ID: 1176121039

View in Genome Browser
Species Human (GRCh38)
Location 20:63454724-63454746
Sequence CAGGGGAGGGAGAGGGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1800
Summary {0: 1, 1: 1, 2: 10, 3: 155, 4: 1633}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176121031_1176121039 -8 Left 1176121031 20:63454709-63454731 CCTCTGCCTCTGAACCAGGGGAG 0: 1
1: 1
2: 2
3: 30
4: 308
Right 1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG 0: 1
1: 1
2: 10
3: 155
4: 1633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176121039 Original CRISPR CAGGGGAGGGAGAGGGCGGC AGG Intronic
900018183 1:169071-169093 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900048442 1:527667-527689 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900070668 1:769519-769541 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900096910 1:943466-943488 TTGGGGAGGGAGAGGGCGTTGGG - Intronic
900140326 1:1137053-1137075 CAGGGCGGGGAGGGCGCGGCCGG + Intergenic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900425452 1:2576324-2576346 CAGGGCAGAGAGAGGGCGCTTGG + Intergenic
900462970 1:2810194-2810216 TAGGGGAGGGCGGGGGCTGCAGG - Intergenic
900600893 1:3502226-3502248 GAGGGGAGGGGCAGGGCTGCTGG + Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900622763 1:3594944-3594966 CAGGGCAGGGAGAGGGACTCAGG + Intronic
900637261 1:3672061-3672083 CAGGGTAGGGAGTGGTCAGCAGG + Intronic
900774520 1:4572180-4572202 CAGGGGAGGGGAAGAGTGGCAGG + Intergenic
900887967 1:5428876-5428898 GAAGGGAGGGAGAGGGGGGGAGG + Intergenic
901035640 1:6334442-6334464 CAGGGGAGGGGCAGGGGGGACGG + Intronic
901078827 1:6572128-6572150 GAGGGCAGGGAGAGGCCAGCAGG - Intronic
901214893 1:7549800-7549822 AATGGGAGGGTGAGGGCGGGAGG + Intronic
901646689 1:10720706-10720728 CTGGGGAGAGGGAGGACGGCTGG + Intronic
901650221 1:10738719-10738741 GAGGGGGAGGAGAGGGAGGCAGG + Intronic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
901759776 1:11463246-11463268 GCGGGGAGGGAGAGAGAGGCAGG - Intergenic
901974357 1:12932518-12932540 CAGAGGAGAGAGATGGCAGCAGG - Intronic
902010817 1:13269250-13269272 CAGAGGAGAGAGATGGCAGCAGG + Intergenic
902018442 1:13327509-13327531 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018448 1:13327528-13327550 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018454 1:13327547-13327569 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018460 1:13327566-13327588 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018466 1:13327585-13327607 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018472 1:13327604-13327626 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018478 1:13327623-13327645 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018484 1:13327642-13327664 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
902018490 1:13327661-13327683 CATGAGAGGGAGAGGGAGACGGG - Intergenic
902219884 1:14958097-14958119 CAGGGGAGGGAGCAGGCAGAGGG - Intronic
902301063 1:15503009-15503031 CCGGGGTGGGAGCGGGGGGCAGG + Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902805013 1:18855561-18855583 CAAGGGAGGGGGAGAGCAGCTGG - Intronic
902829332 1:19000076-19000098 AAGGGGAGGGGGAGGGGAGCGGG + Intergenic
902920967 1:19665712-19665734 CAAGGGAGTGATAGGGTGGCGGG - Exonic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903169216 1:21541710-21541732 TAGGGTAGGGAGAGGGCAGGGGG + Intronic
903221897 1:21873896-21873918 CAGGGGGTGGAGAGGGTGGGGGG - Intronic
903277809 1:22232930-22232952 GAGGGGGAGGAGAGGGCTGCAGG - Intergenic
903284024 1:22266158-22266180 CAGGTGAGGGGGAGGGTGGGAGG + Intergenic
903302740 1:22390773-22390795 TAGGGGAGGGAGGTGGAGGCTGG - Intergenic
903372996 1:22848868-22848890 CAAGGCAGGGAGAGAGAGGCAGG + Intronic
903588776 1:24438459-24438481 CAGGGACGGGAGAGGGCAGGAGG - Intronic
903625952 1:24730316-24730338 GAGGGGAGGGGGAGGGGGGAGGG + Intergenic
903638146 1:24834793-24834815 CATGAGAGGGAGAGGGAGACGGG + Intronic
903638152 1:24834812-24834834 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638158 1:24834831-24834853 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638164 1:24834850-24834872 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638174 1:24834882-24834904 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638192 1:24834939-24834961 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903638202 1:24834971-24834993 CGGGAGAGGGAGAGGGAGACGGG + Intronic
903687967 1:25146458-25146480 CAAGGGAGGGAGAGAGTGGGAGG - Intergenic
903762891 1:25711658-25711680 CAGGGGAGGGGCGGGGCCGCAGG - Intronic
903777198 1:25800505-25800527 CGGGGGAGGCGGAGGGCGGAGGG + Intronic
903810172 1:26030957-26030979 CAGAGGTGGGAGATGGTGGCAGG - Intronic
903858950 1:26353872-26353894 AAAGGGAGGGAGAGGAAGGCAGG + Intronic
903921800 1:26804847-26804869 AAGGAGAGGGAGAGGGAGACGGG + Intergenic
903921806 1:26804866-26804888 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
903921812 1:26804885-26804907 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
903956833 1:27031717-27031739 CGGGGGAGGGAGAGAGTGGGAGG + Intergenic
904051115 1:27639506-27639528 AGAGGGAGGGAGAGGGAGGCCGG - Intergenic
904364481 1:30001743-30001765 CACAGGAGGGAGAGAGGGGCAGG - Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904407397 1:30301378-30301400 CAGGGGAGGGAGGGGAGGGGAGG + Intergenic
904420694 1:30389363-30389385 CAGGGCAGGGTGAGGCCAGCAGG + Intergenic
904591265 1:31616827-31616849 CAGGGGAGGGAGACTGTGTCTGG + Intergenic
904784137 1:32973052-32973074 CCAGGGAGGGAAAGGGAGGCTGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904924578 1:34037413-34037435 CGGGGGAGGGAAAGGGCAACTGG - Intronic
905463071 1:38134002-38134024 CCGAGGAGGGAGGCGGCGGCCGG + Intergenic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905643799 1:39610327-39610349 CTGGGGAGGCGCAGGGCGGCTGG - Intergenic
905789794 1:40783965-40783987 CCGGGGCGGGCGCGGGCGGCGGG - Intergenic
906034355 1:42741257-42741279 TTGGGGACGGAGGGGGCGGCGGG - Intergenic
906069656 1:43007658-43007680 GAGGGGAAGGAGGGGGCCGCGGG - Intergenic
906078401 1:43068386-43068408 CCGGGCCGGGAGGGGGCGGCGGG + Intergenic
906088574 1:43157403-43157425 CAAGGAAGGGAGGGGGCGGAAGG + Intergenic
906135970 1:43501231-43501253 GGGGGGAGGGAGAGGGAGACGGG - Intergenic
906527073 1:46500170-46500192 CTGGGGAGGGGGAGGGCATCAGG + Intergenic
906544938 1:46613984-46614006 TGGAGGAGGGGGAGGGCGGCAGG + Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907110634 1:51923347-51923369 CAGGAGAGGGAGAGGCTGGCAGG + Intronic
907245446 1:53105687-53105709 GAGGGGAGGGAAGGGGCAGCAGG - Intronic
907429783 1:54405467-54405489 CAGGGAAGGGAGAGCGCTCCCGG + Intronic
907865523 1:58396120-58396142 CAGGGGAGGGAGGGGAGGGGGGG + Intronic
908393284 1:63702799-63702821 CTGGAGTGGGAGAGGGAGGCAGG + Intergenic
908437523 1:64121195-64121217 CAGGGGAGGAGGAGGGAGGGAGG - Intronic
909443590 1:75724400-75724422 CGGGGGAGGGGGACGGCGGCGGG - Intronic
909456404 1:75854576-75854598 CAGAGCAGGGAGAGGACGGACGG - Intronic
910120211 1:83779841-83779863 CAAGAGAGGGAGAGGGAGACAGG + Intergenic
910138280 1:83998700-83998722 TGGGGGAGGGAGAGGGCGGAGGG - Intronic
911082659 1:93949212-93949234 CAGAGGAGGGAGAGGGCAAGGGG + Intergenic
911208618 1:95117551-95117573 CCGAGCCGGGAGAGGGCGGCGGG - Exonic
911600500 1:99843154-99843176 CATGGGAGGGAGGGCACGGCAGG + Intergenic
911820337 1:102411303-102411325 CAGGGGAGGGGGAGGGGAGGAGG + Intergenic
912948816 1:114106582-114106604 CAGAGAAGGGAGAGAGCAGCAGG - Intronic
914054940 1:144161331-144161353 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
914124206 1:144805030-144805052 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915469141 1:156115305-156115327 CGGGGAGTGGAGAGGGCGGCGGG + Intronic
915530506 1:156500061-156500083 GAGAGGAGGGAGAGGGAGGGAGG + Intronic
915551673 1:156638840-156638862 CAGGGGAGGGAGAAAGAGGGAGG - Intergenic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915658357 1:157380516-157380538 GAGGGGAGGGAGAGCCCAGCAGG - Intergenic
915722163 1:157993546-157993568 CAGGGGCGGGCGCGGGCGGGCGG + Intronic
915921396 1:159978269-159978291 TAGGGGTGGGAGATGGGGGCAGG + Intergenic
915994646 1:160550416-160550438 GAGGGGAGGGAGGGGCAGGCAGG + Intronic
916060973 1:161098508-161098530 CCGGGGAGAGGGAGGGCGGTGGG - Exonic
916427946 1:164699630-164699652 CAGGGGATGGAGAGGACGGAGGG + Intronic
916605938 1:166342976-166342998 GGGGGGAGGGAGCGGGAGGCGGG + Intergenic
916720768 1:167483409-167483431 CAGGGTAGGGAGGGGGAGGGAGG - Intronic
916759501 1:167803810-167803832 GAGGGGAGGGAAAGGGGGGAGGG - Intergenic
917114788 1:171591864-171591886 CAGGGGATTGGGAGGGGGGCGGG + Exonic
917122218 1:171654819-171654841 CAGGGGAGGTGGAGGGGGACAGG - Intergenic
917142750 1:171853843-171853865 AAGGGGAGGGAGGGGACTGCAGG - Intronic
917722855 1:177802653-177802675 CAGGGGAGGGAAAGGAGGCCAGG - Intergenic
917968524 1:180193377-180193399 CAGAGGAGAGAGAGAGAGGCAGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
919486974 1:198157467-198157489 CAGCGGTGGGAGGGGGCGGCAGG + Intronic
919741046 1:200981824-200981846 TAGGGGAGCGAGAAGGAGGCTGG + Intronic
920181140 1:204132161-204132183 TAGGGGAGGGATGGGGTGGCTGG + Exonic
920188910 1:204179791-204179813 CAGGGGAGGTCGAGGGTGGAGGG + Intergenic
920434957 1:205941670-205941692 CAGAGGAGGGAGAGTTCGCCTGG - Intronic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920535178 1:206732460-206732482 AAGGGCAGGGTGAGGGCGGCAGG - Intronic
920657581 1:207888012-207888034 CAGGGGTGGGAGAAGGGGGAGGG + Intronic
920676511 1:208042062-208042084 CAGTGGGTGGAGAGGGTGGCAGG - Intronic
922088188 1:222370673-222370695 CAGAGGAGAGAAAGGGCTGCAGG + Intergenic
922106029 1:222514934-222514956 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
922196479 1:223364203-223364225 CTGGGGAGGGAGCGCGCGGGCGG - Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922408115 1:225339895-225339917 CAGAGGAGGAAGAGGGAAGCTGG - Intronic
922436777 1:225614991-225615013 CCGTGGAGGGAGAGGGAGACCGG - Intronic
922455937 1:225773553-225773575 CAGGGGAGGCAGAGGAGGTCAGG + Intergenic
922730474 1:227946726-227946748 CCGGGCAGGGAGAGGCCGCCTGG - Intronic
922856372 1:228778526-228778548 CAGGGCAGGGGGAGGGGGGAGGG - Intergenic
923007847 1:230066858-230066880 CGGGGGAGGGGGCGGCCGGCGGG + Intronic
923009551 1:230077264-230077286 GAGGGGAAGGAGAGTGCGGCAGG - Intronic
923161267 1:231316900-231316922 GAGGGGATGGAAAGGGAGGCAGG - Intergenic
924619555 1:245648950-245648972 CAGGGCAGGGCAAGGGCAGCTGG - Intronic
924645341 1:245872429-245872451 CCGGTGAAGGAGAAGGCGGCAGG - Intronic
924740176 1:246790248-246790270 CAGGGAGGGGAGAGGGCTGCTGG + Intergenic
1062786854 10:271934-271956 CAGGGGAGGGAGGGTGCAGGAGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062992919 10:1836808-1836830 CAGGTGGGAGAGGGGGCGGCAGG - Intergenic
1063074017 10:2696306-2696328 CAGGGGTTGGTGAGGGTGGCTGG - Intergenic
1063353136 10:5374258-5374280 GAGGGGAGGGCGAGGGGGGGAGG + Exonic
1063357333 10:5412977-5412999 CAGGGGGAGGCGAGGGCCGCTGG + Intronic
1063362020 10:5466889-5466911 GAGGGGAGGGGGAGGCCGGGAGG + Intergenic
1063401652 10:5752087-5752109 AAGGGTAGGGGGAGGGCAGCTGG - Intronic
1063508408 10:6622973-6622995 CGGGGGAGGGAGTGAGCAGCTGG + Intergenic
1063847549 10:10148019-10148041 AAGGGGAGGGAGAGAGAGACAGG - Intergenic
1063984189 10:11483624-11483646 AAGGGGAGGGAGAGGGGGAGGGG + Intronic
1064106855 10:12507696-12507718 CAGGGGAGGGACCGGGCTGGTGG - Intronic
1064576256 10:16748839-16748861 CATGGAAGGGAGAGCCCGGCTGG - Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065115259 10:22477605-22477627 CTGGGGAGGGAGCGGGCTGCAGG - Intergenic
1065758410 10:28957293-28957315 CAGGGGTGGGAGTGGGGGGAGGG + Intergenic
1065840140 10:29695785-29695807 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840150 10:29695817-29695839 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840164 10:29695861-29695883 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840170 10:29695880-29695902 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840176 10:29695899-29695921 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1065840194 10:29695955-29695977 AAGGAGAGGGAGAGGGAGACGGG - Intronic
1066074127 10:31855103-31855125 GAGGGGAGGGAGAGGAAGGGAGG + Intronic
1066085114 10:31968974-31968996 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085120 10:31968993-31969015 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085126 10:31969012-31969034 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085132 10:31969031-31969053 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085138 10:31969050-31969072 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085144 10:31969069-31969091 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085150 10:31969088-31969110 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1066085156 10:31969107-31969129 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1066085357 10:31969974-31969996 TAGGGGCGGGACGGGGCGGCTGG - Intergenic
1066376483 10:34861901-34861923 CTGGAGAGAGAGAGGGCGGTAGG - Intergenic
1066728150 10:38412399-38412421 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1067029016 10:42868015-42868037 CAGGCCACGGAGAGGGCAGCTGG + Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067762506 10:49058783-49058805 CAGGGGAGGGGAAGGGCCTCCGG - Intronic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1068783301 10:60944215-60944237 CAGGCGAAGGGGAGGGCTGCGGG - Exonic
1068830674 10:61491272-61491294 GCAGGGAGGGAGAGGGAGGCAGG + Intergenic
1069756569 10:70777378-70777400 GAGGGGAGGAAGAGGGCTGAGGG + Intronic
1069773928 10:70916009-70916031 CGGGTCAGGGAGAGGGAGGCTGG + Intergenic
1069836432 10:71311320-71311342 CAGGGAAGTGGGAGGGCGGCAGG + Intergenic
1069837122 10:71316581-71316603 GAGGGGAGGGATGGGGAGGCTGG - Intergenic
1069909408 10:71750430-71750452 TAGGGGATGGGGAGGGCGGGGGG + Exonic
1069939123 10:71941672-71941694 GGGGGGGGGGAGAGGGGGGCAGG + Intergenic
1069986914 10:72290887-72290909 GATGGGTGGGAGAGGGAGGCTGG + Intergenic
1070167881 10:73911797-73911819 CAAGGGAGGAAGAGGCCGCCGGG + Exonic
1070258175 10:74827675-74827697 TAGGGGTGGGACAAGGCGGCAGG + Intronic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1070750759 10:78962742-78962764 GAGGGGAGGGAGGGGGTGGCCGG - Intergenic
1070810427 10:79294930-79294952 GAGGGGAGAGAGAGGGGGGGGGG + Intronic
1070835735 10:79445793-79445815 CGGGGCAGGGAGTGGGCGGCGGG - Intergenic
1070877192 10:79825789-79825811 CGGGCGGGGGAGGGGGCGGCGGG + Intergenic
1070959482 10:80488543-80488565 CAGGGGAGGGAGGGAGCAGGGGG + Intronic
1071514045 10:86285259-86285281 CAGAGGCGGGAGAGGGTGTCTGG - Intronic
1071643688 10:87341833-87341855 CGGGCGGGGGAGGGGGCGGCGGG + Intergenic
1072710803 10:97714497-97714519 GAGGGCAGGGAGAGGGTGCCAGG - Exonic
1072727674 10:97824492-97824514 CAGGGGTGGGTAAGGGAGGCTGG - Intergenic
1072999472 10:100276385-100276407 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999478 10:100276404-100276426 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999484 10:100276423-100276445 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999490 10:100276442-100276464 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999496 10:100276461-100276483 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1072999510 10:100276505-100276527 AAGGAGAGGGAGAGGGAGACGGG - Intronic
1073044041 10:100625846-100625868 GAGGGGAGGGAAAGGGAGGTGGG - Intergenic
1073102162 10:101012038-101012060 CAGGGGTGGGAGGGGCAGGCAGG + Intronic
1073150018 10:101305162-101305184 CAGGGGAGGGGCAGCCCGGCAGG - Intergenic
