ID: 1176121239

View in Genome Browser
Species Human (GRCh38)
Location 20:63455512-63455534
Sequence ATGCAGTCACAGACTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176121227_1176121239 21 Left 1176121227 20:63455468-63455490 CCCCAGATCACAAGAGAGGCCAT 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG 0: 1
1: 0
2: 2
3: 30
4: 206
1176121228_1176121239 20 Left 1176121228 20:63455469-63455491 CCCAGATCACAAGAGAGGCCATG 0: 1
1: 0
2: 0
3: 6
4: 151
Right 1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG 0: 1
1: 0
2: 2
3: 30
4: 206
1176121235_1176121239 2 Left 1176121235 20:63455487-63455509 CCATGGCGGGGATCAGGCACCCC 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG 0: 1
1: 0
2: 2
3: 30
4: 206
1176121229_1176121239 19 Left 1176121229 20:63455470-63455492 CCAGATCACAAGAGAGGCCATGG 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG 0: 1
1: 0
2: 2
3: 30
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176121239 Original CRISPR ATGCAGTCACAGACTGAGCA TGG Intronic
901454909 1:9357708-9357730 CTGCATTCACAGTCTGAGAAAGG - Intronic
902992756 1:20200792-20200814 ATGGAATCACAGACTGAGGATGG + Intergenic
903952840 1:27006080-27006102 CTGCAGGCACTGGCTGAGCAGGG - Exonic
905076242 1:35273002-35273024 ATGCAGTCACCGGCTGGGCGTGG - Intronic
905952196 1:41961243-41961265 ATGCAGTTACAGTCTGATGATGG - Intronic
906055816 1:42916048-42916070 AAGCAGACACAGACATAGCAGGG + Intergenic
906153885 1:43602967-43602989 ATGCATGCACAGACAGAGCAAGG - Intronic
906518800 1:46455491-46455513 ATGGAGTAACAGACTGGGCTTGG + Intergenic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
907488960 1:54796595-54796617 ATGCAGTCACATACACACCAGGG - Intronic
907787974 1:57632572-57632594 AGGCAGACACAGACAGAGGAAGG + Intronic
909285039 1:73805528-73805550 ATGAAATTACAGAATGAGCATGG + Intergenic
910342478 1:86203435-86203457 CTGCAGTCACAGGACGAGCAGGG - Intergenic
911137572 1:94457648-94457670 ATGCATTTGCAGACTGAGCAAGG + Intronic
913253528 1:116933021-116933043 ATGCACTGACTGACTGAGCCAGG - Intronic
914422522 1:147542062-147542084 GTGCATTCTCAGGCTGAGCAAGG + Intronic
914907231 1:151756603-151756625 GTGCAGTCATAGTCTGAGAAGGG + Intergenic
916463808 1:165052582-165052604 ACTCAGTCACAGACTGAGACTGG + Intergenic
918043318 1:180926361-180926383 ATGCAGTACCACACTGAGCATGG - Intronic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
922740376 1:228011001-228011023 GTGCAGACACTGGCTGAGCAGGG - Intronic
1068027967 10:51671958-51671980 ATACAGTCACATTCTGAGGAAGG + Intronic
1068697555 10:59983884-59983906 AGGCAGTAACAGACTAAGCTGGG - Intergenic
1068849154 10:61716375-61716397 AAGCAGTCACAGAGTCAGCTAGG + Intronic
1071269767 10:83996173-83996195 ATTAGGTCACAGACTGAGTAGGG + Intergenic
1071917172 10:90307214-90307236 ATTCAGTCAAAGACAGAGAATGG + Intergenic
1072696634 10:97608904-97608926 CTGCAGTCCCAGGCTGAGCTAGG + Intronic
