGG - Exonic
999804115 5:155066285-155066307 GGCCAGGTTGGATAAACCCATGG + Intergenic
1000842023 5:166231833-166231855 GGCCAGCTTGTAACTCCTCAAGG + Intergenic
1005885486 6:30094353-30094375 GGCCAGGCTTGTCCACCCCACGG - Intergenic
1008940534 6:57041074-57041096 GCCCAGGATGGACCTGCCCTGGG + Intergenic
1015008958 6:128320112-128320134 GGCCAGGCTGGAACTCACCCAGG + Intronic
1017061422 6:150488539-150488561 GGCCAGGTTGGTCATCCCAGTGG - Intergenic
1019315890 7:386410-386432 CGCCAGGTTGGAGCTCCCTTAGG + Intergenic
1021947501 7:25742726-25742748 GGCCAGGTCAGACCTGCTCAAGG + Intergenic
1024902508 7:54336492-54336514 GGCTAGGTAGGGCCTCTCCAGGG - Intergenic
1025181314 7:56825223-56825245 GCCCAGGTTGGGCCTCCCGGCGG - Intronic
1026901617 7:74040466-74040488 AGCCAGGGGGGACCTCTCCAGGG + Intronic
1032504355 7:132424426-132424448 AGCCTGGTTGGACGTCCACAAGG - Intronic
1035220242 7:157402234-157402256 GGCCAGGGTGGACCCCGCCTGGG - Intronic
1038443085 8:27585265-27585287 GGCCAGGAAGGAACTCACCAAGG - Intergenic
1038487960 8:27949974-27949996 GGCCCTGGTGGACCTGCCCAAGG - Intronic
1039984967 8:42439379-42439401 GGCCCAGCTGGTCCTCCCCAGGG + Intronic
1041856974 8:62468444-62468466 GGCCAGGTAAGAGCTCACCAGGG + Intronic
1041902982 8:63002466-63002488 CGCCAGGCTGGAGCTCACCATGG + Intergenic
1042918888 8:73902166-73902188 TGCCAGGGTGGACCTGCCCCAGG + Intergenic
1048461726 8:134626727-134626749 GGGCATGCTGGAGCTCCCCATGG + Intronic
1052647388 9:31254106-31254128 GGCCAGGTTGCCCCTCCAGAAGG - Intergenic
1057273799 9:93665612-93665634 GGACAGGTAGGACCTCCCGAGGG - Intronic
1058899611 9:109430826-109430848 GGCCAGGCTGGAGCTGGCCATGG - Intronic
1060017667 9:120100718-120100740 GGCCTGGTTGGTCCTCTGCAGGG - Intergenic
1060331490 9:122675128-122675150 TGTCAGGTTGGACATTCCCATGG - Exonic
1061009439 9:127946381-127946403 GACTAGGTGGGACCTACCCAGGG + Intronic
1061579692 9:131529430-131529452 GGCCAGCTAGGACGTCCCCTCGG - Intronic
1062253182 9:135608526-135608548 GGCCACCTGAGACCTCCCCACGG + Intergenic
1062357389 9:136171258-136171280 GGCCAGGGAGGGCCTCCCCTGGG - Intergenic
1062385461 9:136309289-136309311 GGCCTGCTTGGGCCTGCCCAGGG - Intergenic
1062429747 9:136521657-136521679 GGCCAGCTTGGATCTCTGCAGGG - Intronic
1062639691 9:137512321-137512343 GGCATGGATGGACCTCCCCACGG + Intronic
1062641915 9:137523133-137523155 GGAGTGGTTGGAACTCCCCATGG - Intronic
1189033288 X:37471133-37471155 TGACAGGTTGGCCTTCCCCATGG + Intronic
1200096693 X:153667910-153667932 CCCAAGGTTGGACTTCCCCAAGG + Intergenic
1200573468 Y:4861689-4861711 GCCCAGTTCGGACTTCCCCAAGG + Intergenic
1202095384 Y:21243991-21244013 GGCCAGGTTGGCCCCTGCCATGG + Intergenic