1073207993 10:101778787-101778809 CAAGGGAGGGAGCGGCCTGCGGG - Intronic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073448825 10:103597384-103597406 CTGGGGTGAGAGAGGGCTGCTGG + Exonic
1073580415 10:104660528-104660550 GAGGGGAGGGTGAGGGCCACAGG - Intronic
1073680543 10:105698878-105698900 CAGGGAGGGGAGTGGGAGGCAGG - Intergenic
1074792754 10:116907711-116907733 CAGCGGAGGGAGGGGAAGGCAGG + Intronic
1075001903 10:118804888-118804910 CTGGGGAGGGAGAGGTGGGCAGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1076182406 10:128420520-128420542 CAGGAGAGAGAGAGGGCGCAGGG + Intergenic
1076196437 10:128521718-128521740 CAGGTGAGGAGGAGGGCGGCTGG - Intergenic
1076197243 10:128527716-128527738 CAGGGGAGGGAGCGGGAGCTGGG - Intergenic
1076371601 10:129959293-129959315 GAGGGCAGGGCGAGGGAGGCCGG + Intronic
1076696124 10:132248270-132248292 GAGGAGAGTGAGAGGGCAGCTGG + Intronic
1076717589 10:132374317-132374339 CCGGGGAGGGAGACGGGAGCCGG + Intronic
1076743825 10:132502640-132502662 CAGAGGAGGGAGAGCAAGGCTGG - Intergenic
1076779657 10:132717239-132717261 CGGGGGTGGGGGAGGGAGGCGGG - Intronic
1076792616 10:132785266-132785288 CAGGTGAAGGTGAGCGCGGCGGG - Exonic
1076810483 10:132884107-132884129 GAGGGGAGGCTGCGGGCGGCTGG - Intronic
1076849930 10:133087840-133087862 CCGGGGCGGGCGATGGCGGCGGG - Intronic
1076870467 10:133190468-133190490 CAGGGGGAGGAGACGGCAGCCGG + Intronic
1076974786 11:164267-164289 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1076987518 11:249565-249587 GCGGGGAGGGGGAGAGCGGCGGG + Intronic
1076987528 11:249589-249611 GCGGGGAGGGGGAGAGCGGCGGG + Intronic
1076992858 11:284688-284710 CCGGGGAGGGGGAGGGTGCCTGG + Intronic
1077093496 11:789871-789893 CGGGAGAGGGAGGCGGCGGCCGG - Intronic
1077131213 11:973683-973705 CAGGAGAGGGAGGGTGGGGCTGG + Intronic
1077143446 11:1034840-1034862 TGGGGCAGGGCGAGGGCGGCGGG - Intronic
1077155236 11:1088163-1088185 CAGGGCAGGGGGTGGGGGGCTGG - Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077172853 11:1176128-1176150 CTGGGGAGGGAGGGGCCGTCAGG - Intronic
1077190107 11:1252467-1252489 CAGGGGAGGGCGAGGACAGCGGG - Exonic
1077204078 11:1333189-1333211 GAGTGGAGGGAGAGGGCGGGAGG + Intergenic
1077301047 11:1847143-1847165 CAGGGGAGGGAGAGGCCCTGGGG - Intergenic
1077358161 11:2128115-2128137 AAGGGAAGGGAGAGGGTGGGCGG - Intergenic
1077430140 11:2512265-2512287 CCGGGGCGGGAGAGGGCCGCAGG + Intronic
1077491951 11:2865074-2865096 CTAGGGCGGGAGAAGGCGGCTGG - Intergenic
1077522575 11:3045072-3045094 GGGGGTAGGGAGAGGCCGGCGGG + Intronic
1078132102 11:8621378-8621400 GAGGGGAGGGAGAGACTGGCAGG + Intronic
1078133257 11:8630955-8630977 GAGGAGAGAGAGAGGGCAGCAGG - Intronic
1079121494 11:17688296-17688318 CAGAGGAGGGAAAGGGCAGGGGG + Intergenic
1079156167 11:17949727-17949749 CAGGGGAGGTAAAGGGAGGGTGG + Intronic
1079244748 11:18743932-18743954 CTGGGGAGGAAGTGGGAGGCTGG + Intronic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1079601425 11:22316346-22316368 CAGGGGAGAGAGAGAGAGGCGGG - Intergenic
1079601533 11:22316748-22316770 CAGGGGAGAGAGAGAGAGGCAGG - Intergenic
1079930513 11:26554086-26554108 CAGGGGAAGGTCAGGGAGGCAGG - Intronic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1081569033 11:44278336-44278358 CAGGGGAGGGAGTAGAGGGCAGG - Intronic
1081673489 11:44954886-44954908 GAGCGGAGGGAGAGGGCCTCAGG + Intergenic
1081763026 11:45590497-45590519 CAGGGGAGGTGGAGGGTGGGTGG - Intergenic
1081831963 11:46121662-46121684 GCGGGGAGGGAGGGGGCCGCCGG + Intergenic
1081832150 11:46122346-46122368 GAGGGGAGGGAGCGGGCGAGCGG - Intergenic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1081932447 11:46881494-46881516 CAGGGGTGGGAAAGGGCTGCTGG - Intronic
1081979459 11:47257553-47257575 CAAGGGAGGAGGAGGGAGGCTGG + Intronic
1081990953 11:47337348-47337370 CTGGGGAGGGGGCGGGGGGCAGG + Intronic
1082011001 11:47449417-47449439 CGGGGGAAGGAGAGCGAGGCTGG + Intergenic
1082099710 11:48162392-48162414 AAAGGGAGGGAGAGGGAGGAGGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083228498 11:61300068-61300090 GAGAGGAGGGGGAGGGCAGCAGG + Exonic
1083266751 11:61550439-61550461 GAGGGCAGGGGGAGGGTGGCTGG + Intronic
1083397475 11:62401628-62401650 CAGGGGAGGGAGAGAGGGCAAGG - Intergenic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083676671 11:64329734-64329756 CAGGGCAGGGACAGGGAGCCAGG + Intergenic
1083802237 11:65053367-65053389 GAGGAGAGGGAGAGGTGGGCAGG + Intronic
1083832434 11:65241489-65241511 CAGGGGAGGTTGAGGGTGGTGGG - Intergenic
1083865269 11:65450348-65450370 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1083865275 11:65450367-65450389 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1083885202 11:65570121-65570143 CAGGGGAGGCGGAGGCCAGCGGG + Intergenic
1083932185 11:65852152-65852174 CAGGGGAGGGAGGCAGTGGCTGG - Intronic
1083970147 11:66069878-66069900 CAGGGCAGGGCTAGGTCGGCAGG + Intergenic
1084104931 11:66975084-66975106 GAGGGGAGGGGGAGGGGGGAAGG + Intergenic
1084149689 11:67282373-67282395 GTGGGGAGGGAGAGGGTGGGGGG - Intronic
1084174676 11:67417140-67417162 CAGGGGCGGGAGGGGCTGGCTGG + Intronic
1084408185 11:68991100-68991122 CAGGTGAGGGAGCGGGGTGCTGG + Intergenic
1084640676 11:70424001-70424023 CAGGGGAGGGAGCAGTCGGGTGG + Intronic
1084679246 11:70656489-70656511 CGTGGGAGGGGCAGGGCGGCGGG - Intronic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1084972982 11:72781542-72781564 GAGGGGAGGGACGGTGCGGCGGG + Intronic
1085116892 11:73937665-73937687 AAGGAGAGGGAGAGGGAGACGGG + Intergenic
1085116908 11:73937715-73937737 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1085395806 11:76206588-76206610 CCGGGGAGGCCGAGCGCGGCGGG + Intronic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1085754223 11:79190845-79190867 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754229 11:79190864-79190886 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754235 11:79190883-79190905 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754241 11:79190902-79190924 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754247 11:79190921-79190943 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754253 11:79190940-79190962 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754261 11:79190966-79190988 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754267 11:79190985-79191007 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754273 11:79191004-79191026 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754279 11:79191023-79191045 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754285 11:79191042-79191064 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754291 11:79191061-79191083 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1085754313 11:79191130-79191152 AAGGAGAGGGAGAGGGAGACGGG - Intronic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1086343048 11:85866910-85866932 AAAGGGAGGGTGAGGGAGGCAGG + Intronic
1086598199 11:88600295-88600317 AAGGGGAGGGAGAGGGGGAAGGG - Intronic
1087474802 11:98622071-98622093 GAGGGGAGGGAGAGGAGGGGGGG - Intergenic
1088411580 11:109539996-109540018 TAGGGGAGGGAGAGTGCAGTGGG - Intergenic
1088661580 11:112052746-112052768 AAGGGGAGGGAGATGTAGGCTGG - Intronic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088908608 11:114173344-114173366 CAGGGGAGGGGAAGGGAGGGTGG + Intronic
1089096160 11:115921811-115921833 CAGGAGTGGGACAGGGCAGCTGG + Intergenic
1089135268 11:116244169-116244191 CCGGGGAGAGAGAGGCCGGCTGG - Intergenic
1089253065 11:117179052-117179074 CAGGGGAGGGGGCGGCCGGGAGG - Exonic
1089270747 11:117300030-117300052 CAGGAGAGGAAGGGGGAGGCAGG - Intronic
1089290279 11:117433480-117433502 CAGTAGAGGGAGAGGAGGGCTGG + Intronic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089707390 11:120289551-120289573 TAGGGGAGGGAGAGGACAGGCGG - Intronic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1090022284 11:123138599-123138621 CAGGGGAGGGGGAGGGGGGTGGG - Intronic
1090039320 11:123276480-123276502 AAGGGAAGGGAGAAGGCTGCAGG - Intergenic
1090062627 11:123477268-123477290 GAGGGGAGGGAGAGGGGAGGGGG - Intergenic
1090065792 11:123502386-123502408 CAGGGAAGGGAGAGGGGGCTAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090386036 11:126358002-126358024 CAGGGGATGGAGAGGGAGCTTGG + Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090636605 11:128693861-128693883 CAGGGGAGGAAGAGGGGGTGTGG + Exonic
1090807903 11:130213836-130213858 CTGGGGAGGGAGACGGCGTCTGG - Intergenic
1090969017 11:131623720-131623742 CAAGGGAGGGAGAGTGGGCCTGG - Intronic
1091000987 11:131910752-131910774 CCGAGGAGGGAGAGGCCGGGCGG - Intronic
1091140679 11:133231865-133231887 GAGGGGAGGGAGAAGCAGGCAGG + Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091378387 12:41224-41246 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091378393 12:41243-41265 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091378399 12:41262-41284 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1091378405 12:41281-41303 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1091551210 12:1536213-1536235 AAGGGAAGGAAGAGGGAGGCAGG + Intronic
1091584828 12:1810235-1810257 AATGAGGGGGAGAGGGCGGCAGG - Intronic
1091740316 12:2956596-2956618 CAGGGGACGGAGAGGAAAGCAGG - Intergenic
1091807344 12:3365984-3366006 CGGGGGCGGGGGAGGGAGGCTGG - Intergenic
1091858148 12:3755514-3755536 CAGGGGTGGGAGTGGGGGGTGGG + Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1091885394 12:4013530-4013552 AAGTGGAGGGAGAAAGCGGCTGG - Intergenic
1092002725 12:5045014-5045036 CAGGGGCGGGCGCGGGAGGCTGG - Exonic
1092140107 12:6177995-6178017 CAGGGGAGGGGGAGCCCGACAGG + Intergenic
1092231586 12:6778558-6778580 AAGGGGAAGGTGAGGGAGGCTGG - Intergenic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092377861 12:7970543-7970565 CAAGAAAGGGAGAGCGCGGCCGG - Intergenic
1092487348 12:8914410-8914432 CGCGGGAGGGAGGGGGCGGAGGG + Intronic
1092676887 12:10930558-10930580 CAGGTCAGGGAGAGAGGGGCCGG + Intronic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1095349041 12:41188330-41188352 CAGTGGAGGGAGGTGGCGGGTGG - Intergenic
1095672405 12:44876354-44876376 CCGGGGAGGGAGGGGCGGGCCGG + Intronic
1095960827 12:47833300-47833322 CAGGAGAGGAAGAGGGCGATGGG + Intergenic
1096148416 12:49294539-49294561 CAGGGGAGGGGGAGGGGGGCTGG + Exonic
1096226662 12:49870439-49870461 CAGGGGAGGGACAGGGAACCAGG + Exonic
1096319408 12:50598738-50598760 GAGGGGAGGGGGAGGGGGGAGGG - Intronic
1096532396 12:52250048-52250070 CAGGGGAGAGGGAGGGAGCCAGG + Intronic
1096647602 12:53047231-53047253 CAGTGGCGGGAGCGGGCGGCCGG - Intronic
1096764081 12:53868774-53868796 CAGTGGTGGGAGATGGCAGCAGG + Intergenic
1096771426 12:53938483-53938505 CCAGGGAGGGAGAGGGAGGGGGG - Intergenic
1096779711 12:53984889-53984911 CAGGGGAGGTAGAGGGGTGGAGG - Intergenic
1096948436 12:55436915-55436937 CATGGGAAGGAGAGAGTGGCAGG - Intergenic
1096967666 12:55641321-55641343 CAGGGGCCAGAGAGGACGGCAGG + Intergenic
1096975613 12:55697860-55697882 CAGGGGAGGCAGAGGCCTGCGGG - Intronic
1097222934 12:57461237-57461259 CAGTAGAGGGAGAAGGCGGGCGG + Intronic
1098060144 12:66553333-66553355 CAAGGGAGGGAGAGGGAAGGAGG - Intronic
1098426116 12:70366683-70366705 CGGGGGCGGGAGGGGGCGGGGGG + Exonic
1099576965 12:84393940-84393962 CGGGGGGGGGGGGGGGCGGCGGG - Intergenic
1100256294 12:92886529-92886551 GAGGGGAGGGAGAGGAGGGGAGG + Intronic
1100289497 12:93200363-93200385 GAGGGAAGGGAGAGTGAGGCAGG + Intergenic
1100551631 12:95651430-95651452 AAGGGGAGGGAGATAGGGGCAGG - Intergenic
1100570924 12:95842348-95842370 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1100570936 12:95842386-95842408 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570942 12:95842405-95842427 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570948 12:95842424-95842446 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570954 12:95842443-95842465 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570960 12:95842462-95842484 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570966 12:95842481-95842503 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570972 12:95842500-95842522 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1100570978 12:95842519-95842541 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1101348157 12:103905251-103905273 GGGGGGAGGGAGAGGGAGGAAGG + Intergenic
1101399408 12:104374927-104374949 GAGGGGAGTGTGAGGGCAGCAGG - Intergenic
1101467236 12:104960456-104960478 CCTGGGAGGGAGAGGTGGGCGGG + Intergenic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102353240 12:112210438-112210460 GAGGTGAGGGACAGGGAGGCAGG - Intronic
1102508461 12:113398666-113398688 CAAGGAAGAGAGAGGGCGCCTGG - Intronic
1102547334 12:113666263-113666285 ATGGGGAGGGAGAGGGAAGCCGG + Intergenic
1102827893 12:115965709-115965731 CAGGGGAAGAAGAGGATGGCTGG + Intronic
1103003994 12:117407444-117407466 CAGAGGAGGGAGAGGCAGGTGGG - Intronic
1103239014 12:119398004-119398026 GATGGGAGGAAGGGGGCGGCGGG + Intronic
1103601994 12:122060181-122060203 CGGGGGAGGCAAAGGGCAGCAGG - Exonic
1103932244 12:124457056-124457078 CAGGGGAGGGCGGGGGTGGCTGG - Intronic
1104009113 12:124916602-124916624 CAGGGGCGGGAGAGGAGGACAGG + Intronic
1104410174 12:128551213-128551235 CAGGGGAGGAAGCGGGAGGGGGG - Intronic
1104550381 12:129751403-129751425 CAGGGGAGGGACATGGTGGGAGG - Intronic
1104622829 12:130331273-130331295 GAGGGGAGGGCCAGGGCCGCTGG + Intergenic
1104906444 12:132215852-132215874 CAGGGGATGGAGAGGGGGTGAGG + Intronic
1104906491 12:132215995-132216017 GAGGGAAGGGAGACGGTGGCGGG + Intronic
1104929466 12:132330042-132330064 CGGGGGAGAGGGAGGGAGGCCGG - Intergenic
1104951799 12:132444470-132444492 CAGGGGAGACAGAGGGCTCCGGG - Intergenic
1104955979 12:132466057-132466079 CAGGGGAGGGAGGGAGGAGCGGG - Intergenic
1104957995 12:132475262-132475284 CCGGGGAGAGAGGGGGCGGGGGG - Intergenic
1104975493 12:132550201-132550223 CAGGGGAGGGAGAGGGGCTGCGG + Intronic
1104982328 12:132579047-132579069 CAGAGGAGGGAAGGGGAGGCGGG - Intronic
1105007380 12:132729612-132729634 GAGGGGAGGGGGAGGGGGGAGGG + Intronic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105331466 13:19420584-19420606 GGGTGGAGGGAGAGGGCTGCGGG + Intergenic
1105913322 13:24891292-24891314 CTGGGCAGGGAGAGGCCAGCAGG - Intronic
1106036845 13:26051519-26051541 CAGAGGAGGCTGAGCGCGGCCGG - Intergenic
1106230139 13:27815270-27815292 CAGGGAAAGGAGAGGCCCGCGGG - Intergenic
1106679972 13:31999475-31999497 CTGGAGAGGGAGAGGGAGACGGG - Intergenic
1106935107 13:34709614-34709636 GAGGGGAGAGAGGGAGCGGCTGG + Intergenic
1107133292 13:36919584-36919606 CAGCGGACAGAGGGGGCGGCGGG - Intronic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107562521 13:41571325-41571347 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1107744813 13:43493150-43493172 CAGGAGAGGGAGTGGGAGGGGGG - Intronic
1107885809 13:44873391-44873413 CAGGAGAGGGAGAGGCCTGTAGG - Intergenic
1108326472 13:49337418-49337440 GAGGGGAGGGAGATGTGGGCTGG - Intronic
1108794767 13:54017808-54017830 AAGGGGAGGGAAAGGGAGGGAGG + Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1110117771 13:71841349-71841371 CAGGGAAGGGAGAGCGGGGAGGG + Intronic
1110318571 13:74135476-74135498 CGGGAGAGGGAGGAGGCGGCCGG + Intergenic
1110568623 13:76980432-76980454 GAGGGAAGAGAGAGGGCGCCAGG + Intergenic
1111230815 13:85341576-85341598 GAGGGGAGGGAGAGGGGGAGGGG + Intergenic
1112692901 13:101916665-101916687 CCGGGGAGGGAGGGCGCGGGAGG + Intronic
1112728222 13:102329505-102329527 CAGGGAAGGGAGTGGTCAGCAGG - Intronic
