ID: 1176117717

View in Genome Browser
Species Human (GRCh38)
Location 20:63440274-63440296
Sequence GGCCAGGTTGGACCTCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176117701_1176117717 28 Left 1176117701 20:63440223-63440245 CCCAGGGGTTGTGCTTAGTTTCT No data
Right 1176117717 20:63440274-63440296 GGCCAGGTTGGACCTCCCCAAGG No data
1176117700_1176117717 29 Left 1176117700 20:63440222-63440244 CCCCAGGGGTTGTGCTTAGTTTC No data
Right 1176117717 20:63440274-63440296 GGCCAGGTTGGACCTCCCCAAGG No data
1176117702_1176117717 27 Left 1176117702 20:63440224-63440246 CCAGGGGTTGTGCTTAGTTTCTC No data
Right 1176117717 20:63440274-63440296 GGCCAGGTTGGACCTCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176117717 Original CRISPR GGCCAGGTTGGACCTCCCCA AGG Intronic