1072787481 10:98294087-98294109 AGGCAGTCACCGTCTAAGCAAGG - Intergenic
1076294352 10:129373102-129373124 ATGAAGAGACAGACTGAGCTTGG - Intergenic
1076329556 10:129654487-129654509 ATGCAGGCTCAGAGTGAGCAGGG - Intronic
1078529016 11:12122083-12122105 ATGCTGTCACAGACAGACCATGG + Intronic
1078720286 11:13877832-13877854 ATGGAGTCAGAGTGTGAGCAGGG + Intergenic
1080110810 11:28565606-28565628 ATTCAGTCAAAGAATGACCATGG - Intergenic
1081780477 11:45707547-45707569 ATACAGGCAAAGACTGAGCCAGG - Intergenic
1082222651 11:49659028-49659050 ATGCAGTCAGAGAAGTAGCAGGG - Intergenic
1082731024 11:56797879-56797901 GTGCAGTCACAGGTTGAGGAGGG - Intergenic
1083488963 11:63000877-63000899 ATGAGGCCACAGGCTGAGCATGG - Intronic
1084279034 11:68074354-68074376 CTACAGTCAGAGACTGAGCAGGG + Intronic
1086654767 11:89340556-89340578 ATTCTATCACAGACTGAGTAGGG + Intronic
1087353219 11:97060111-97060133 TTGCAGTCACAAACTGAGCAAGG + Intergenic
1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG + Intergenic
1088686152 11:112286019-112286041 AGGCAATCACAGACTTTGCAGGG + Intergenic
1091121366 11:133060602-133060624 ATGCAGCCACAGTAGGAGCAGGG - Intronic
1091675543 12:2486376-2486398 ATTCAGACACACACTGGGCATGG + Intronic
1093225319 12:16476149-16476171 ATGCAGCCAAAGACTAAGAAAGG + Intronic
1095713375 12:45314819-45314841 ATGCAGTCAAATACTAATCAAGG - Intronic
1098014287 12:66088152-66088174 AGACAGTCCCAGACAGAGCAAGG - Intergenic
1099603150 12:84767319-84767341 ATTCAGTCACAGACTGAGGGTGG + Intergenic
1106214339 13:27681320-27681342 ATGCAGTCTCAGTGTGAGAAAGG + Intergenic
1107748132 13:43534523-43534545 ATGCTATCACAGACTGAAGACGG + Intronic
1110271661 13:73598009-73598031 ATACAGTCACATACTGAAGAAGG + Intergenic
1110568275 13:76977920-76977942 ATGCAGATACAGGCTGGGCATGG + Intergenic
1111871049 13:93832687-93832709 AGGCAGTCAGAGAGTGACCAAGG - Intronic
1111996975 13:95175111-95175133 ATGAAGTCATCCACTGAGCATGG - Intronic
1112035869 13:95496109-95496131 ATGCAGACACAGCCTGAGAAAGG - Intronic
1112940308 13:104854090-104854112 ATGCAGTCACTGCCTGGGAATGG - Intergenic
1113935556 13:113993170-113993192 AAGCAGACATAGAATGAGCAGGG - Intronic
1114587777 14:23830241-23830263 AAGCACTCACAGCCTGAGCTGGG + Intergenic
1118577407 14:67257169-67257191 ATTCAGTGAAAGACTGATCAAGG - Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1120252314 14:82073190-82073212 ATAAAGTCACAGACTCTGCAGGG - Intergenic
1120420332 14:84277190-84277212 AAGAAGTCACAGACTGGGCTGGG - Intergenic
1121654657 14:95586501-95586523 ATGTGGTCACAGGCTGAGGAAGG + Intergenic
1123116614 14:105897695-105897717 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123118669 14:105906944-105906966 ATGCGGGCAGAGCCTGAGCAGGG - Intergenic
1123120894 14:105916562-105916584 ATGCGGGCAGAGCCTGAGCAGGG - Intergenic
1123403614 15:20008143-20008165 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123512950 15:21014788-21014810 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1128792257 15:70442017-70442039 ATGGAATCCCAGACTGGGCAGGG + Intergenic