1112744053 13:102507549-102507571 CATGGGAGGGACTCGGCGGCAGG + Intergenic
1113179788 13:107612091-107612113 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1113724679 13:112589260-112589282 AAGGTGGGGGAGAGGGTGGCAGG - Intergenic
1113754760 13:112803765-112803787 GAGGGGAGGGAGAGGAAGGAGGG - Intronic
1113779747 13:112969226-112969248 CTGGGCAGGGAGGCGGCGGCTGG + Exonic
1113784132 13:112993558-112993580 GAGGGGAGGGGGAGGGTGCCTGG + Intronic
1113849170 13:113408113-113408135 CTGAGGATGGAGTGGGCGGCCGG + Intergenic
1113850211 13:113413569-113413591 CAGGGGTGGGAAAGGGCGAGAGG - Intergenic
1113861785 13:113491344-113491366 CCGGGGAGGGAGAGAGGGGAGGG - Intronic
1113938589 13:114007267-114007289 CAGGGCAGGAGGGGGGCGGCAGG - Intronic
1114265745 14:21071582-21071604 CTGGGGAGGGAGGCGGCGGGCGG - Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114672541 14:24419161-24419183 CCAGGGAGGGAGAGTGAGGCTGG - Exonic
1114865993 14:26597135-26597157 CAGGGGAGGGGGCGCGGGGCAGG + Intronic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115433547 14:33348261-33348283 GTGGGAAGGGAGAGAGCGGCTGG - Intronic
1115508195 14:34112640-34112662 TAGGGGTGGAAGAGGGCGGTGGG + Intronic
1115664626 14:35534059-35534081 CAGGAGTGGGAGCGGGCGCCGGG - Exonic
1115828037 14:37299289-37299311 TAGGGTAGGGAGAGGGGGGCGGG + Intronic
1116863455 14:50012764-50012786 CAAGGGAGGGAGGGAGCTGCAGG - Intergenic
1117065091 14:52005511-52005533 CAGGGGTGGGACAGGGTGGTGGG + Exonic
1117202651 14:53408365-53408387 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1117202673 14:53408422-53408444 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1117315475 14:54567344-54567366 GAGGGGGCGGAGGGGGCGGCTGG + Intronic
1117830109 14:59741713-59741735 CAGGGGAGGAAGAGGGAAGTGGG - Intronic
1118341418 14:64896653-64896675 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1118341424 14:64896672-64896694 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341430 14:64896691-64896713 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341436 14:64896710-64896732 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341442 14:64896729-64896751 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341448 14:64896748-64896770 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341454 14:64896767-64896789 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118341460 14:64896786-64896808 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1118366760 14:65102724-65102746 CCGGGGAGGGGGGGGGGGGCGGG + Intergenic
1118696963 14:68394893-68394915 CAGGCGGGGGTGAGGGGGGCTGG - Intronic
1118764558 14:68901101-68901123 CAGGGGAGGGAGTGGGTGGGAGG + Intronic
1118769455 14:68932281-68932303 CACGGGAGAGAGATGGAGGCTGG - Intronic
1118836781 14:69483871-69483893 CAGGCCAGGGAGATGCCGGCCGG - Intergenic
1119113474 14:71996777-71996799 TAGGGGAGGAAGGGGGTGGCGGG + Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119516777 14:75254602-75254624 CAGGGAAGGAAGAGGGCAACAGG - Intronic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1119649271 14:76372162-76372184 CTGGGGTGGGAAAGGGCGGGTGG + Intronic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1119761095 14:77152476-77152498 CAAGGGAGGGAAAGGGTGTCAGG - Intronic
1119788069 14:77327360-77327382 CAGGGAAGGGAGATGGGGGTGGG + Intronic
1120045572 14:79801910-79801932 AAGGGGTGGGAGAGTGGGGCTGG + Intronic
1120193938 14:81463204-81463226 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120193946 14:81463223-81463245 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120193954 14:81463242-81463264 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120193962 14:81463261-81463283 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120856749 14:89219149-89219171 CAGGGGAGGGAGGTGGTGGGAGG + Intronic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121330501 14:93046588-93046610 CGGGGGCGGGGGGGGGCGGCGGG + Intronic
1121358661 14:93235285-93235307 CAGGGGAGTGAGAGGGGGTGTGG - Intergenic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121597223 14:95173574-95173596 CAGGGCAGGGACAGGACAGCAGG - Intergenic
1121613626 14:95298190-95298212 AAGGGAAGGGAGAGGACTGCAGG - Intronic
1121744046 14:96274109-96274131 CAGGGGAGGGAGCGGGCAGGTGG + Intergenic
1121778448 14:96606387-96606409 AAGGGGAGGGAGACGGCTGGGGG + Intergenic
1122036118 14:98950447-98950469 GAGGGGAGGGAGAGGAGGGGAGG + Intergenic
1122059910 14:99130126-99130148 CAGGGGAAGGAGAGGGCGTGGGG - Intergenic
1122220785 14:100238399-100238421 GAAGGGAGGGAGGGGCCGGCCGG - Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122279180 14:100611061-100611083 GAGGGCTGGGAGAGGGAGGCTGG - Intergenic
1122388316 14:101363939-101363961 GAGGGGAGGGTGAGGGAGACAGG - Intergenic
1122459655 14:101884569-101884591 CAGGGGAGGGAAAGCCCCGCTGG + Intronic
1122651343 14:103228764-103228786 CAGGGGAGGGGGTGGGAGGGAGG + Intergenic
1122738887 14:103859493-103859515 CAGGGGAGGGAGGGAGCGAGTGG + Intergenic
1122782250 14:104148675-104148697 GAGGGGAGGGGCAGGGCTGCAGG + Intronic
1122931323 14:104934006-104934028 GAGGGGACGGGGAGGGCGGGAGG + Exonic
1122931339 14:104934041-104934063 GAGGGGACGGGGAGGGCGGGAGG + Exonic
1122931355 14:104934076-104934098 GAGGGGACGGGGAGGGCGGGAGG + Exonic
1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG + Intronic
1123023889 14:105414715-105414737 CAGAGGAGGGTGCGTGCGGCGGG + Intronic
1123037797 14:105478515-105478537 CAGGGCAGGCCGAGGGCAGCCGG - Intronic
1123450851 15:20358105-20358127 CAGGGGAGGAAGAGGGGAGGAGG + Intergenic
1123876523 15:24629196-24629218 CAGGGTAGGGAGTGGGGGGTGGG - Intergenic
1124127079 15:26945807-26945829 CAGGGGTGGGGGCGGGTGGCAGG - Intronic
1124251125 15:28107010-28107032 GCGGGGAGGGAGAGTCCGGCAGG + Intergenic
1124866675 15:33499174-33499196 AAGGGGAGGGAGAGAGAGGGAGG - Intronic
1125135532 15:36336957-36336979 CAGGGGAGAAAGAGGTAGGCTGG - Intergenic
1125535581 15:40440039-40440061 CGGGGGAGGGAGAAAGGGGCGGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125677642 15:41511402-41511424 CAGGTGAGGGCGCGGGCCGCGGG - Exonic
1125694199 15:41621693-41621715 GGGGGGAAGGAGAGGGTGGCGGG + Intronic
1125968715 15:43894676-43894698 CAGGGGAGGGAGGCAGCGGAGGG + Intronic
1126049662 15:44674392-44674414 CAGGAGAGGGAGAGGGATCCTGG - Intronic
1127114090 15:55706781-55706803 GAGGAGAGGGAGAGCGAGGCAGG + Intronic
1127507654 15:59611060-59611082 GAGGGGAGGGGGAGGGCGAGGGG - Intronic
1127507663 15:59611077-59611099 AAGGGGAGGGGGAGGGCGAGGGG - Intronic
1127682853 15:61314562-61314584 CAGGGGAGGGATGGGGCTGATGG + Intergenic
1127997727 15:64163229-64163251 TGTGGGCGGGAGAGGGCGGCCGG - Intergenic
1128146269 15:65334085-65334107 ATGGGGAGGGAGGGGGCAGCAGG - Intronic
1128269022 15:66293046-66293068 GATGGGAGGGTGAGGGGGGCAGG - Intergenic
1128293536 15:66497614-66497636 GAGGGGCAGGAGAGGGCCGCGGG + Intronic
1128412607 15:67414433-67414455 AAGGGGAGGCAGAGGAGGGCAGG + Intronic
1128725190 15:69982777-69982799 GATGGGAGGGAGAGGGCTGGAGG + Intergenic
1128977711 15:72165613-72165635 GAGGGGAGGGATGGGGCAGCAGG - Intronic
1129032457 15:72629003-72629025 AAGGGGAGGGAGAGGTGTGCTGG + Intergenic
1129162158 15:73752968-73752990 GAGGGGAGGGGGCGAGCGGCGGG + Intergenic
1129169675 15:73799959-73799981 CAAGGGAGTGAGAGGTCAGCAGG - Intergenic
1129217433 15:74108236-74108258 AAGGGGAGGGAGAGGTGTGCTGG - Intronic
1129226672 15:74174357-74174379 GAGGAGCGGGAGAGGGCGGGTGG + Intronic
1129229176 15:74187227-74187249 CAGTGGAGGGAGAGAGAGGTAGG - Intronic
1129264221 15:74385439-74385461 CAGGCGAGGGAGGCAGCGGCTGG - Intergenic
1129271441 15:74421331-74421353 GAAGGGAGGGTGAGGGCTGCTGG + Intronic
1129288765 15:74547153-74547175 CGGGGGAGGGGGAAGGCGGGGGG - Intronic
1129351188 15:74956817-74956839 CAGGGGAGGGGCCTGGCGGCAGG - Exonic
1129386706 15:75200472-75200494 CAGGGCAGGGACAGGGTCGCCGG + Intronic
1129393380 15:75231721-75231743 CAGGGGTGGGAGAGGGAGAAGGG - Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129704501 15:77786586-77786608 CAGAGGAGGGAGGGGATGGCAGG + Intronic
1129713979 15:77836366-77836388 CAGGGAAAGGAGAGAGCAGCTGG - Intergenic
1129734597 15:77952533-77952555 AAGGGGAGGGAGAGGTGTGCTGG - Intergenic
1129840993 15:78743458-78743480 AAGGGGAGGGAGAGGTGTGCTGG + Intergenic
1130650210 15:85758159-85758181 CAGGGCAGGGAGAGAGGGGGTGG + Intergenic
1130884842 15:88084243-88084265 CAGGGGAGTGAGGGGGCAGTGGG - Intronic
1130970199 15:88726377-88726399 CAGAGGAGGGTGAGGGCAGCGGG + Intergenic
1131053834 15:89364131-89364153 CAAGGGAGGGAGGGGGCAGTGGG + Intergenic
1131067033 15:89441260-89441282 GAGGGGAGTGAGAGGGTGGCAGG + Intergenic
1131180247 15:90234158-90234180 CCGGGGTGGGAGGGGGGGGCGGG + Intronic
1131225936 15:90624446-90624468 ATGGGGAGGGAGAGGCAGGCGGG - Intronic
1131453106 15:92562639-92562661 CTGGAGAGGGAGATGGCGCCAGG + Intergenic
1131519331 15:93101470-93101492 CAGGGGAAGTACAGGGCTGCTGG + Intergenic
1131785409 15:95906591-95906613 AAGGGGAGGGTGAGGGAGGAGGG + Intergenic
1132161682 15:99548686-99548708 AAAGGGAGGGAGAGTGGGGCTGG + Intergenic
1132255619 15:100373627-100373649 CAGGGCTGGGCGGGGGCGGCAGG + Intergenic
1132533708 16:466954-466976 CAGCCGAGGGAGAGCACGGCTGG + Intronic
1132579814 16:679815-679837 CAGGGGCGGGAGGCGGCGGCTGG + Intronic
1132582854 16:693521-693543 TTGGGCAGGGAGAGGGCGGAAGG - Exonic
1132752653 16:1465887-1465909 CAGGGCAGGGGCAGGGCAGCGGG + Intronic
1132803152 16:1763883-1763905 AGGGGGTGGGAGAGGACGGCGGG + Intronic
1132829003 16:1918484-1918506 CGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1132843615 16:1990217-1990239 CAGGGGCGGGAGCGGGGGCCCGG - Intronic
1133020097 16:2963462-2963484 CGGGGGAGGGGGAGGGGAGCAGG - Intergenic
1133032455 16:3017851-3017873 CAGGTGAGGGGGAGGGGGGAGGG + Intronic
1133229517 16:4359965-4359987 CAGGGGAGGGTGAGGGGGGTAGG - Intronic
1133303952 16:4798591-4798613 TCGGGGAGGGTGAGGGTGGCGGG + Exonic
1133470132 16:6066960-6066982 AGGGGGCGGGGGAGGGCGGCAGG + Intronic
1133568816 16:7021991-7022013 AAGGGGAGGGAGAGGGGGAGGGG - Intronic
1133820528 16:9232287-9232309 AAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1133964208 16:10519352-10519374 GAGGGGAGGGGGAGGGGGGGAGG - Intergenic
1133998193 16:10763131-10763153 CAGGGGTGGTAGAGGGAGGCCGG + Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134396930 16:13873797-13873819 TAGGGGAGGGAGAAGGCTGGGGG - Intergenic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134567439 16:15263609-15263631 GAGGTGAGGGGGAGGGTGGCCGG - Intergenic
1134637546 16:15803797-15803819 CAGGAGAGGGAGCGGGCTCCAGG + Intronic
1134735054 16:16493091-16493113 GAGGTGAGGGGGAGGGTGGCCGG + Intergenic
1134911709 16:18033051-18033073 CAGGGGAGGAAGATGGAGGGAGG - Intergenic
1134932468 16:18219126-18219148 GAGGTGAGGGGGAGGGTGGCCGG - Intergenic
1135326088 16:21526632-21526654 CAGGAGAGGGTGGGGGCGGAGGG + Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135708701 16:24696773-24696795 AAGGGGAGGGGGAGGGAGGGAGG + Intergenic
1135754325 16:25083799-25083821 CAGGAGAGGAAGAGGGGGGAAGG - Intergenic
1135770759 16:25216798-25216820 CAGGGCAGGGTGAGGGAGTCAGG - Intronic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136073427 16:27802596-27802618 CAGGGGAGCCAGAGGCCGGTGGG - Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136449601 16:30346237-30346259 CAGGGGAAGAAGAGGGTGTCTGG - Intergenic
1136611151 16:31366388-31366410 CAGGAGAGGGAGAGAGAGACAGG - Intronic
1136779164 16:32886191-32886213 GGCGGGAGGGAGAGGGGGGCCGG - Intergenic
1136891453 16:33975327-33975349 GGCGGGAGGGAGAGGGGGGCCGG + Intergenic
1137430977 16:48417528-48417550 ACGGGGAGGGAGAGGGAGACGGG + Intronic
1137430984 16:48417546-48417568 ACGGGGAGGGAGAGGGAGACGGG + Intronic
1137430991 16:48417564-48417586 ACGGGGAGGGAGAGGGAGACGGG + Intronic
1137430998 16:48417582-48417604 ACGGGGAGGGAGAGGGAGACGGG + Intronic
1137617146 16:49855133-49855155 CAGGGGCGGGAGGGGGCGCCAGG + Intronic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138452995 16:57104921-57104943 CAAGCGAGGGGGAGGGTGGCAGG + Intronic
1138454935 16:57115764-57115786 CAGTGCAGGGAGGGGGCTGCTGG - Intronic
1138482245 16:57311077-57311099 CAGGGGAGGGTGGGGGCTGGGGG + Intergenic
1138667767 16:58586394-58586416 CAGGGGAGGGAGGGGAGGGGAGG + Intronic
1138756364 16:59490938-59490960 CAGGGGAGGGGGAGGAAGGAGGG - Intergenic
1138988513 16:62361525-62361547 AAGGGGAGAGAGAGGGAGGGAGG + Intergenic
1139018379 16:62717843-62717865 CAGGGTGGGGTGAGGGTGGCAGG + Intergenic
1139274655 16:65716354-65716376 AAGGGGAGGGAGAGGAAGGAAGG + Intergenic
1139476045 16:67203044-67203066 GAGGGCAGGCAGAGGGCGGCTGG + Intronic
1139510264 16:67424146-67424168 CAGGGGCGGGAGGGGGCTGGTGG - Intergenic
1139632017 16:68236644-68236666 CTGGGAAAGGGGAGGGCGGCGGG + Intronic
1139754548 16:69132288-69132310 CCGGGAAGGGGGAGGGCGGCGGG - Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140153783 16:72401174-72401196 GAGGAGAGGGAGAGGGAGGGGGG + Intergenic
1140296730 16:73716183-73716205 TAGGGGAGGGAATGGGTGGCTGG + Intergenic
1140306131 16:73804911-73804933 GAGGGGAGGGAGAGGGAGGGAGG + Intergenic
1140328079 16:74025296-74025318 CTGGGGGAGGTGAGGGCGGCAGG - Intergenic
1140400322 16:74666069-74666091 AAGAGGAGGGAGAGGGAGACGGG + Intronic
1140456473 16:75108769-75108791 TAGGTGAGGGAGTGGGGGGCAGG - Exonic
1140501343 16:75436069-75436091 CAGAAGAGGAAGAGGGTGGCAGG - Intronic
1140650966 16:77087970-77087992 CAGGGGTGGGAGGGGTTGGCAGG + Intergenic
1140818227 16:78639928-78639950 CTGTGGAGGGAGTGGGAGGCAGG + Intronic
1141099270 16:81185202-81185224 CAGGGCAGGGAAGGGGCAGCTGG - Intergenic
1141156260 16:81599266-81599288 CAGGGGAGGGAGAGTGTGAACGG + Intronic
1141466371 16:84208435-84208457 GAGGGGAGGAAGAGGGCAGAGGG + Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141648238 16:85378702-85378724 CAGGGCAGGCACAGGGCTGCAGG - Intergenic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1141665289 16:85462667-85462689 CGCGGGCGGGGGAGGGCGGCGGG + Intergenic
1141673270 16:85504037-85504059 CGTGGGAGGCAGAGGGCGGGCGG - Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141927281 16:87177890-87177912 GAAGGGAGGGAGAGGCGGGCAGG + Intronic
1141948200 16:87324515-87324537 CTGGGGAGGGACAGCGCTGCAGG + Intronic
1141955292 16:87366749-87366771 GAGGGGAGGCAGAGGGCAGACGG + Intronic
1141983695 16:87565903-87565925 GAGGGGAGGGACAGGGAGGAAGG - Intergenic
1142039126 16:87881357-87881379 CAGGAGAGGGCGGGGGCGGAGGG + Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142188304 16:88705349-88705371 CAGGGGAGAGAGAGAGCAGGAGG - Intronic
1142200581 16:88759421-88759443 CAGGCCAGGGGGAGGGCAGCTGG - Intronic
1142245824 16:88969624-88969646 GAGCCGAGGGAGAGGGGGGCGGG + Intronic
1142282673 16:89156737-89156759 GAGGGAAGGCAGAGGGCGGCAGG - Intergenic
1142323765 16:89401092-89401114 CTGGGGAGGGGGAGGGCGGGTGG - Intronic
1142324895 16:89408403-89408425 CAGAGGAGGAAGAGGATGGCAGG + Intronic
1142359259 16:89619049-89619071 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359396 16:89619352-89619374 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359411 16:89619383-89619405 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142395477 16:89828988-89829010 CCGGGGAGGGAGAGGAAGGAGGG - Intronic
1142414225 16:89932693-89932715 CAGGGCTGGGATAGGGAGGCTGG - Intronic
1142445477 16:90133390-90133412 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1203081576 16_KI270728v1_random:1148279-1148301 GGCGGGAGGGAGAGGGGGGCCGG - Intergenic
1142462035 17:102080-102102 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1142603598 17:1069827-1069849 CAGGGGCGGGGGAGGGGGTCCGG - Intronic
