ID: 1176120320

View in Genome Browser
Species Human (GRCh38)
Location 20:63451671-63451693
Sequence ATTCACGACGGACACCCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176120313_1176120320 21 Left 1176120313 20:63451627-63451649 CCTTCAGCCAAGAACAAGAGGGT 0: 1
1: 0
2: 0
3: 15
4: 156
Right 1176120320 20:63451671-63451693 ATTCACGACGGACACCCCCACGG 0: 1
1: 0
2: 0
3: 2
4: 31
1176120311_1176120320 22 Left 1176120311 20:63451626-63451648 CCCTTCAGCCAAGAACAAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1176120320 20:63451671-63451693 ATTCACGACGGACACCCCCACGG 0: 1
1: 0
2: 0
3: 2
4: 31
1176120315_1176120320 14 Left 1176120315 20:63451634-63451656 CCAAGAACAAGAGGGTGGCCATG 0: 1
1: 0
2: 0
3: 15
4: 209
Right 1176120320 20:63451671-63451693 ATTCACGACGGACACCCCCACGG 0: 1
1: 0
2: 0
3: 2
4: 31
1176120317_1176120320 -4 Left 1176120317 20:63451652-63451674 CCATGCTGTTCCAGGCTCGATTC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1176120320 20:63451671-63451693 ATTCACGACGGACACCCCCACGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176120320 Original CRISPR ATTCACGACGGACACCCCCA CGG Intronic
900956216 1:5887871-5887893 ATCCAGGACGGAAACCCCAATGG + Intronic
902237063 1:15064277-15064299 ATTCGCAACGGAGACCACCAGGG + Intronic
903424996 1:23246812-23246834 ATTCAGGACAGAAATCCCCAAGG - Intergenic
914241748 1:145857463-145857485 ATTCAAGCCAGACAGCCCCACGG + Intronic
920121459 1:203661783-203661805 AGTCACCACAGACACGCCCAGGG - Intronic
1063336135 10:5216250-5216272 ATTCATGAGGGATGCCCCCAGGG + Intronic
1088468667 11:110170620-110170642 ATTCACCAAGGACAGTCCCAAGG - Exonic
1120611580 14:86647632-86647654 ATACAAGACGACCACCCCCAAGG + Intergenic
1122968919 14:105144547-105144569 ATTCACATCTGACACCCCCCAGG + Intronic
1127300327 15:57646710-57646732 ATTCAGGAAGGACACCTTCAGGG - Intronic
1128079210 15:64846152-64846174 CATCACCACTGACACCCCCAGGG - Intronic
1144339898 17:14302382-14302404 ATTCGAGTCGGATACCCCCATGG - Intronic
1152922679 17:83073713-83073735 AGTCTCCACGGACAGCCCCAGGG - Intergenic
1164929980 19:32168040-32168062 ATTCAAGACAGCCACACCCAGGG + Intergenic
935940228 2:108230004-108230026 ACTTACTACTGACACCCCCATGG + Intergenic
947621334 2:231593110-231593132 CTTCAAGACGGCCACCCCCAGGG + Exonic
1176120320 20:63451671-63451693 ATTCACGACGGACACCCCCACGG + Intronic
1176201116 20:63861026-63861048 ATTTAAGATGGACAGCCCCACGG - Intergenic
1180785977 22:18548088-18548110 ATGCAGGAGGGACAGCCCCAGGG + Intergenic
1181131260 22:20733813-20733835 ATGCAGGAGGGACAGCCCCAGGG + Exonic
1181242900 22:21487642-21487664 ATGCAGGAGGGACAGCCCCAGGG + Intergenic
959382569 3:105659148-105659170 ATTCACCACAGAAAACCCCATGG - Exonic
998279082 5:140787615-140787637 ATTCACGTCGGCCACCTCCACGG - Exonic
998280496 5:140802522-140802544 GTTCACGTCGGCCACCTCCACGG - Exonic
998283514 5:140835708-140835730 GTTCACGTCGGCCACCTCCACGG - Exonic
998286796 5:140870425-140870447 GTTCACGTCGGCCACCTCCACGG - Exonic
998287434 5:140876797-140876819 GTTCACGTCGGCCACCTCCACGG - Exonic
998313413 5:141157311-141157333 ATTGACGTCGGAGACCCGCAGGG - Intergenic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1044663253 8:94611989-94612011 GTTCACGACAGATACTCCCAGGG - Intergenic
1048437459 8:134431726-134431748 TTTCACGACGCACATCTCCAGGG - Intergenic
1048868159 8:138776068-138776090 TTTCTCCATGGACACCCCCACGG - Intronic
1062631723 9:137466104-137466126 ATGCACCAGGGACAGCCCCACGG + Intronic
1187965583 X:24608227-24608249 ATTCAGGACTGCCACACCCAAGG - Intronic