1142671068 17:1487570-1487592 CAGAGGCGGGGGAGGGCGGGAGG + Intronic
1142894165 17:2963794-2963816 CAGGGGAGGGAGGGGGCCGGTGG - Intronic
1142910022 17:3081017-3081039 CAGGGGAGAGAGAGGGGCGGGGG + Intergenic
1142941748 17:3385881-3385903 GAGGGGAGGGAGGAGGCAGCCGG - Intergenic
1142958222 17:3535383-3535405 GAGAGGAGGGAGAGGGAGGAGGG - Intronic
1143029792 17:3961541-3961563 CAGGGGAGGGAGGCAGCGGCTGG - Intronic
1143137696 17:4720874-4720896 GAGGGCAGGGAGTGGGAGGCTGG + Intronic
1143174930 17:4950081-4950103 AGGGGTGGGGAGAGGGCGGCGGG + Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143447595 17:7018455-7018477 CATGGTTGGGAGAGGGGGGCCGG + Intergenic
1143500129 17:7334033-7334055 CAGGGAAGAAAGAGGGCAGCTGG + Intergenic
1143702590 17:8672405-8672427 TGGGTGAGGGTGAGGGCGGCGGG - Intergenic
1144269454 17:13602106-13602128 CTGGAGAGGGCGGGGGCGGCAGG + Intergenic
1144395912 17:14843070-14843092 TAGGGGAGAGAGAGGGAGACAGG + Intergenic
1144501328 17:15787997-15788019 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1144740891 17:17581693-17581715 CACAGGAGGGAGAGGGGGGAGGG - Intronic
1145133199 17:20376928-20376950 GAGGGGAGGGAGAGGAGGGAGGG - Intergenic
1145154511 17:20533292-20533314 GAGGGGAGGGAAAGGGCAGAAGG + Intergenic
1145163503 17:20590671-20590693 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1145279230 17:21455975-21455997 CAGGTGAGGGGGCGGGCTGCAGG + Intergenic
1145398626 17:22514472-22514494 CAGGTGAGGGGGTGGGCTGCAGG - Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145733431 17:27211256-27211278 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733448 17:27211313-27211335 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733462 17:27211357-27211379 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733468 17:27211376-27211398 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733474 17:27211395-27211417 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1145733480 17:27211414-27211436 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1145908519 17:28529257-28529279 GAGGGGAGTGAGAGGGCCCCTGG + Intronic
1145962897 17:28897677-28897699 CGGGCGAGCGAGCGGGCGGCCGG - Exonic
1146176085 17:30667479-30667501 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146349543 17:32083589-32083611 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146422215 17:32698289-32698311 AGGGGGAGGGAGAGGGGGGAAGG - Intronic
1147037752 17:37694432-37694454 CGGGGGGGGGGGGGGGCGGCGGG - Intronic
1147132832 17:38419196-38419218 GAGGGGAGGGGGCGGGCGGAGGG + Intergenic
1147168910 17:38606838-38606860 CGAGGGAGGGAGGGGGCCGCTGG - Intergenic
1147215483 17:38896587-38896609 CAGGGGACGGAGTGGGGGACTGG + Intronic
1147330417 17:39696037-39696059 CAGGGAAGGGAAAGGGGTGCTGG - Intronic
1147587084 17:41658905-41658927 CAGGGCAGGGAGGGGCTGGCAGG + Intergenic
1147645976 17:42034165-42034187 CTGGGCAGGGAGAGGGCTGGAGG - Intronic
1147891581 17:43720952-43720974 GAGGGGACGGAGGGGGCGGAGGG + Intergenic
1148053224 17:44779423-44779445 CGGGCGAGGGCGAGGGCAGCTGG - Intronic
1148079623 17:44960492-44960514 CGGGGGAGGGGGAGCGTGGCAGG - Intronic
1148439827 17:47706224-47706246 CAGGGGAAGGAGAGGGCTCTGGG - Intronic
1148467357 17:47872920-47872942 CCGGGGCTGGAGAGGGCGGAAGG + Intergenic
1148559414 17:48597387-48597409 CAGGGCTGGGAGAGGGGGGTTGG + Intronic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148698655 17:49575740-49575762 CAGCGCGGGGAGCGGGCGGCCGG + Intergenic
1148736149 17:49865967-49865989 CAGGAGGGAGAGAAGGCGGCAGG + Intergenic
1148782592 17:50130073-50130095 CGGGGGCGGGGGAGGGCGGCGGG + Intergenic
1149441591 17:56678836-56678858 CGGGGGAGGGAGGGGGCCCCCGG - Intergenic
1149496088 17:57118467-57118489 CAGGGGTGGGGGAGGCAGGCTGG + Intronic
1149552777 17:57552388-57552410 CAGGGCAGTGAGTGGGGGGCTGG - Intronic
1149583572 17:57768701-57768723 CAGGGGAAGGAGAGTGGGGTGGG + Intergenic
1149614656 17:57988032-57988054 CACGGGGGGGACAGGGGGGCCGG - Intronic
1149867124 17:60157206-60157228 CAGGAGAGGGGGAGGCAGGCAGG + Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150218956 17:63485078-63485100 CAGGGGAGGGGCAGGGTGCCAGG + Intronic
1150566765 17:66348768-66348790 CAGCAGAGGGGGAGGGCAGCTGG + Intronic
1150597225 17:66616827-66616849 CAGAGGAGGGAGAGGGGGCTGGG + Intronic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1150636228 17:66915190-66915212 TGGGGCAGGGAGAGGGAGGCAGG + Intergenic
1150641628 17:66953446-66953468 CAGGGGAGGGACAGGCCTGCTGG - Intergenic
1151218995 17:72597854-72597876 CAGGGTAGGGAGGGGGCAGAAGG - Intergenic
1151534568 17:74731354-74731376 CAGGGGAGGGACAGAGCCCCTGG + Intronic
1151591459 17:75047282-75047304 CGGGGCTGGGAGGGGGCGGCGGG + Exonic
1151612020 17:75182599-75182621 CGGGGGCGGGAGAGAGCGGCGGG + Intergenic
1151679045 17:75614372-75614394 CAGGCCAGGGAGAGGGGTGCTGG - Intergenic
1151682396 17:75628987-75629009 CAGGGGAGGAAGATGGAGCCGGG - Exonic
1151749256 17:76027360-76027382 CAGGTGAGGCAGCGGGCGGGCGG + Exonic
1151755945 17:76075294-76075316 CGGGGGATGGAGCGGGAGGCGGG + Intronic
1151820151 17:76492759-76492781 CAGGGCAGGGAGAGCGTGACAGG + Intronic
1152010128 17:77707784-77707806 GAGGGGAGGAAGAGGGTGGTTGG + Intergenic
1152018880 17:77770238-77770260 CAGGGGAGGGAGAGAGAGAGAGG - Intergenic
1152033765 17:77859268-77859290 GAAGAGAGGGAGAGGGAGGCAGG + Intergenic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152223505 17:79082089-79082111 CAGGGGAGGCACTGGGCCGCTGG - Intronic
1152245526 17:79182985-79183007 AAGGCGCGGGAGGGGGCGGCGGG - Intronic
1152446855 17:80349925-80349947 CTGGGGAGGGAGAGGGCAGCAGG - Intronic
1152461507 17:80444616-80444638 CAGGGGAGGGCGTGGGGGGGTGG + Intergenic
1152521028 17:80857157-80857179 CAGGGGAGGGAGGGCGTGGAGGG - Intronic
1152530002 17:80912697-80912719 CCGTGGTGGGAGAGGGGGGCGGG - Intronic
1152586721 17:81192642-81192664 CAGGGATGGGAGAGGTCAGCGGG + Intronic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152645284 17:81465800-81465822 CGGGGGTGGGAGCGGGGGGCTGG - Exonic
1152699480 17:81811970-81811992 CTGGGGAGGGACCGGGGGGCTGG + Intronic
1152736608 17:82000345-82000367 CAGGGGAGGGAGCGTGTGCCTGG + Intronic
1152793343 17:82293472-82293494 GAGGGGAGGGCGCGGGCTGCGGG + Intergenic
1152821797 17:82441287-82441309 CAGGTGTGGGTGAGGGGGGCAGG + Intronic
1152930526 17:83107450-83107472 CAGGGGACTGTGAGGGCTGCGGG + Intergenic
1153051143 18:904656-904678 AAGGCAAGGGAGAGGGCGGGCGG - Intergenic
1153243068 18:3048207-3048229 GACGGGAGGGAGAGGACGGAGGG - Intergenic
1153505299 18:5790595-5790617 CAAGGAATGGAGAGGGCTGCTGG + Intergenic
1153596402 18:6729691-6729713 CAGCCGCGGGAGAGAGCGGCTGG + Intergenic
1153893844 18:9541601-9541623 GAGGGGAGGGAGAGGGAGCCAGG - Intergenic
1153915152 18:9738411-9738433 CAGGGAAGGGAAGGGGCGGAAGG + Intronic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1154183244 18:12156079-12156101 AAAGGGAGGGAGAGGGAGGGGGG - Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155100727 18:22607622-22607644 CAGGGGAGGCAGAGATCAGCAGG - Intergenic
1155171143 18:23267586-23267608 CAGTGCAGGGAGTGGGCAGCCGG - Intronic
1155352187 18:24917640-24917662 CAGGGGAGGAAGAGGGCGGGGGG + Intergenic
1155630540 18:27887533-27887555 CAGGGAAGGAGGAGGGAGGCAGG - Intergenic
1155910325 18:31498131-31498153 GCGGGGAGGGAGAGGGTGGCCGG + Exonic
1156183994 18:34640263-34640285 CAGAGGAGGGACAGGCAGGCAGG - Intronic
1156452687 18:37275385-37275407 CGGGGGAGGGGGACGGGGGCGGG + Intronic
1156466532 18:37351106-37351128 CTGGTGGGGGAGAGGGGGGCTGG + Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1156664023 18:39383495-39383517 CAGAGGAGGGAGAGCCCAGCGGG - Intergenic
1157045655 18:44099463-44099485 CAGGGGAGGTAGAGGCTTGCAGG + Intergenic
1157128482 18:44980601-44980623 CAGAGGAGGGAGAGGCAGGGAGG + Intronic
1157368080 18:47084939-47084961 AAGGGGAGGGAGACGGTGGTGGG - Intronic
1157470126 18:47982529-47982551 AGGGGGAGGGAGAGGGAGGGAGG + Intergenic
1157590449 18:48833483-48833505 GAGGAGAGGTGGAGGGCGGCGGG - Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1157876126 18:51275259-51275281 CAGGATAGGAAGGGGGCGGCAGG - Intergenic
1157905158 18:51563236-51563258 GAGGGTAGGGAGAGGGAGTCCGG + Intergenic
1158137690 18:54224495-54224517 GAGGAGGGGGAGAGTGCGGCGGG - Exonic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159468839 18:68822978-68823000 CAGGGGAGTGTGGGGGCGGGAGG - Intronic
1159732850 18:72053322-72053344 CAAGGGAGGGTGAGGGTGGTGGG + Intergenic
1159888599 18:73934270-73934292 AAGGGGAGGGACAGTGAGGCAGG - Intergenic
1159931399 18:74316021-74316043 CAGGGGGAGGAAAGGGCGGGTGG - Exonic
1160011519 18:75110061-75110083 GGGAGGAGGGAGAGGGAGGCTGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160340379 18:78084281-78084303 CTGAGGTGGGAGAGGGCTGCAGG + Intergenic
1160404823 18:78638146-78638168 CTGGGGCTGGGGAGGGCGGCTGG + Intergenic
1160418234 18:78726746-78726768 CAGGGGAGGAGGAGGGCGCCTGG + Intergenic
1160453223 18:78979369-78979391 CAGGGGAGGGAGAGGAGGGGAGG + Intergenic
1160498592 18:79389930-79389952 AGGGGGAGGCAGAGGGAGGCAGG + Intergenic
1160543735 18:79639265-79639287 CTGGTGAGGGAGTGGGGGGCTGG + Intergenic
1160651738 19:234448-234470 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1160673554 19:377269-377291 CAGGGGGGGGAGAGGCTGGGTGG - Intergenic
1160690834 19:460295-460317 AGGGGCGGGGAGAGGGCGGCGGG - Intronic
1160708124 19:539358-539380 CAGGGGAGGGCCAGGGTGGACGG - Intronic
1160726755 19:620891-620913 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160726774 19:620932-620954 CAGGGGAGGGGGAGGGGAGGAGG + Intronic
1160736239 19:663555-663577 CGGGCGGGGGAGAGGGCGCCTGG - Intergenic
1160758119 19:768636-768658 CAGGGGCGGGAGAGCGTGTCTGG + Intergenic
1160763590 19:797602-797624 CTCGGGCGGGAGGGGGCGGCGGG + Intronic
1160774480 19:848695-848717 CAGGGGACGGGGAGGAGGGCAGG + Intergenic
1160812351 19:1018268-1018290 CTGGGGAGAGAGGAGGCGGCAGG - Intronic
1160818048 19:1045234-1045256 CAGGCGAGGGAGGGGGCGGGGGG + Intronic
1160835791 19:1123908-1123930 CAGGGGAGGGAGCTCTCGGCTGG + Intronic
1160922842 19:1528811-1528833 CAGGGGTGGGTGTGGGTGGCAGG + Intronic
1160967177 19:1751918-1751940 CTGGGGAGGGATAGGGCTGAAGG - Intergenic
1160979934 19:1812191-1812213 CAGGAGAGGCAGGGGGGGGCAGG + Exonic
1160982783 19:1823851-1823873 CAGGCTTGGGAGAGGGTGGCTGG + Intronic
1161100536 19:2419020-2419042 GAAGGGAAGGAGAGGGCGGGAGG - Intronic
1161100554 19:2419066-2419088 GAAGGGAAGGAGAGGGCGGGAGG - Intronic
1161153644 19:2721546-2721568 CCGGGGTGGGAGAGGTCGCCAGG + Intronic
1161208287 19:3053607-3053629 CAGGGGAGGAGGAGGGAAGCCGG + Exonic
1161238417 19:3209037-3209059 CACGGAAGGGAGACGGCTGCGGG - Exonic
1161256944 19:3314890-3314912 CGGGGGCAGGAGGGGGCGGCCGG + Intergenic
1161381669 19:3968751-3968773 CAGGCTAGGGAGAGTGCTGCAGG - Intronic
1161471189 19:4457469-4457491 CAGGGGAGGGGGAGAGGCGCCGG - Intronic
1161495420 19:4583634-4583656 CAGGGGAGGGAGGGGATGCCAGG - Intergenic
1161750498 19:6092725-6092747 CGGGGGAGGGAGAGGCTGCCAGG + Intronic
1161847067 19:6718227-6718249 CAGGTGAGGCTGGGGGCGGCTGG - Exonic
1161864319 19:6822353-6822375 CTGGGGAGGGCGTGGGCGGGGGG + Intronic
1161925235 19:7294471-7294493 CAGGGGAGGGAGGTGCCGCCCGG + Intergenic
1161981077 19:7630693-7630715 CAGGGGTGGGAGAGGGTGTGGGG + Intronic
1162022467 19:7874106-7874128 CAGGGGAGGCCGATGGGGGCTGG - Intronic
1162153414 19:8661020-8661042 GAAGGGAGGGAGAGGGAGGGAGG - Intergenic
1162534766 19:11256325-11256347 CAGAGGAGGGAGAGGGGAGGAGG + Intronic
1162578512 19:11513545-11513567 GAAGGGAGGGAGAGAGAGGCAGG + Intronic
1162722932 19:12673143-12673165 CAGGGGTGGGAGAGGAGGGAAGG - Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1163213922 19:15862469-15862491 GAGGGGAGGGAGAGGGGGAGGGG + Intergenic
1163305061 19:16472459-16472481 CGGGGCAGGGTGAGGGGGGCAGG - Intergenic
1163376923 19:16938744-16938766 GATGGGAGGAAGAGGGTGGCTGG - Intronic
1163420775 19:17212465-17212487 CAAGGCAGGGAGAGGCCGGCTGG + Exonic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163507773 19:17718512-17718534 GAGGGGAGGGAGAGGAAGGGAGG + Intergenic
1163605723 19:18274331-18274353 CAGGGGCGGGTGAGTGGGGCTGG - Intronic
1163647119 19:18495750-18495772 CAGTGGAGGGATGGGGAGGCAGG + Intronic
1163663857 19:18594163-18594185 CAGGGGAGGGGGAAGACAGCAGG - Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163795431 19:19335172-19335194 GAGGGGAGGGAGGGGGCTCCAGG - Intronic
1163919594 19:20276237-20276259 CAGGGAAGAGAAAGGACGGCCGG + Intergenic
1164066236 19:21720258-21720280 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066242 19:21720277-21720299 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066248 19:21720296-21720318 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066254 19:21720315-21720337 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066260 19:21720334-21720356 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066266 19:21720353-21720375 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1164066272 19:21720372-21720394 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1164572613 19:29385266-29385288 CAAGGGAGAGAGGGGGTGGCAGG + Intergenic
1164581770 19:29439193-29439215 GAGGGGGGAGAGAGGGAGGCAGG + Intergenic
1164645432 19:29855700-29855722 GAGGGGAGGGAGTGGGGGGCAGG - Intergenic
1164654357 19:29910054-29910076 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654382 19:29910134-29910156 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654428 19:29910274-29910296 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164684714 19:30159087-30159109 CAGAGGAGGGAGGGGGCGCATGG - Intergenic
1164718670 19:30415168-30415190 AGGGGGAGGGAGAGGGAGACAGG - Intronic
1164834553 19:31349274-31349296 ACAGGGAGGGAGGGGGCGGCGGG + Exonic
1165102009 19:33444598-33444620 CATGGGAGGGAGGGGGCTGGAGG - Intronic
1165333812 19:35155458-35155480 CAGGGCAGGGAAAGGGCTGCAGG + Exonic
1165349655 19:35269017-35269039 GAGGGGAGGGGGCGGGCGGCCGG - Intronic
1165354238 19:35293834-35293856 GTGGGGTGGGAGAGGGCGGCAGG + Intronic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165762070 19:38327268-38327290 CAGGGCACGGAGGGGGCAGCAGG - Exonic
1165903405 19:39179148-39179170 CAGGGGCTGGAGAGGGTGGGGGG - Exonic
1165904213 19:39183740-39183762 CTGGGGAGGGAGAGGGGTGAGGG + Intergenic
1165926020 19:39326734-39326756 GAGGGGAGGGGGAGGGGAGCGGG + Intergenic
1166079334 19:40434000-40434022 CTGGGGAGGGAGGAGGCGCCAGG + Intergenic
1166079440 19:40434373-40434395 CAGGGCAGGCAGAGAGCTGCAGG + Intergenic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166361265 19:42253918-42253940 CGGGGGAGGGGGAAGGGGGCCGG - Intronic
1166381656 19:42358069-42358091 CAGGGGACCGGGAGGTCGGCGGG + Intronic
1166419112 19:42620973-42620995 CAGGTGAGGGAAAGTGGGGCAGG - Intronic
1166843419 19:45712430-45712452 CAGGGGGCGGAGGGGGCGCCGGG + Exonic
1166861819 19:45815705-45815727 CCGGGGAAGGAAAGGGCAGCCGG + Intronic
1166948034 19:46409127-46409149 AAGGGGAGGGAGAGGGAGAGGGG + Intergenic
1167075141 19:47244019-47244041 CGGGGAAGGGAGAGGGGGGCGGG - Intergenic
1167080834 19:47275181-47275203 CAGGAGAGGGAGGCAGCGGCGGG - Exonic
1167103211 19:47416707-47416729 GAGGGAAGAGAGAGGCCGGCAGG + Intronic
1167114879 19:47483400-47483422 CAGGGGAGGGCAGGGGTGGCAGG + Intronic
1167123307 19:47531949-47531971 TAGGGGAGGGAGAGTGCAGCAGG + Intronic
1167216697 19:48170195-48170217 GATGGGAGGCGGAGGGCGGCGGG - Intronic
1167250846 19:48397746-48397768 ACGGGGAGGGAAAGAGCGGCAGG - Intronic
1167295500 19:48646699-48646721 CTGGCGAGGGAGAGAGGGGCGGG + Intergenic
1167383759 19:49152523-49152545 CAGGGGAGGGGAGGGGAGGCTGG - Intronic
1167448710 19:49554855-49554877 CAGGGGAGAGTGAGGGAGCCAGG - Intergenic
1167529098 19:50003835-50003857 CAGTGCAGGGAGAGCGGGGCTGG - Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167575280 19:50314869-50314891 CAGGGTCGGGGGAGCGCGGCGGG + Intronic
1167627718 19:50603788-50603810 CAGGGGATGGGGATGGCGACAGG - Intergenic
1167628077 19:50605682-50605704 CAGGGGATGGGGATGGCGACAGG - Intergenic
1167636083 19:50656566-50656588 AAGGGGAGGCTGAGGGGGGCAGG + Intronic
1167649109 19:50719846-50719868 GAGGGAGGGGAGAGGGCGGAGGG - Intergenic
1167713242 19:51125002-51125024 TGGGGGAGGGAGAGGGCGGAAGG + Exonic
1167715833 19:51142400-51142422 TGGGGGAGGGAGAGGGTGGAAGG + Exonic
1167913964 19:52725372-52725394 CAGGGGAGGCCGACGGGGGCTGG + Intronic
1167959500 19:53094973-53094995 AAGGGCTGGAAGAGGGCGGCGGG - Intronic
1168153552 19:54461366-54461388 CAGGTGAGGCAGCGGGCGGTGGG - Exonic
1168344631 19:55644203-55644225 GAGGGGAGGGAGAGGCCTGGAGG + Intronic
1168414659 19:56160509-56160531 TGGAGGAGGGAGAGGGAGGCTGG - Exonic
1168454647 19:56496812-56496834 CGGGGGTGGGAGGGGGCGGAAGG + Intergenic
1168660642 19:58163162-58163184 CAGGGTCGGGAGAGGGGGGAGGG + Intergenic
1202694422 1_KI270712v1_random:114006-114028 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
925188727 2:1866564-1866586 AAGGGGAGAGAGAGAGAGGCAGG + Intronic
925207044 2:2015697-2015719 CAAGGGAAGGAGGGGGCGGGAGG + Intronic
925217568 2:2110610-2110632 GAGGGGAGGGAGAGGGAGAGGGG - Intronic
925337413 2:3108343-3108365 CAGGGGCGGGTGAGGGATGCTGG - Intergenic
925420207 2:3704499-3704521 TAGGGGAGGGGGAGGGGGGAGGG + Intronic
925420296 2:3704697-3704719 TAGGGGAGGGGGAGGGGGGAGGG + Intronic
925589225 2:5493498-5493520 CAAGTGAGGGAGAAGGGGGCCGG - Intergenic
926001405 2:9336290-9336312 CAGGGGAGAGAAAGGGAGGGAGG - Intronic
926115893 2:10213164-10213186 GAGGGGAGGGAAAGGGAGGGAGG + Intergenic
926126709 2:10276742-10276764 AAGGGGAGGCACAGGGTGGCGGG - Intergenic
926292381 2:11541259-11541281 AAGGGAAGGGAAAGGGAGGCCGG + Intronic
926423324 2:12718795-12718817 CCCGGGGAGGAGAGGGCGGCGGG + Intronic
926555590 2:14354240-14354262 CAGGGCAGGGAAGGGGAGGCAGG + Intergenic
926624932 2:15083156-15083178 CAGGGGTGGGAGAGGGGTACTGG - Intergenic
926683563 2:15681112-15681134 GAGGGGAGGGGGAGGGGGGAGGG + Intergenic
926683579 2:15681136-15681158 GAGGGGAGGGGGAGGGGGGAGGG + Intergenic
926683591 2:15681154-15681176 GAGGGGAGGGGGAGGGGGGAGGG + Intergenic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926765218 2:16318139-16318161 GAGAGAAGGGAGAGTGCGGCAGG + Intergenic
926924451 2:17972985-17973007 AAGGGGCTGGAGAGGGAGGCAGG + Intronic
927208822 2:20626449-20626471 CAGGGAAGGGACAGGCAGGCTGG + Intronic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927696741 2:25244469-25244491 GAGGGGAGGCGGTGGGCGGCGGG + Intronic
927708039 2:25309107-25309129 CAGGGGTGGGTGAGGCCTGCTGG - Intronic
927962711 2:27250706-27250728 GAGTGGAGGGAGAGAGAGGCAGG - Intergenic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
928373072 2:30755166-30755188 GAGAGGAGGAAGAGGGCGCCAGG - Intronic
928609480 2:32977439-32977461 AAGGGCGGGGTGAGGGCGGCTGG + Intronic
929013252 2:37469062-37469084 GAGGGGAGGGAGGGGAGGGCAGG - Intergenic
929761055 2:44806520-44806542 GAGGGGAAAGAGAGGACGGCAGG - Intergenic
929777258 2:44937208-44937230 CAGGGAGGGGAGCGGGTGGCAGG - Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930136250 2:47906137-47906159 CAGCGGGGGGAGTGGGCGGGCGG + Intergenic
930209004 2:48615465-48615487 AAGGAGAGGGAGAGGGAGACGGG + Intronic
930209010 2:48615484-48615506 CGGGAGAGGGAGAGGGAGACGGG + Intronic
930209016 2:48615503-48615525 CGGGAGAGGGAGAGGGAGACGGG + Intronic
930209022 2:48615522-48615544 CGGGAGAGGGAGAGGGAGACGGG + Intronic
931356136 2:61538698-61538720 ACCGGGAGGGAGAGGGCCGCAGG - Intergenic
931664123 2:64598166-64598188 CAGGGGAGGGATGGTGAGGCAGG - Intergenic
931689075 2:64819948-64819970 CAGGGGTGGGAGAGGGGTACGGG - Intergenic
931695722 2:64869212-64869234 CAGCAGAGGGTGAGGGCTGCGGG + Intergenic
931751864 2:65338174-65338196 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751870 2:65338193-65338215 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751876 2:65338212-65338234 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751886 2:65338244-65338266 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751892 2:65338263-65338285 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751898 2:65338282-65338304 CGGGAGAGGGAGAGGGAGACGGG - Intronic
931751904 2:65338301-65338323 AAGGAGAGGGAGAGGGAGACGGG - Intronic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
932127375 2:69156325-69156347 AAAGGGAGGGAGAGGGATGCTGG - Intronic
932330173 2:70894292-70894314 AAGGGCAGGGAGAGGATGGCTGG - Intergenic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932616137 2:73232957-73232979 CAGGTCTGGGAGCGGGCGGCCGG - Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
933078044 2:77954293-77954315 CAGGGGATGGGGATGGCGACAGG + Intergenic
933212362 2:79585718-79585740 CGGGGGAGGGAGGGAGGGGCTGG - Intronic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933731303 2:85458272-85458294 AAGGTGAGGGAGAGGTCGGCAGG + Intergenic
933742238 2:85543355-85543377 CATGGTAGGGTGTGGGCGGCGGG + Intronic
933769469 2:85733978-85734000 CTGGGGTGGGAGATGGTGGCAGG - Intergenic
933893462 2:86790730-86790752 CAGGGGATGGGGCGGGCGGGGGG - Intronic
933952139 2:87340558-87340580 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
933979457 2:87538539-87538561 CAGGGGGACGAGGGGGCGGCTGG - Intergenic
934077973 2:88443801-88443823 CGGGGGATGGAGAGGGTGGTGGG + Intergenic
934236383 2:90236896-90236918 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
934523341 2:95033427-95033449 CCAGGGAGGGAGAAGCCGGCTGG + Intronic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934736942 2:96694298-96694320 GAGGTGAGGGTGAGGGCAGCAGG + Intergenic
934790874 2:97059062-97059084 CAGGGGAGGGAGAGGTCCTGGGG - Intergenic
934815577 2:97323468-97323490 CAGGGGAGGGAGAGGCCCTGGGG + Intergenic
934822118 2:97385015-97385037 CAGGGGAGGGAGAGGCCCTGGGG - Intergenic
935597954 2:104894494-104894516 CAGGGGAGGAAGAGGAAGCCTGG - Intergenic
935627289 2:105181562-105181584 CAGGGGAGGAAGAGGAGGGGTGG + Intergenic
935902871 2:107811274-107811296 CTGGGGAGGGAGAGAGAGGCAGG - Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936203055 2:110424559-110424581 CAGAGGAGGGAGAGGCCTGGAGG + Intronic
936314366 2:111412252-111412274 CAGGGGGACGAGGGGGCGGCTGG + Intergenic
936528343 2:113257593-113257615 CAGGGGAGGGAGATAGAGGATGG + Intronic
937221457 2:120345125-120345147 CAGGGCCGGGAGAGAGCGGGCGG - Intergenic
937268736 2:120633619-120633641 CAGGGAAGGGGAAGGGGGGCAGG - Intergenic
937477771 2:122230189-122230211 CAGTGGAGGCAGAGGCCTGCAGG - Intergenic
937584482 2:123530044-123530066 TGGGGGAGGGAGAGGGGAGCTGG - Intergenic
937777523 2:125797288-125797310 GAGGGGAGGGGGAGGGGGACGGG + Intergenic
937956268 2:127423244-127423266 CAGGGGAGGGCGCGGGCAGCTGG - Intronic
937986551 2:127640626-127640648 CAAGGGAGGGAGGGGGTTGCTGG + Intronic
938018197 2:127885401-127885423 CGGGCGGGGGAGGGGGCGGCGGG + Intronic
938086934 2:128407816-128407838 CAGGGGAGGGAGTGTGTGGGAGG + Intergenic
938207757 2:129438537-129438559 CTGGGGAGGGAGAGGGAGCCTGG - Intergenic
938410117 2:131056598-131056620 CAGGGGAGGGAGAGGGTCTCTGG + Intronic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
938745861 2:134277546-134277568 CAGGGGAGGGAGCTGGTGGGAGG - Intronic
939178660 2:138780406-138780428 CAGGGAAGGGGGAGGGTGGGCGG + Intergenic
940775122 2:157876466-157876488 GAGGGGAGAGAGGAGGCGGCGGG + Intergenic
940835734 2:158519478-158519500 AAGGGGAGAGAGAGTGCAGCTGG - Intronic
940946407 2:159623083-159623105 GAGGGGAGGGAGAGGGGAGAGGG + Intergenic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941065950 2:160902995-160903017 CTGGGGTGGGAGAGGGTGTCAGG + Intergenic
941168031 2:162104346-162104368 CAGGGGAAAGAGAGGGCACCAGG + Intergenic
941384901 2:164841247-164841269 CTGGGGTGGGAGAGGCCGGCGGG + Exonic
941490112 2:166133209-166133231 CAGGGAAGGCAGAGGGCAACTGG - Intergenic
941773184 2:169364311-169364333 CTGGGGAGGGAGGGGGCGACCGG + Intergenic
941933254 2:170963486-170963508 CTGGGGCGGGGGAGGGGGGCGGG - Intronic
941964641 2:171288941-171288963 CAGGGGAGTGAAACAGCGGCAGG + Intergenic
942045182 2:172095720-172095742 GAGGGAAGGGAAAGGTCGGCCGG + Intergenic
942965840 2:181891873-181891895 AAGGGGAGGGAAGGGGCGGAGGG - Exonic
943635409 2:190301469-190301491 CAGAGGAGGGAGAGGGAGTTGGG + Intronic
943700195 2:190980990-190981012 CTGGGGAGGGAGAGAGCAGATGG - Intronic
943727341 2:191265966-191265988 GAGGGGGTGGAGAGGGAGGCAGG + Intronic
943773168 2:191741099-191741121 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943773174 2:191741118-191741140 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943773195 2:191741182-191741204 CGGGAGAGGGAGAGGGAGACAGG - Intergenic
943773200 2:191741201-191741223 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
943773206 2:191741220-191741242 AAGGAGAGGGAGAGGGAGACGGG - Intergenic
944159073 2:196639860-196639882 CAGGACAGGGAGAGGGCGCCAGG - Intronic
944599042 2:201284649-201284671 CATGAGAGGGAGAGGGAGACGGG + Intronic
944863536 2:203838724-203838746 CAGGAGAGGGAAAGGGCCGGTGG + Intergenic
945090542 2:206172591-206172613 AAGGAGAGGGAGAGGGAGACGGG + Intergenic
945090548 2:206172610-206172632 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090554 2:206172629-206172651 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090560 2:206172648-206172670 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090566 2:206172667-206172689 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090572 2:206172686-206172708 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090578 2:206172705-206172727 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090616 2:206172823-206172845 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090662 2:206172967-206172989 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090668 2:206172986-206173008 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090678 2:206173018-206173040 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090688 2:206173050-206173072 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090694 2:206173069-206173091 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090700 2:206173088-206173110 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945090706 2:206173107-206173129 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945219510 2:207469424-207469446 CATGCGAGGGAGAGGGAAGCTGG - Intergenic
945251628 2:207769712-207769734 CAGGGGAGGAGGCGAGCGGCGGG - Intergenic
945314733 2:208359822-208359844 CAGGGGAAGGCGAGGGTGGCTGG + Intronic
945314872 2:208360523-208360545 CGAGCGAGCGAGAGGGCGGCAGG - Intronic
945970609 2:216227528-216227550 CATGAGAGGGAGAGGGAGACGGG + Intergenic
945970615 2:216227547-216227569 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970621 2:216227566-216227588 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970627 2:216227585-216227607 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970633 2:216227604-216227626 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970643 2:216227636-216227658 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970649 2:216227655-216227677 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970655 2:216227674-216227696 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970661 2:216227693-216227715 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970667 2:216227712-216227734 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970673 2:216227731-216227753 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
945970679 2:216227750-216227772 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
946027972 2:216683541-216683563 CAGGTGAGGGAGAGGGGAACAGG + Intronic
946188111 2:217992666-217992688 CAGGGGAGAGAGAGGGGTGCGGG + Intronic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
946394084 2:219434742-219434764 CCGTGGAGGGAGGGGGCAGCAGG - Intergenic
946421886 2:219570063-219570085 CTGGGGAGTGAGAGGCGGGCGGG + Intronic
946524676 2:220505546-220505568 CAAGAGAGGGAGAGAGAGGCAGG + Intergenic
947188117 2:227472630-227472652 GAGGTGGGGGAGCGGGCGGCGGG + Intronic
947549772 2:231037812-231037834 CAGAGGGCGGCGAGGGCGGCTGG + Exonic
947589901 2:231379575-231379597 TGGGGGAGGGGGAGGGAGGCAGG + Intergenic
947769455 2:232659448-232659470 GAGGGCAGGGAGGGGGTGGCTGG + Intronic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948242330 2:236447881-236447903 CAGGGGAGGGTGGGGGAGGGTGG + Intronic
948285154 2:236778523-236778545 TAGGGGAGGGAGAGGGGAGTAGG - Intergenic
948801974 2:240437120-240437142 CAGGGGAGTGGGAGTGCGGGTGG + Intronic
948852935 2:240717273-240717295 CAGGAGAGGGGCTGGGCGGCAGG + Exonic
948995453 2:241576083-241576105 CAGGGGAGGGGGAGGAGAGCTGG - Intergenic
949009801 2:241671975-241671997 CAGGGCAGGGTGAGGAGGGCAGG - Intronic
949014617 2:241702269-241702291 GAGGGGAGGGCGCGGGGGGCGGG + Intronic
1168765835 20:381210-381232 GGGGGGCGGGAGGGGGCGGCCGG + Intronic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1169043739 20:2518952-2518974 CAGGAAAGAGAGAGGGGGGCAGG - Intronic
1169085318 20:2822528-2822550 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085340 20:2822598-2822620 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085346 20:2822617-2822639 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085352 20:2822636-2822658 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085358 20:2822655-2822677 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085364 20:2822674-2822696 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085370 20:2822693-2822715 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085376 20:2822712-2822734 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085382 20:2822731-2822753 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085388 20:2822750-2822772 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085394 20:2822769-2822791 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085400 20:2822788-2822810 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085406 20:2822807-2822829 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085412 20:2822826-2822848 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085418 20:2822845-2822867 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085424 20:2822864-2822886 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085430 20:2822883-2822905 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085436 20:2822902-2822924 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085442 20:2822921-2822943 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085448 20:2822940-2822962 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085454 20:2822959-2822981 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169085460 20:2822978-2823000 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1169124314 20:3116128-3116150 CTGGGGAGGGAATGGGGGGCAGG - Intronic
1169328552 20:4697758-4697780 CAGGGGAGGAGCAGGGAGGCTGG + Intronic
1169381741 20:5113260-5113282 CAGCGGAGGTAGCCGGCGGCAGG - Intergenic
1169525998 20:6426323-6426345 AAGGGGAGGGAGAGAGAGGGAGG - Intergenic
1169810690 20:9606227-9606249 CAGGAGGAAGAGAGGGCGGCAGG - Intronic
1169912016 20:10654755-10654777 CTGGGCAGGGAGAGGGAGGTGGG + Intronic
1169914642 20:10673400-10673422 GAGGGGAGGGAGAGGACGGCTGG + Intronic
1170047839 20:12105492-12105514 CAGGGGAGAGAGATGTAGGCTGG - Intergenic
1170435019 20:16317777-16317799 CAGGTGAGGGTGAGGGTGGCAGG - Intronic
1170459473 20:16563978-16564000 CAAGGGAGGGAAGGGGCTGCTGG - Intronic
1170545980 20:17436235-17436257 CAGGGGACAGAGAGAGGGGCAGG - Intronic
1170783637 20:19449069-19449091 GTGGGCAGGGAGAGGGAGGCAGG + Intronic
1171178985 20:23077589-23077611 GAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1171178993 20:23077607-23077629 GAAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171249697 20:23638242-23638264 GAGGGGAGGGAGAGGGGAGGCGG - Intronic
1171278574 20:23878643-23878665 CTGTGCAGGGAGAGGGCTGCAGG + Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171320164 20:24236035-24236057 CTGGGGATGGAGAGGCAGGCAGG + Intergenic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1171950774 20:31419717-31419739 CAGGTGAGAGAGAGGGCACCAGG - Intergenic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172117432 20:32581319-32581341 CAGGGCAGAGAGAGGGCGAGGGG - Intronic
1172152687 20:32801463-32801485 CAGGGCAGGGAAAGCGCTGCTGG + Intronic
1172192520 20:33070586-33070608 CAGGGGAGGGACAGACAGGCCGG - Intronic
1172422038 20:34825665-34825687 CCGGGGAGGGAGGGGGAGGGAGG + Intergenic
1172428623 20:34872865-34872887 CGGGGGAGTGGGAGGGCGGAGGG + Intronic
1172468513 20:35174651-35174673 CCGGCGTGGGAGGGGGCGGCGGG - Intronic
1173485412 20:43437471-43437493 GAGGGGAGGGAAAGGGTGGGGGG + Intergenic
1173617855 20:44414442-44414464 CAGGGGACAGAGAGTGCGGGAGG + Intronic
1173807464 20:45935086-45935108 CGGGGGCGGGAGCGCGCGGCGGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174177995 20:48657060-48657082 CAGGAGGCGCAGAGGGCGGCGGG + Exonic
1174215285 20:48911776-48911798 GAGGTCAGGGAGAGGGAGGCAGG - Intergenic
1174292622 20:49519735-49519757 CAGAAGAGGGAGATGGCGGGAGG - Intronic
1174364869 20:50050541-50050563 GAGGGGAGGGAGAGGGGGCTGGG + Intergenic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175429249 20:58890937-58890959 AAGGGGAGGGAGCGCGCGCCCGG - Intronic
1175522597 20:59611698-59611720 CTGGGGCCGGAGAGGGAGGCAGG - Intronic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175547172 20:59785891-59785913 CAGGGGATGCAGAGGGCCGTTGG - Intronic
1175547180 20:59785925-59785947 CAGGGGAGGCAGAGGGCCGTTGG - Intronic
1175550391 20:59813725-59813747 CAGGGCTGGGTGAGGGTGGCAGG + Intronic
1175612804 20:60365435-60365457 CAGGGCAGGGAGGGGCTGGCCGG - Intergenic
1175674338 20:60933960-60933982 CAGGGGAGAGAGAGAGGGCCAGG - Intergenic
1175834505 20:61984950-61984972 CGGGGGTGGGAGGGGGCGGAAGG + Intronic
1175912706 20:62412445-62412467 CAGAGGAGGGCGAGGGTGGCCGG - Intronic
1176085587 20:63294140-63294162 GAGGGGAGGGGGAGTGCGGGGGG + Intronic
1176090536 20:63316482-63316504 CAGGGGAGGGAGGAAGGGGCAGG - Intronic
1176099835 20:63359960-63359982 CAGGGGTGGGAGAGAGCCGGAGG - Intronic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176131773 20:63499322-63499344 CAGGGCAGGGAGGCGGCGGGAGG + Intergenic
1176138583 20:63535758-63535780 CAGGTGAGGGGGGGGGCGGGAGG - Intronic
1176138616 20:63535828-63535850 CAGGTGAGGGGGGGGGCGGGAGG - Intronic
1176138992 20:63537012-63537034 CAGGGGAGGGACAGGGCTCTGGG - Intronic
1176142071 20:63549188-63549210 TGGGGGGAGGAGAGGGCGGCGGG - Intronic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1176733491 21:10521916-10521938 GAGGGGACGGGGAGGGCGGAGGG - Intronic
1178258856 21:31080174-31080196 CAGGGTAGAGAGAGGTGGGCTGG + Intergenic
1179133723 21:38661169-38661191 CAGGGGAGGGAAAGTGTGGGAGG + Intronic
1179195025 21:39156588-39156610 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1179195039 21:39156632-39156654 AAGGAGAGGGAGAGGGAGACGGG - Intergenic
1179275212 21:39885692-39885714 CAGGGGAGGGAGAGGGTGCCTGG - Intronic
1179439480 21:41382982-41383004 CAGGGGTGAGGGAGGGCGACCGG + Intronic
1179485379 21:41706714-41706736 CAGGGGAGGGAGCTGGAGGTGGG - Intergenic
1179626813 21:42653714-42653736 CAGGGGAGGGGGCGGGCGGGGGG - Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179885727 21:44313532-44313554 CAGTGGATGGAGAGGCAGGCAGG - Intronic
1180012607 21:45060696-45060718 CAGGGGAGGGCGATGGAGGGAGG + Intergenic
1180064259 21:45404983-45405005 CGGGGAGGGGAGAGGGGGGCGGG - Intergenic
1180094451 21:45549627-45549649 CAGGGGAGGGGCAGGGGGACAGG + Intergenic
1180095924 21:45555296-45555318 CAGGGGGCGGCGGGGGCGGCGGG + Intergenic
1180160825 21:45997993-45998015 CAGGGGAGGGAGCCGGCTTCTGG + Intronic
1180186830 21:46144469-46144491 AAGGGGAGGGAGAGGGGGAGAGG - Intronic
1180217973 21:46338299-46338321 CTGGGGAAGGAGAGAGCGGCTGG - Intronic
1180320005 22:11311157-11311179 GAAGGGAGAGAGAGGGAGGCAGG - Intergenic
1180841947 22:18963243-18963265 GAGGGCAGGGAGAGGCCTGCAGG - Intergenic
1180922515 22:19528346-19528368 CGGGTGAGGGAGTGGGGGGCAGG + Intergenic
1180927416 22:19565961-19565983 CGGGGGAGGGATGGGGCGGGAGG - Intergenic
1180945118 22:19688486-19688508 CCGGGCAGGGAGAGGGCAGTGGG - Intergenic
1180951193 22:19721351-19721373 CTGGGGAGGGAAGGGGCAGCTGG + Intronic
1181059552 22:20275638-20275660 GAGGGCAGGGAGAGGCCTGCGGG + Intronic
1181236639 22:21451062-21451084 CCGGGGTGGGAGAGGGCAGAGGG - Exonic
1181534223 22:23533421-23533443 CAGGTGAGGGAGGCAGCGGCAGG + Intergenic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181645794 22:24231341-24231363 CGGGGGAGGGGGTGGGCGCCAGG + Intronic
1181803256 22:25360635-25360657 GAGGGGAGGGAGAGAGCTTCAGG - Exonic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182036549 22:27202979-27203001 CCGAGGAGGGGGAGGGCCGCGGG - Intergenic
1182095191 22:27621194-27621216 TAGGGGAGAGAGAGGAGGGCAGG - Intergenic
1182151108 22:28027800-28027822 CAGGGCAGGGACAGGCTGGCAGG + Intronic
1182351726 22:29703551-29703573 CATGGAAGGGGGAGAGCGGCTGG + Intergenic
1182362337 22:29754105-29754127 CAGGGGAGGAAGGGGACAGCTGG + Intronic
1182418846 22:30238819-30238841 CTTGGGAGGGAGAGGCCGGCAGG - Intergenic
1182523358 22:30898688-30898710 CAGGGGAGGGACCGGGTGGGAGG - Intronic
1183093619 22:35540067-35540089 CTCGGGAGGGAGGCGGCGGCTGG + Intergenic
1183248546 22:36712032-36712054 CAGGATGGGGAGAGGGCGGAGGG + Intergenic
1183368591 22:37419911-37419933 CAGGGGCGGGGGCTGGCGGCGGG - Intronic
1183432507 22:37774296-37774318 TAGGGCAGGAAGAGGGTGGCAGG - Exonic
1183598627 22:38827100-38827122 CAGGGGAGGGACAGGTCTGGTGG - Intronic
1183654610 22:39177366-39177388 GAGGGGAGGGAGAGGGTGGGAGG - Intergenic
1183694553 22:39414281-39414303 CAGGGGATGGACAGGGCTGTAGG + Intronic
1183713503 22:39520447-39520469 GAGGGAAGGGAGCGGGCGGGAGG + Intronic
1183724009 22:39578493-39578515 CAGGGGAGGAGGAGGGAGGGTGG - Intronic
1183871892 22:40746367-40746389 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1183871898 22:40746386-40746408 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871904 22:40746405-40746427 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871910 22:40746424-40746446 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871924 22:40746468-40746490 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871930 22:40746487-40746509 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871936 22:40746506-40746528 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871942 22:40746525-40746547 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871948 22:40746544-40746566 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871954 22:40746563-40746585 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1183871964 22:40746595-40746617 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1184036206 22:41919549-41919571 CGTGGGAGGGAGGGGGCGCCCGG + Intergenic
1184056343 22:42052801-42052823 CAGGTGAGAGACAGGGAGGCTGG - Intronic
1184247990 22:43245324-43245346 CAGTGGAGGTAGAGGCAGGCGGG - Intronic
1184561780 22:45268160-45268182 GCGGGGAGGGAGAGGGGGACAGG - Intergenic
1184565416 22:45288954-45288976 TAGGGGTGGGAGACGGCAGCGGG - Intronic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184677919 22:46053690-46053712 CTGGGGAGGGAGAGGGCCCCAGG - Intronic
1184746348 22:46458384-46458406 CAGGGCAGGACGAGGGTGGCAGG + Intronic
1184754241 22:46507462-46507484 CCGGGGAGGGAGGGAGCCGCTGG - Intronic
1184806647 22:46798879-46798901 CAGGGCAGGGAGAGGGTTTCCGG + Intronic
1184843335 22:47065520-47065542 CAGGGGAGGGGCAGGGAGCCAGG - Intronic
1184882293 22:47316219-47316241 GAGGAGAGGGAGGGGGAGGCTGG - Intergenic
1185190443 22:49433040-49433062 CCGGGCAGGGAGAGGGCGGATGG - Intronic
1185190491 22:49433211-49433233 CCCGGCAGGGAGAGGGCGGATGG - Intronic
1185190538 22:49433414-49433436 CCCGGCAGGGAGAGGGCGGATGG - Intronic
1185190571 22:49433537-49433559 CCCGGCAGGGAGAGGGCGGATGG - Intronic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185229838 22:49673614-49673636 CGGGGGAGGGAGAGGGGGAAGGG + Intergenic
1185255209 22:49827773-49827795 CGGGCGCGGGAGCGGGCGGCGGG + Intergenic
1185340077 22:50287232-50287254 CAGGGCAGGGAGGGGGCTGACGG + Exonic
949330847 3:2920296-2920318 GAGGGGAGGTAGAAGGAGGCTGG + Intronic
949533377 3:4978437-4978459 CAGAGGAGGGAGGGAGCGCCGGG + Intergenic
949961288 3:9314633-9314655 CAGGGTGGGGAGAGGAGGGCAGG - Intronic
950139966 3:10608731-10608753 CAGGGGAGGAAGAGGCCAGTGGG - Intronic
950193275 3:10992579-10992601 CTGCGGAGGGAGCGCGCGGCGGG + Intergenic
950424832 3:12919463-12919485 CAGGGGAAGGGGAGGGCACCTGG + Intronic
950458658 3:13107851-13107873 CTGGGGAGGGAGCAGGCCGCTGG - Intergenic
950530281 3:13549065-13549087 CAGGGGAGGGGGCCGGGGGCCGG + Intergenic
950637524 3:14325217-14325239 CAGAGCAGGGAGAGGGCTGGAGG - Intergenic
950855560 3:16101493-16101515 TAGGGGAAGGACAGGGCAGCAGG - Intergenic
951537303 3:23751582-23751604 CAGGGGAGGGAGATGGGAGGGGG - Intergenic
951543850 3:23806680-23806702 GGGGGAAGGGAGAGGCCGGCGGG - Intronic
952913096 3:38207897-38207919 GAGGGGAGGGGGAGGGGGGAGGG - Intronic
953030633 3:39177707-39177729 CGGGGGGGGGAGGGGGCGGAGGG + Intergenic
953472297 3:43177627-43177649 CAGGGGAGTCAGAGGGGGGGGGG - Intergenic
953574689 3:44103577-44103599 AATGGGAGGGAGAGGGGGGTAGG + Intergenic
953890512 3:46748891-46748913 CAGTGCAGGGACAGGGTGGCAGG + Intronic
954390767 3:50267044-50267066 TAGGGGAGGGAGAGGAGGGCAGG - Intergenic
954935751 3:54325003-54325025 GAGGGGAGGGAGAAGGCAGAAGG + Intronic
955004477 3:54956061-54956083 GAGGGGAGGGAGAAGGAGACAGG - Intronic
955239279 3:57165142-57165164 GAGGGTAAGGCGAGGGCGGCGGG - Exonic
955326169 3:58010444-58010466 TTGGGGAGGGGGAGGGCTGCTGG - Intronic
955687817 3:61563072-61563094 CAGCGGAGGGAAAGGGCCACGGG - Intronic
956326834 3:68062237-68062259 CAGGGGATGGTGAGGACTGCAGG + Intronic
956741566 3:72279927-72279949 AGGAGGAGGGAGAGGGCAGCAGG + Intergenic
956825931 3:72996940-72996962 CGAGGGAGGGGGAGGGCGTCGGG + Exonic
956892339 3:73624861-73624883 GTGGGGAGGGAGGGGGCGCCCGG - Exonic
957299701 3:78375984-78376006 CAGGGGCGGGATTGGGCGGAAGG + Intergenic
959087588 3:101868086-101868108 AAGGGGAGGGGGAGGGGGACAGG - Intergenic
959466132 3:106690184-106690206 CAGGAGAGGGAGAGAGCGCAGGG + Intergenic
959976993 3:112472124-112472146 CAAGGTAGGGGGAGGGAGGCTGG + Intronic
960269586 3:115659113-115659135 CAGGGGAGTGGAAGAGCGGCCGG + Intronic
960343608 3:116505557-116505579 CAGGGTAGGGGGAGGGGGGACGG - Intronic
960811274 3:121629669-121629691 CTGGAGGGGGAGAGTGCGGCTGG - Exonic
960829846 3:121834922-121834944 CTGGGGAGGGAGAGGGCCCCAGG - Intronic
960947072 3:122974138-122974160 GCGGGGAGGGAGAAGCCGGCAGG + Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961046573 3:123712598-123712620 CAGGGGAGGGAGAGGCAGATAGG - Intronic
961105212 3:124234967-124234989 CAGGGGAGCGGGAGGGGAGCTGG + Intronic
961175021 3:124827991-124828013 CAGCGAAGGGAGCTGGCGGCGGG - Intronic
961175855 3:124834541-124834563 GAGGGGAGGGAGCGGGGGGAGGG + Intronic
961355701 3:126338774-126338796 CAGGGAAGGGAGTGCGCAGCAGG - Intergenic
961358131 3:126351711-126351733 GAGGGGAGGGAGGGGCAGGCGGG - Intronic
961460290 3:127045673-127045695 GAGGAGAGGGAGAGGGAGGGAGG + Intergenic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961718966 3:128879539-128879561 CAGGGGATGGAGAGGCCAGAAGG - Intronic
961719636 3:128884440-128884462 CAGGGGAGGGAGATGGATGTGGG + Intronic
961940959 3:130636936-130636958 CAGGGGAGGGGGAGGGGGAGGGG - Intronic
962072193 3:132044659-132044681 AAGGGGAGGGAGGGGGAGGGAGG + Intronic
962072303 3:132044874-132044896 GAGGGGAGGGGGAGGGGGGAGGG + Intronic
962072339 3:132044940-132044962 AAGGGGAGGGGGAGGGGGGAGGG + Intronic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962298992 3:134220422-134220444 AGGGGGAGGGAGAGGGAGACTGG + Intronic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
964030587 3:152134665-152134687 CAGGGGAAGGATAGGGCATCAGG + Intergenic
964819463 3:160755015-160755037 CTCGGGAGGGAGAAGGCTGCTGG + Intergenic
965147993 3:164931053-164931075 CAGGGGATGGAGAGTGGGGATGG + Intergenic
965590608 3:170357563-170357585 CGGGGGAGAGCGAGGGCGGCGGG - Intergenic
966060541 3:175749208-175749230 AAGGGGAGGGAGAGGGGGTAGGG + Intronic
966435126 3:179875497-179875519 CAGGTGAGGCAGGTGGCGGCAGG + Intronic
966624598 3:182002395-182002417 GTGGGGAGGGAGATGGGGGCAGG - Intergenic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
966919392 3:184602070-184602092 GAGGGGAGGCTGGGGGCGGCGGG + Intronic
967191704 3:186990595-186990617 GAGGGATGGGAGAAGGCGGCTGG - Intronic
967557673 3:190877306-190877328 CAGGGGATGGGGATGGCGACAGG + Intronic
967942509 3:194777052-194777074 CACTGGAGGGAGAGGGCTGCGGG + Intergenic
967962822 3:194939406-194939428 CAGGGGAGGTAGAGGGGAGACGG + Intergenic
968089774 3:195892792-195892814 CAGGCAAGAGGGAGGGCGGCCGG - Intronic
968293523 3:197556145-197556167 TCGGGGAGCGAGAAGGCGGCGGG - Intronic
968366093 3:198185520-198185542 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
968503370 4:961202-961224 CTGGGGCGGGAGAGGCCAGCCGG + Intronic
968503414 4:961321-961343 CTGGGGCGGGAGAGGCCAGCCGG + Intronic
968503440 4:961383-961405 CTGGGGCGGGAGAGGCCAGCTGG + Intronic
968584703 4:1410757-1410779 CAGGGGAGGAAGAGGGCGGCAGG + Intergenic
968616134 4:1578733-1578755 CAGGGAAGGGAGGGGAGGGCAGG + Intergenic
968628240 4:1637603-1637625 CAGGAGAGGGGGAGGGCTGGGGG + Intronic
968633934 4:1668004-1668026 GAGGGGAGGGACAGGGAGCCTGG + Intronic
968688771 4:1978935-1978957 CAGGGGCGGTGCAGGGCGGCCGG + Exonic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
968758296 4:2427947-2427969 CAGGGGCTGGAGAGGGGAGCAGG + Intronic
968780692 4:2578936-2578958 CAGAGGAGGTAGAGGAAGGCAGG + Intronic
968881311 4:3301595-3301617 CCGGGGATGGAGAGTGAGGCCGG + Intronic
968881336 4:3301661-3301683 CTGGGGATGGAGAGTGAGGCCGG + Intronic
968942439 4:3645854-3645876 CAGGGGTGGGAGAGGGCGCTGGG - Intergenic
968954835 4:3712967-3712989 GAGGGGGAGGAGTGGGCGGCTGG - Intergenic
969330515 4:6471589-6471611 AGTGGGAGGGAGAAGGCGGCTGG - Intronic
969355216 4:6621069-6621091 CAGGAGGGTGAGAGGGAGGCTGG + Intronic
969371563 4:6734507-6734529 GAGGCAAGGCAGAGGGCGGCTGG - Intergenic
969396808 4:6927070-6927092 CAGGGGAGTGACAGGAGGGCTGG + Intronic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
969437456 4:7196631-7196653 GAGGGGAGGGAGAGGGAAGGGGG - Intronic
969444739 4:7238270-7238292 CTGGGGAGGTAGAGGGAGTCTGG + Intronic
969479728 4:7441497-7441519 CAGGGGAGGCGCAGGCCGGCAGG + Intronic
969493163 4:7511408-7511430 AGGGGGAGGGAGAGAGGGGCGGG + Intronic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
969640375 4:8394819-8394841 CAGTGCAGGGAGAGGCCGTCAGG + Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
969872959 4:10116265-10116287 CAGGGCAGGGCGGGGACGGCGGG + Intronic
969997369 4:11326674-11326696 AAGAGAAGGGAGAGGGCTGCAGG + Intergenic
970523548 4:16909345-16909367 CAGGGGAGGGAAAGAGAGGCAGG - Intergenic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
971451221 4:26803789-26803811 CAAGGAGGGGAGAGGACGGCTGG + Intergenic
972294521 4:37723923-37723945 CAGGTTAGGAAGATGGCGGCGGG - Intergenic
972414368 4:38824076-38824098 CAGGGGGGGGCGGGGGCGGCGGG - Exonic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972565522 4:40265676-40265698 GAGGGAAGGGAGAGGGAGGAGGG + Intergenic
973279788 4:48347318-48347340 CAGGGGTGGGGGAGGGGGGGTGG - Intronic
973754753 4:54064151-54064173 CGGAGGAGGGCGAGGGCGGGAGG - Intronic
974482972 4:62470271-62470293 GAGGGGAGGGGGAGGGGGGAAGG - Intergenic
974766724 4:66356957-66356979 CAGGGGTGAGAAAGGGAGGCAGG - Intergenic
975139089 4:70902294-70902316 GAGGGGAAGGAAAGGGAGGCGGG - Intergenic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
976478340 4:85510605-85510627 CAGGGGAGGGAGGGGAAGACGGG - Intronic
976695819 4:87918775-87918797 AAGGGGAGGGAAAGGGAGGGAGG + Intergenic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977922385 4:102659906-102659928 CTGGGGATGGAGAGGGTAGCTGG - Intronic
979333826 4:119445334-119445356 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
979468996 4:121072615-121072637 CAGAGGAGGGAGGGGGCGGGCGG - Intronic
979624419 4:122828573-122828595 GAGGGGAGGTGGAGGGGGGCTGG + Intronic
979942552 4:126779903-126779925 CAGTGGAGGGTCAGGGTGGCAGG - Intergenic
980309666 4:131109685-131109707 GAGGAGAGGGAGAGAGAGGCTGG + Intergenic
980471864 4:133263237-133263259 GAGGGGAGGGAGAGGGGGCGGGG - Intergenic
980841231 4:138264155-138264177 CAGGGAAGGGAGAGGGGGTGAGG - Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
981816739 4:148839660-148839682 CAGAGGAGGGAGAGGGTTGGGGG + Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982306286 4:153934559-153934581 AAGGGGAAGGAGAGCACGGCAGG - Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
983490986 4:168388804-168388826 CAGGGGAGGGGCAGGGCAACAGG + Intronic
983654709 4:170071251-170071273 CAGGTGAGGGAGAGAGTGACAGG + Intronic
984139997 4:175993138-175993160 GAGGGGAGGGAGAGAGGGGAGGG - Intronic
984462692 4:180057985-180058007 CTGGTGTGGGGGAGGGCGGCCGG + Intergenic
984761481 4:183366507-183366529 GAGGAGAGGGAGAGGACGGGAGG + Intergenic
984897848 4:184557763-184557785 GAAGGGAGGGAGAGGGGGACAGG + Intergenic
985425802 4:189828906-189828928 CAGGTAAGGGAGAGAGAGGCAGG - Intergenic
985425809 4:189828951-189828973 CAGGTAAGGGAGAGAGAGGCAGG - Intergenic
985520786 5:373236-373258 CAGGGCAGGGCCAGGGCCGCGGG - Intronic
985549159 5:524479-524501 CCGGGGCGGGAGGGGGCCGCGGG - Intergenic
985564230 5:607293-607315 GAGGGGAGTGTGAGGGCAGCGGG - Intergenic
985620438 5:952210-952232 CAGGGGAGGGAGGTGGGGGGTGG - Intergenic
985677155 5:1238119-1238141 CAGGTGAGGGAGGGAGCTGCTGG - Intronic
985716901 5:1467867-1467889 CCAGGCAGAGAGAGGGCGGCGGG - Intronic
985720018 5:1484055-1484077 CAGGGGCAGGTGAGGGCGGCGGG - Intronic
985720207 5:1484933-1484955 CAGGGGAGGCGGAGGACGGCAGG + Intronic
985744946 5:1641161-1641183 CGTGGGAGGAGGAGGGCGGCGGG - Intergenic
985781603 5:1874516-1874538 ATGGGGAGAGAGAGGGAGGCCGG + Intergenic
985784425 5:1886584-1886606 GAGAGGAGGGAGAGGGCCGCGGG - Intronic
985813706 5:2110999-2111021 CATGGGTGGGAGAGAGGGGCTGG + Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986729698 5:10626107-10626129 CAGGGGCCGGAGTGGGAGGCAGG + Intronic
987445998 5:18020673-18020695 CATGGGAGGGGGTGGGGGGCAGG + Intergenic
990439457 5:55830107-55830129 CAGGCGAGTGAGAGGGCTGGAGG + Intergenic
990743700 5:58937232-58937254 CAGGGGAGGGGGAGGGGCGGGGG + Intergenic
991073994 5:62514584-62514606 AAGGAGAGGGAGAGGGAGACGGG + Intronic
991114263 5:62935864-62935886 CAGGGCAGCGAGAGGTCAGCAGG + Intergenic
991634328 5:68689235-68689257 TTGTGGAGGGAGAGGGCTGCAGG - Intergenic
992269802 5:75053112-75053134 CAGCGGGGGGAAAGGGCAGCGGG - Intergenic
992636519 5:78730278-78730300 TAGGGGAGGGAAAGGGGGGAAGG - Intronic
992881479 5:81114623-81114645 CAGGGGCTGGAGAGGGGGACAGG - Intronic
992897028 5:81254499-81254521 GTGGGGAAGGAGAGGGAGGCTGG - Intronic
993168421 5:84384822-84384844 GAGGGGAGCGAGCGGGCCGCCGG + Intergenic
993467785 5:88269152-88269174 GAGGGGAGAGGGAGGGGGGCGGG + Intronic
994133073 5:96253278-96253300 CACAGGAGGGAGAGGGTGTCTGG + Intergenic
994670763 5:102758824-102758846 CAGGGTAGGGGGAGGGGGGAAGG + Intronic
995256796 5:110056176-110056198 CAGAGAAGGGAGAGAGCAGCTGG + Intergenic
995856811 5:116601164-116601186 CAGAGGAGGGAGAGGAGGGAGGG - Intergenic
997284302 5:132667527-132667549 CAGGGGAGAGGGCAGGCGGCGGG - Intergenic
997304915 5:132830057-132830079 CACGGGAGGGAGAGAGGCGCAGG + Intronic
997472227 5:134123468-134123490 CAGAGGAGGGAGAGGCCAGTGGG + Intronic
997521625 5:134527201-134527223 GAAGGGAGGGAGAGGGAGGAAGG - Intronic
997528965 5:134570613-134570635 CGGGGGATGGAGAGGTGGGCAGG - Intronic
997609644 5:135206657-135206679 CAGTGGAGGAAGAGAGCAGCAGG - Intronic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
998208373 5:140175434-140175456 CTGGGGAGGGGCAGGGAGGCAGG + Intronic
998976004 5:147648731-147648753 CAGGGCAGGGAGAGTGCAGAGGG + Intronic
999310291 5:150547387-150547409 CAGGGGAGGGGGTTGGCGGCTGG + Intronic
999481726 5:151954527-151954549 GAGGGGAGGGAGAGTTCTGCTGG - Intergenic
999622913 5:153490571-153490593 CAAGGGAGGGAGAGAGAGGCAGG + Intronic
999831272 5:155322519-155322541 CTGGGGAGGGAGAGGGTCCCAGG + Intergenic
1000080917 5:157846027-157846049 CAGAGGAGAGGGAGAGCGGCAGG - Intronic
1001089391 5:168726349-168726371 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089398 5:168726367-168726389 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089442 5:168726483-168726505 GGAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089449 5:168726501-168726523 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001199243 5:169700851-169700873 GAGAGGGGAGAGAGGGCGGCGGG + Intronic
1001237626 5:170043446-170043468 CAGAGGAGAGGGAGGGCTGCAGG - Intronic
1001342916 5:170863272-170863294 CAGGGGAGGCAGTGGGTGGCAGG + Intronic
1001381789 5:171310494-171310516 TGGGGGAGGCAGAGGGGGGCGGG - Intronic
1002132415 5:177089703-177089725 CTGAGGTGGGAGAGGGTGGCAGG + Intronic
1002140007 5:177132788-177132810 AAGGGGAGGGAGAGGGATGGGGG + Intergenic
1002169336 5:177366681-177366703 GAGGGGAAGGAGGGGGAGGCAGG - Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002214951 5:177624544-177624566 CAGGGGAGGGAGAGGGATGTTGG + Intergenic
1002260785 5:177992748-177992770 CATGGGAGGGGGTGGGGGGCAGG + Exonic
1002587146 5:180256392-180256414 CAGGGGTGGGGCAGGGGGGCAGG + Intronic
1002718961 5:181246560-181246582 CCGGGCCGGGAGACGGCGGCAGG - Intronic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1002725319 5:181290745-181290767 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1002897804 6:1389540-1389562 CCGGGGAGGGCGAGGGAGGGAGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003059651 6:2853390-2853412 CAGGAGAGGGACAGGGAGGGGGG - Intergenic
1003120702 6:3317096-3317118 CAAGGGAGGGAGAAGGCTGTTGG - Intronic
1003139243 6:3457057-3457079 CAGGAGCTGGAGAGCGCGGCCGG - Intergenic
1003153135 6:3569916-3569938 CAGGGAGGGGAGAGGGAGGGAGG - Intergenic
1003154195 6:3577539-3577561 CAGGGGAGGGAGCTGGCTGTGGG - Intergenic
1003163026 6:3652090-3652112 CAGGGGAGGGAGAATGCTGCTGG - Intergenic
1004121069 6:12822575-12822597 CAGGGAAGGGAGAGGAGGCCTGG - Intronic
1004233321 6:13852025-13852047 GAGGAGAGGGAGAGGGAGGGAGG - Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005836967 6:29717718-29717740 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836973 6:29717737-29717759 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836979 6:29717756-29717778 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836985 6:29717775-29717797 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836991 6:29717794-29717816 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005836997 6:29717813-29717835 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837014 6:29717864-29717886 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837020 6:29717883-29717905 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837026 6:29717902-29717924 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1005837032 6:29717921-29717943 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1006197455 6:32254759-32254781 GAGGGCAGGGAGAGGGAGGGGGG + Intergenic
1006315764 6:33290592-33290614 CAGGGGAGGGAGAAGAAGGGGGG - Intronic
1006351444 6:33524196-33524218 CAGGGAGGGGAGAGGGCTGAAGG + Intergenic
1006497555 6:34434800-34434822 CGGGGGAGGGGGTGGGCGGGGGG - Intergenic
1006794031 6:36721064-36721086 CAAGGGATGGTGAGGGCTGCAGG + Intronic
1006841082 6:37028182-37028204 CAGGGTGGGGAGAGGTGGGCAGG - Exonic
1006860425 6:37168961-37168983 CAAGGGAGGCAGAGGGTGGGGGG + Intergenic
1006903575 6:37518273-37518295 CAGGAGAGGGAAGGGGCGGTGGG + Intergenic
1007177923 6:39909219-39909241 CAGGGGAGGGGGAGGGGAGAGGG + Intronic
1007177936 6:39909251-39909273 CAGGGGAGGGGGAGGGGGAGAGG + Intronic
1007177950 6:39909284-39909306 CAGGGGAGGGGGAGGGGGAGAGG + Intronic
1007392849 6:41560584-41560606 CGGGGGAGGGAGAGAGGGGCGGG - Intronic
1007517987 6:42428837-42428859 GAAGGGAGGGAGAGGGAGGCAGG - Intronic
1007752180 6:44077163-44077185 CAGGGAAGGGAGGAGGCGGTCGG + Intergenic
1008048841 6:46879472-46879494 CAGGAGAGGGAGAGAGGGTCTGG - Intronic
1008337602 6:50325457-50325479 CATGGGAGGGAGCTGGCGGGAGG + Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008926785 6:56895989-56896011 CATGAGAGGGAGAGGGAGACGGG + Intronic
1008926791 6:56896008-56896030 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926797 6:56896027-56896049 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926803 6:56896046-56896068 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926809 6:56896065-56896087 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926815 6:56896084-56896106 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926821 6:56896103-56896125 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008926827 6:56896122-56896144 CGGGAGAGGGAGAGGGAGACGGG + Intronic
1008956599 6:57222342-57222364 CAGGGGCGGGGCAGGGCCGCGGG - Intergenic
1009431551 6:63572257-63572279 CGGGGGAGGGAAGGGGCTGCCGG - Exonic
1009975570 6:70667774-70667796 GAGGGGAGGGGGAGGGGGACTGG - Exonic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010166182 6:72917828-72917850 AGTGGGAGGGAGTGGGCGGCAGG - Intronic
1010277068 6:73981107-73981129 CAGGGTAGGGAGAGGGAGCTGGG - Intergenic
1011041587 6:83035253-83035275 CAGGGTAAGGAGTGGGCAGCAGG - Intronic
1011293276 6:85799782-85799804 AAGGGGAGGGAGTGGGCTGGGGG - Intergenic
1011402331 6:86977180-86977202 CAGAGGAGGGAGAGGGGGAAGGG - Intronic
1011603344 6:89080368-89080390 GGGGGCAGGGGGAGGGCGGCAGG - Intergenic
1012111611 6:95242116-95242138 AGGGGGAGGGAGAGGGAGGGAGG + Intergenic
1013225763 6:108118532-108118554 CAGGGGGCGCAGGGGGCGGCCGG + Intronic
1013227971 6:108134194-108134216 CGGGGCAGGGAGAGGGGCGCGGG - Intronic
1013327064 6:109056924-109056946 CAGGGGAGGGAGAGGACAGATGG - Intronic
1013608592 6:111773555-111773577 CAGAGGAGGGAGAGGGAGAGGGG + Intronic
1013973818 6:116052751-116052773 CAGGTGAGGGAGAGTGCAGACGG + Intronic
1014041513 6:116832384-116832406 CAAGGGAGGTAGAGTGTGGCAGG + Intergenic
1014060444 6:117065339-117065361 GGGGGGAGGGAGGGGGTGGCGGG - Intergenic
1014187172 6:118448053-118448075 CATGGGAGGGACAGGGTGGGAGG - Intergenic
1014741590 6:125153839-125153861 CAGGAGTGGGAGCGAGCGGCGGG + Exonic
1014764408 6:125390099-125390121 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1014764414 6:125390118-125390140 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764420 6:125390137-125390159 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764426 6:125390156-125390178 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014764432 6:125390175-125390197 CGGGAGAGGGAGAGGGAGACGGG + Intergenic
1014913303 6:127118592-127118614 GGGGGGAGGGAGAGGAGGGCAGG - Exonic
1015190231 6:130464239-130464261 CCGGGGAGAGTGAGGGAGGCAGG - Intergenic
1015750046 6:136550282-136550304 CAGGGGACGGCGAGCGGGGCCGG - Intronic
1015858631 6:137652513-137652535 CAGGGGAGGAAGAGCCTGGCTGG + Intergenic
1016439499 6:144068485-144068507 CAAGGCAGGGAGATGGCTGCTGG - Intergenic
1016724630 6:147348338-147348360 GAGGTGAGGGAGAGGGAGGGAGG - Intronic
1017106784 6:150895310-150895332 CACGGAAGGGAGAGGTGGGCAGG + Intronic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017708857 6:157147913-157147935 AAGGCGAGGGTGAGGGCGGGCGG - Intronic
1017775025 6:157673765-157673787 CCGGGGCTGCAGAGGGCGGCTGG + Exonic
1017852202 6:158314490-158314512 CAGTGCAGGGAGAGGACAGCAGG - Intronic
1018217962 6:161549142-161549164 AGGGGGAGGGAGAGGGCCACGGG + Intronic
1018435127 6:163752433-163752455 CTGGTGAGGGAGAGAGAGGCCGG - Intergenic
1018757374 6:166862274-166862296 CAAGGGACGCAGAGGCCGGCGGG + Exonic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1018949530 6:168370363-168370385 CAAGCGCGGGAGAGGGAGGCCGG - Intergenic
1019196175 6:170284414-170284436 CAGGGGAGGGAGGGAGGGGAAGG + Intronic
1019429751 7:993202-993224 CAGGGCAGGGGGACGGCAGCTGG + Intergenic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019479785 7:1261224-1261246 CAGGGGACGGACAGGGAGGATGG + Intergenic
1019501194 7:1365516-1365538 CAGGGGTGGGACAGGGCCCCTGG - Intergenic
1019512722 7:1426076-1426098 GAGGGGAGGGAGAGGCAGCCTGG - Intergenic
1019525336 7:1478108-1478130 CCGGGGCTGGAGAGTGCGGCCGG + Intronic
1019561607 7:1662099-1662121 CAGGGGAGGGATAGAGCAGCTGG - Intergenic
1019595576 7:1856858-1856880 TGGGGGAGGGAGAGGGAGCCTGG + Intronic
1019612636 7:1944725-1944747 CAGGAGTGGGAGAGGGCCGACGG - Intronic
1019623487 7:2003725-2003747 CAGGGCAGTGTGAGGGCAGCAGG - Intronic
1019739724 7:2666537-2666559 CAGGGGAGGGAGGGTTCGGGCGG + Intergenic
1019795247 7:3043806-3043828 CAGGGCCGGGAGGGGGCTGCGGG + Exonic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020092952 7:5351497-5351519 CGGGGGAGGGGGAGGAGGGCAGG + Intronic
1020660419 7:10974400-10974422 CAGGGGTGGGAGAGTCCTGCGGG + Intronic
1020666317 7:11047932-11047954 AGGGGGAGGGAGAGGGAGGGAGG + Intronic
1021085884 7:16421004-16421026 CAGGGCGGGGAGCGGGAGGCCGG + Intronic
1021116624 7:16752312-16752334 CAGGGGAGGGAAGGAGAGGCTGG + Intergenic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021731186 7:23597263-23597285 CAGGGTAGGTGCAGGGCGGCTGG + Intergenic
1021936786 7:25639067-25639089 CTGGGGAGGGCGTGGGCAGCTGG + Intergenic
1022230799 7:28410260-28410282 CAGCGGAGGCAGGAGGCGGCCGG - Intronic
1022443691 7:30453039-30453061 CACTGGAGGGAGGGGGTGGCAGG + Exonic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1022974746 7:35546842-35546864 CAGGGCAGGGAGAGTGCAGAGGG - Intergenic
1023036526 7:36135948-36135970 CAGGAGAGGCAGTGGGTGGCAGG + Intergenic
1023058584 7:36309242-36309264 CAGGGGAGGAAGGGGCCTGCAGG - Intergenic
1023129062 7:36984459-36984481 CAAGGCAGGGTGAGGGCGACTGG - Intronic
1023198074 7:37663852-37663874 TAAGTGAGAGAGAGGGCGGCGGG - Intergenic
1023867931 7:44247599-44247621 CAGGGAAGGGTCAAGGCGGCTGG + Intronic
1023888534 7:44377006-44377028 CACGGGAGGGACAGGGAGGGAGG - Intergenic
1024070225 7:45778358-45778380 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1024264239 7:47594641-47594663 CTGGGGAGGCAGAGAGCTGCAGG - Intergenic
1025099208 7:56121586-56121608 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1026285022 7:68955279-68955301 GAGGGGAGGGGGAGGGCGGGAGG + Intergenic
1026308841 7:69166277-69166299 AAGGGGAGGGGGAGGGGGGAAGG + Intergenic
1026477160 7:70746708-70746730 AAGGAGAGGGAGAGGGGGGCAGG + Intronic
1026690172 7:72544222-72544244 GAGGGGAGGGAGAGGAGGGGAGG + Intergenic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1026938027 7:74270249-74270271 GAGGGGAGGGAGAGGAGGGGAGG - Intergenic
1026938033 7:74270263-74270285 GAGGGGAGGGAGAGGAGGGGAGG - Intergenic
1026938039 7:74270277-74270299 GAGGGGAGGGAGAGGAGGGGAGG - Intergenic
1026972628 7:74477498-74477520 CAGGGGAGGGAGGGGGCATGGGG + Intronic
1027138231 7:75639268-75639290 AGGGGGAGGGGGAGGGGGGCGGG + Intronic
1028189955 7:87835707-87835729 GCGGGGAAGGAGAGGGAGGCGGG + Exonic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029170248 7:98625236-98625258 CCGAGGAGGGCGAGGACGGCTGG - Intronic
1029440065 7:100582532-100582554 GAGGTGAGGGAGTGGGCAGCCGG - Intronic
1029545289 7:101207317-101207339 GAGGGGAGGGGAGGGGCGGCGGG + Intronic
1029597375 7:101545093-101545115 CTTGGGAGGGTGAGGGGGGCAGG - Intronic
1029675958 7:102069094-102069116 GAGGAGGAGGAGAGGGCGGCTGG - Intronic
1029746476 7:102517928-102517950 CAGGGCGGGGAGGGGCCGGCCGG + Intergenic
1029764413 7:102616907-102616929 CAGGGCGGGGAGGGGCCGGCCGG + Intronic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030850569 7:114480256-114480278 CAGAGGAGGAAGAGGGGGACAGG - Intronic
1031369822 7:120951002-120951024 GGCGGGAGGGAGGGGGCGGCGGG + Intronic
1031989488 7:128188445-128188467 CAGGGGAGAGAGACGGCAGCAGG + Intergenic
1032047627 7:128622650-128622672 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1032794993 7:135269868-135269890 GAGGGGATGGAGAGGCCAGCAGG + Intergenic
1033343890 7:140512539-140512561 CAGGGGTGGGGGATGGTGGCAGG + Intergenic
1033349714 7:140552356-140552378 AAGGAGAGGGAGAGGGAGGGAGG - Intronic
1033354374 7:140587583-140587605 AAGGGGAGGGAGAATGGGGCTGG - Intronic
1033802776 7:144920350-144920372 GAGGGGAGGGGGAGGGGGGAGGG + Intergenic
1034070440 7:148179582-148179604 CGGGGGAGAGAGAGGGAGGGAGG + Intronic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034154163 7:148940943-148940965 CCGGAGAGGGACAGGCCGGCCGG + Intergenic
1034263798 7:149772243-149772265 GGGGGGAGGGGGAGGGCGGTGGG - Intronic
1034271323 7:149804611-149804633 GAGGGGAGGGGGAGAGAGGCAGG + Intergenic
1034306254 7:150047574-150047596 CGGGGGCGGGGGACGGCGGCGGG - Intergenic
1034343326 7:150371484-150371506 CAGGGCAGGGCAAGGGCAGCCGG - Exonic
1034413920 7:150955295-150955317 CAGGCTGGGGAGAGGGCTGCTGG - Intronic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034475561 7:151279628-151279650 CAGGGAAGGGAGAGGTGGGGTGG + Intergenic
1034880355 7:154757983-154758005 GCGTGGCGGGAGAGGGCGGCGGG - Intronic
1034964118 7:155381361-155381383 CAGGGGAGGGAGGGGTGTGCAGG - Intergenic
1035004446 7:155644762-155644784 CAGAGAAGGGAGGGGGCTGCAGG - Exonic
1035108254 7:156459807-156459829 CAGGGGCAGAACAGGGCGGCGGG - Intergenic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035366987 7:158355434-158355456 CAGGAGAGTGAGAGAGAGGCAGG - Intronic
1035389676 7:158496572-158496594 CAGGGAAGGGGGAGGCCTGCAGG - Intronic
1035389726 7:158496694-158496716 CAGGGAAGGGGGAGGGGTGCAGG - Intronic
1035389810 7:158496888-158496910 CAGGGAAGGGGGAGGCCTGCAGG - Intronic
1035389946 7:158497219-158497241 CAGGGAAGGGGGAGGGGCGCAGG - Intronic
1035620386 8:1032263-1032285 CTGTGGAGGCAGTGGGCGGCCGG + Intergenic
1035654191 8:1293236-1293258 CAGGAGAGGGAGAGGGCATGTGG - Intergenic
1035724064 8:1813805-1813827 CAGGGGTCGGGGAGGGGGGCAGG - Intergenic
1036163066 8:6406823-6406845 CGGGGGAGGAAGGAGGCGGCAGG - Intronic
1036217104 8:6889883-6889905 GAGGGGAGGGGGAGGGGGGATGG - Intergenic
1036445998 8:8822397-8822419 CAGGGGATGGAGCGGGAGACAGG + Intronic
1036656739 8:10681813-10681835 CAGTGGAGGCACAGGGCAGCCGG + Intronic
1036659383 8:10698103-10698125 CAGGGGAGGGGGAGAGATGCAGG + Intronic
1036788146 8:11701574-11701596 CAAGGGAGGGAGGGGGCGAGCGG + Intronic
1037134758 8:15446729-15446751 CAGGAGAGGGGGAGGGAGGGGGG + Intronic
1037681549 8:21101861-21101883 CAGGGGAGGGAGTGGGAGGCAGG - Intergenic
1037709960 8:21347637-21347659 CAGGGGAGGGACATGGGGGAGGG + Intergenic
1037882176 8:22578782-22578804 GCGGGGCGGGAGAGCGCGGCCGG + Exonic
1037905445 8:22713597-22713619 CAGGGGCCTGAGAGGGAGGCCGG + Intronic
1038035251 8:23681945-23681967 GAGAGGCGGGAGAGGGAGGCAGG + Intronic
1038151074 8:24942570-24942592 CGGGGGAGGGAGGAGGCGCCGGG - Intergenic
1038425357 8:27461002-27461024 AAGGGGAGGAAGCGGGAGGCAGG - Exonic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1038613041 8:29071508-29071530 CAGGAGAGGGAGGGGCCGGGAGG - Intronic
1038687902 8:29735301-29735323 TTGGGGAGGGAGAGGGAGGGAGG - Intergenic
1038828363 8:31032491-31032513 CTGGATAGGGAGAGGCCGGCAGG - Exonic
1038828614 8:31033331-31033353 GAGGGGAGGGAAGGGGAGGCGGG + Exonic
1039561028 8:38512642-38512664 GAGGGGATGGAGAGGGAGGCAGG + Intronic
1039608414 8:38901164-38901186 CCGGGGAGGGAGAGGGGTGCCGG - Intergenic
1039912475 8:41835946-41835968 CAGGGAGGGGAGAGGGCAGGGGG + Intronic
1039950189 8:42164948-42164970 AAGGGGAGGGAGAGAGAGGAAGG + Intronic
1040875784 8:52150572-52150594 GCGGGCAGGGAGAGGGAGGCAGG + Intronic
1041059416 8:54021973-54021995 GAGGGGAGGGAGAAGGAGGGAGG + Intronic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1041357859 8:57021180-57021202 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1041357865 8:57021199-57021221 CGGGAGAGGGAGAGGGAGACGGG - Intergenic
1042339524 8:67664510-67664532 CAGGTGTGGGAGAAGGCAGCAGG - Intronic
1043296384 8:78668158-78668180 TAGGGGAGGGAGAGGGGAGAAGG - Intronic
1044767982 8:95597191-95597213 AAGGGGAGGGAGAGGAGGGGAGG - Intergenic
1045061997 8:98418819-98418841 GATGGGAGGGAGAGGGCAGGGGG - Intronic
1045501183 8:102745554-102745576 CTGGGGAGTGAGGGGGCGGAGGG - Intergenic
1045535934 8:103027880-103027902 TGGGGGTGGGAGAGGGTGGCAGG - Intronic
1045650311 8:104336194-104336216 CAAGGAAGGGAGAGGGCTGCAGG + Intronic
1047054358 8:121147583-121147605 CTGGGGAGGGAGGGGGAGACAGG - Intergenic
1047254806 8:123207061-123207083 GAGGGGAGGAAGAGGGAGGGAGG - Intronic
1047300766 8:123612089-123612111 GAGGGGAGGGGGAGGGGGGAAGG - Intergenic
1047634755 8:126748861-126748883 CAGGTGAGGGAGGGGACGACTGG + Intergenic
1048045647 8:130770304-130770326 CTGGGGAGGGAGAAGGCAGGAGG + Intergenic
1048484062 8:134831709-134831731 CAGGGTATGGGGCGGGCGGCGGG - Intergenic
1048484142 8:134831950-134831972 TTGGGGCGGGAGAGGGCGTCCGG - Intergenic
1048881673 8:138877091-138877113 GAGGGGAGGCAGAGGGCTGATGG - Intronic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049154715 8:141059574-141059596 AGGGGGAGGGAGGGGGCTGCAGG + Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049358862 8:142202355-142202377 CAGAGGGCGGAGACGGCGGCTGG - Intergenic
1049416762 8:142498948-142498970 CAAGAGAGGGAGAGAGAGGCTGG - Intronic
1049467946 8:142761687-142761709 CAGGGGAGGGGAGGGGCTGCAGG + Intergenic
1049501892 8:142971501-142971523 AAGGGGAGGGAGAGGAAGGGAGG - Intergenic
1049511313 8:143028173-143028195 GAGGGGAGGGAGAGGAAGGGAGG + Intergenic
1049532462 8:143161116-143161138 CAGGGCAGGGCTAGGGCAGCAGG - Intergenic
1049551809 8:143263509-143263531 CAGGGGAGGGAGAGCTGGGAGGG - Intronic
1049606557 8:143532318-143532340 CGGGGGAGGGAGGCGGCAGCAGG + Intronic
1049624634 8:143614549-143614571 CAGGGGCGGGTGGGGCCGGCTGG - Intronic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049737768 8:144218828-144218850 CAGGGGAGGGGAAGGGAGGAGGG - Intronic
1049748845 8:144274195-144274217 CAGGGCAGGGAGGGCGCCGCTGG - Intronic
1049847199 8:144808553-144808575 CTGGGGAGGGAAAGGGCACCAGG + Exonic
1050120336 9:2301204-2301226 CAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1050236562 9:3587271-3587293 CAGGGGAGGGAGCTGGTGGAAGG + Intergenic
1050273804 9:3975237-3975259 CAGGAGAGGGAGTGGGCAGTTGG + Intronic
1050309627 9:4339810-4339832 GAGGGGAGGGGGAGGGGGGAGGG + Intronic
1050552254 9:6758393-6758415 CAGGGGAGGGATGCGGGGGCCGG + Intronic
1051174255 9:14347367-14347389 TAGGGGAGGGAGAGGACGGGAGG + Intronic
1051235267 9:14992885-14992907 TAGGGGAGGGAGAGGGATGGAGG + Intergenic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1051725487 9:20084487-20084509 GAGGGGTGGGAGAGGGAGGGAGG - Intergenic
1051728430 9:20112818-20112840 CAGGGGAGGTGGGGGGTGGCTGG - Intergenic
1052142414 9:25003854-25003876 CAGCTGAGGCAGAGGGTGGCGGG + Intergenic
1052982276 9:34458184-34458206 CTGGTGAGGGGGCGGGCGGCGGG - Exonic
1052992185 9:34525231-34525253 CAGGGGAGGGAAATGGAGGCAGG - Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053266226 9:36715721-36715743 ATTGGGAGGGAGAGGGCGACTGG - Intergenic
1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG + Intronic
1053736522 9:41106556-41106578 CAGGGGAGGAAGAGGGGGAGAGG - Intergenic
1054691849 9:68324844-68324866 CAGGGGAGGAAGAGGGGGAGAGG + Intergenic
1054775664 9:69121733-69121755 CCGGGGAGGGAGAGAGAGGAGGG - Intronic
1055155826 9:73061742-73061764 CAGGGTAGGGAGTGGGTGGGGGG - Intronic
1055433173 9:76265261-76265283 AAAGGGAGGGAGGGGGAGGCGGG + Intronic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056198503 9:84251784-84251806 CAGGGAAGGGGGAGGGCAGGAGG - Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1056658749 9:88529555-88529577 CTGGGGAGGGAGTGGGCTGCAGG - Intergenic
1057274703 9:93670178-93670200 GAGCAGAGGGAGAGGACGGCAGG + Intronic
1057423075 9:94927662-94927684 CAGGGGAGGGAGAGATGGGCAGG - Intronic
1057448355 9:95134845-95134867 CAGGGGAGGGTGAAGGCAGGTGG + Intronic
1057481639 9:95449278-95449300 CAGGGGAGGGTGTGGGCAGGCGG + Exonic
1057725404 9:97564736-97564758 CAGGGGAGGGACAGGTGGACAGG + Intronic
1057744599 9:97741296-97741318 CAGGGGCGGAGGAGGGCGGGGGG - Intergenic
1057964271 9:99488161-99488183 CTGGGGATGGAAAGGGAGGCGGG - Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058021866 9:100098633-100098655 CAGGCGAGAGTGAGGGCAGCGGG + Intronic
1058201500 9:102047651-102047673 CAGGGGAGGGACAAGGTGGGAGG + Intergenic
1058622441 9:106897934-106897956 AGGGGGAGGGAGAGGGCTGGTGG - Intronic
1058674311 9:107387686-107387708 CAGGGGTGGGTGATGGCTGCTGG + Intergenic
1058873353 9:109221229-109221251 GAGGGGAGGGAGGGGGAGGAAGG + Intronic
1059309265 9:113377112-113377134 GAGGGGACGGCGAGGGCGACGGG - Intergenic
1059312291 9:113396831-113396853 CAGGGCAGGAAGAGGGCAGTGGG + Intronic
1059448692 9:114356494-114356516 AAGGGAAGGGAGAAGGCGGAGGG - Intronic
1060251154 9:121987762-121987784 CAGGGGAGGGGGAGGGAGCCAGG - Intronic
1060554348 9:124500551-124500573 CCGGTGCGGGAGGGGGCGGCGGG + Exonic
1060572897 9:124659274-124659296 CAGGGGCGGGAGCGGGGGGGCGG + Intronic
1060819027 9:126651108-126651130 ATGGGGAGGGAGAGAGGGGCAGG - Intronic
1061225570 9:129279128-129279150 CAGGGGAGGGACCGGGGGGGGGG - Intergenic
1061261223 9:129482162-129482184 CTGGGAGGGGAGAGGGGGGCGGG - Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061391744 9:130320686-130320708 CTGGGGAGGGAGAGGGGAGCAGG + Intronic
1061450256 9:130663789-130663811 CCGGGGAGGGAGAGCGGTGCAGG + Intergenic
1061615179 9:131774623-131774645 CAGGGGAGGGAGTGGGGCCCTGG - Intergenic
1061854912 9:133436791-133436813 CAGAGGAGGGGGATGGCGGTGGG - Intronic
1061875357 9:133540847-133540869 AGGGAGAGGGAGAGGGCTGCTGG - Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1061995360 9:134180381-134180403 CAGGGGAGGGGGAGCCGGGCTGG - Intergenic
1061996671 9:134189710-134189732 CAGGCGAGGGAGTGGGCGTCCGG + Intergenic
1062070767 9:134553960-134553982 AAGGGGAGGAAGAGGAAGGCTGG + Intergenic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062167384 9:135114684-135114706 CTGGGGAGGGAGGGAGGGGCTGG + Intronic
1062194172 9:135263979-135264001 AAGGGGAGGGGGAGGGAGGGTGG - Intergenic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1062321061 9:135990770-135990792 GAGGGGAGGGAAAGGGCAGGAGG - Intergenic
1062321081 9:135990817-135990839 GAGGGGAGGGAAAGGGCGGGAGG - Intergenic
1062321096 9:135990848-135990870 GAGGGGAGGGAAAGGGCGGGAGG - Intergenic
1062359334 9:136180098-136180120 GAGGGGAGAGAGCGGGCTGCGGG - Intergenic
1062435653 9:136545627-136545649 CACGGCTGGGAGCGGGCGGCGGG - Intronic
1062448365 9:136605096-136605118 CTGGGGCAGGGGAGGGCGGCAGG + Intergenic
1062544592 9:137055762-137055784 ATGGGGAGGGAGAGGGGAGCTGG + Intergenic
1062548916 9:137077212-137077234 CAGGGGACGGAGAGGGACGGGGG + Intergenic
1062562488 9:137147832-137147854 CACGGCAGGGTGGGGGCGGCAGG + Intronic
1062573871 9:137197685-137197707 CAGGGGAGGGAGAGGCAGACAGG + Intronic
1062686629 9:137817013-137817035 CAGGGCTGGGGGAGGGTGGCAGG - Intronic
1062717776 9:138019636-138019658 CTGGGCAGGGCGGGGGCGGCAGG - Intronic
1062750462 9:138248387-138248409 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1185459869 X:328948-328970 GAGGGGAGGGGGAGGGGGGAGGG - Intergenic
1185627578 X:1493356-1493378 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186287941 X:8065631-8065653 CAGGGGAGGGGAATGGAGGCAGG + Intergenic
1186476236 X:9859814-9859836 CAGGTGAGGGGGAGGGAGGGAGG - Intronic
1187416413 X:19097084-19097106 GAGGGGAGGCAGAGAGGGGCTGG - Intronic
1187526057 X:20056335-20056357 CAGGGGAGGGAAACGGCAGGAGG - Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1189262633 X:39689186-39689208 TAGGGGAGGGAGAGGGGAGGAGG - Intergenic
1189335760 X:40169899-40169921 CAGGGAAGGGAGAGTAAGGCCGG + Intronic
1189650938 X:43188726-43188748 GAGGGGAGGGAAAGGGATGCAGG - Intergenic
1190054775 X:47175207-47175229 AAGGGGAGAGAGGGGGCGGGGGG - Intronic
1190057415 X:47189793-47189815 AAGGAGAGGGAGAGGGAGGGTGG - Intergenic
1190233131 X:48597652-48597674 AAGGGAAGGCGGAGGGCGGCGGG + Intronic
1190367413 X:49709360-49709382 GAGGGGAGGGGGAGGGGGACAGG + Intergenic
1190526283 X:51332554-51332576 CAGGGGAGGGCGTGGGCTGAGGG - Intronic
1190759951 X:53430825-53430847 CAAGGGAGGGAGAGGAGGGATGG + Intronic
1190817457 X:53940614-53940636 CAGGTAAGGGAGAGGGTGGCAGG - Intronic
1190957260 X:55207922-55207944 CAGGGCAGGGGGCGGGGGGCGGG + Intronic
1191851592 X:65589583-65589605 CTGGGAAGGGAGAGGAAGGCAGG + Intronic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192106771 X:68325616-68325638 CGGGAGAGGGAGAGGGAGACGGG - Intronic
1192433077 X:71125740-71125762 GAGGGAAGGGAGAGGGAGGGAGG - Intronic
1192561706 X:72131761-72131783 CCGGGGCCGGAGAGGGCGGGCGG + Exonic
1195086497 X:101418516-101418538 AGGAGGAGGGGGAGGGCGGCAGG + Intronic
1195266520 X:103186123-103186145 GAGGGGAGGGAGTCGGAGGCTGG - Intergenic
1195370411 X:104167066-104167088 CAGGTGGGGGAGGGGGCGACTGG - Intronic
1195704917 X:107731873-107731895 GGGGGGAGGGAGAGGGCTGTAGG + Intronic
1196036924 X:111155596-111155618 CTGGGGAGGGAAAGGGAAGCAGG + Intronic
1196237499 X:113299892-113299914 GAGGGGAGGGGGAGGGGGACGGG - Intergenic
1196793280 X:119482979-119483001 CAGGGGAGGAAGAGCTTGGCTGG - Intergenic
1198047129 X:132913963-132913985 CAGGAGAGGGGGAGAGGGGCTGG - Intronic
1198100440 X:133417353-133417375 CTGGGGAGGGCGGGGGCGGCGGG - Intergenic
1198376464 X:136045096-136045118 TAGGGGAGGGAGAGTGAGGAGGG + Exonic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1198438358 X:136638542-136638564 CAGGGGAGAGAGAGGGCTCCAGG + Intergenic
1199306319 X:146270665-146270687 CAAGGGAGGGATGGGGTGGCAGG + Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199451350 X:147981725-147981747 AGGGGGAGGGAGAGGGGGGCGGG + Intronic
1199679362 X:150214782-150214804 CTGGGGAGGCAGAGGTCTGCTGG - Intergenic
1199695865 X:150342267-150342289 CTGGGGAGGCAGAGGTCTGCTGG + Intergenic
1200100528 X:153687617-153687639 CAGGGCTGGGAGGGGCCGGCCGG + Intronic
1200100609 X:153687830-153687852 AGGGGGAGGGGGAGGGGGGCCGG + Intronic
1200135816 X:153874056-153874078 CTGGGGAGGGAGATGGTGACAGG + Intronic
1200216298 X:154369533-154369555 TAGGGGAGGGAGGGGTTGGCTGG - Intronic