1132206875 15:99992615-99992637 ATGCAGGGACAGACAGGGCAGGG - Intronic
1132498430 16:274553-274575 ATGTAGTCACAGTCTGTGCCTGG + Intronic
1134886300 16:17795739-17795761 AAGCAGACACAGGCTGGGCACGG + Intergenic
1135194191 16:20381060-20381082 ATGCAGCCACAGTCTGTGCCTGG - Intronic
1136051052 16:27650278-27650300 ATGCAGGCACAGTGTGAACAAGG + Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1138552729 16:57756317-57756339 ATGAAGTCACAGATGGACCAAGG - Intronic
1139456191 16:67079580-67079602 ACACAGTCACACAATGAGCATGG - Intronic
1140554738 16:75908956-75908978 TTTCAGTCAATGACTGAGCATGG + Intergenic
1141094650 16:81154366-81154388 ATGCAGGAACCCACTGAGCAAGG - Intergenic
1141274053 16:82568972-82568994 ATGCAGTCACAGCTTGTGGATGG - Intergenic
1141897766 16:86969627-86969649 CTGAAGTCACAGGCTGAGCCAGG - Intergenic
1142281563 16:89150835-89150857 CTGCAGTCTCAGCCTGAGCCGGG - Intronic
1144132407 17:12259664-12259686 AGGAAGTCACAGACTGGGAAGGG + Intergenic
1144170726 17:12657509-12657531 ATGCAATAACAGGCTGGGCACGG + Intergenic
1145029770 17:19495600-19495622 ATGCAGTCAGAGGCTGGGCCTGG - Intronic
1145115073 17:20202073-20202095 ATGCACACACAGACTGTACATGG + Intronic
1146976847 17:37120645-37120667 ATGCAGTCTCTGGCTTAGCATGG + Intronic
1148238417 17:45984100-45984122 GTGCGGCCACAGCCTGAGCACGG - Intronic
1148668868 17:49395231-49395253 CTTCAGTCTCAGACTGAGCCAGG - Intronic
1148726292 17:49793101-49793123 ATGCATTTACAGGCTGAACATGG - Intronic
1149414239 17:56442329-56442351 ATGCAGACACAAAAAGAGCAAGG + Intronic
1151232348 17:72694028-72694050 GTCCAGCCCCAGACTGAGCAAGG - Intronic
1151385916 17:73755258-73755280 CTGCAGCCAGAGACTTAGCAAGG + Intergenic
1151517629 17:74606538-74606560 ATAAAGTCACAGCCTGAGCCGGG + Intergenic
1152499225 17:80697100-80697122 CTACAGTCAGAGAGTGAGCAAGG + Intronic
1155221335 18:23689054-23689076 CTGCAGCCACAGGCTGAGCCAGG - Intergenic
1155509707 18:26564187-26564209 ATGCTAACTCAGACTGAGCATGG + Intronic
1155575365 18:27239890-27239912 ATGCAGGTTCAGACTGAACACGG + Intergenic
1155902881 18:31412654-31412676 ATGCTATCACAGAATGTGCATGG + Intronic
1157694289 18:49708564-49708586 AAGCATTCACAGACTGATGAAGG - Intergenic
1162353938 19:10169118-10169140 ATGCAGCCTCAGGCTGGGCATGG - Intronic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1165068505 19:33242048-33242070 ATACAGACCCAGACTGAGGACGG + Intergenic
1165357354 19:35312243-35312265 ATGCAGTCACAGACACAGGCAGG - Intronic
1166798639 19:45443069-45443091 ATGCAGTCACACACAGACCAGGG + Intronic
1167295682 19:48647774-48647796 ACACACACACAGACTGAGCATGG + Intergenic
929187143 2:39107317-39107339 TCCCAGTCACTGACTGAGCATGG + Intronic
929801831 2:45111197-45111219 ATTCAGAGACAGATTGAGCACGG - Intergenic
933307762 2:80623247-80623269 ATGCATTCATAGAATTAGCATGG + Intronic
935285447 2:101560303-101560325 AAGCAGACACAGCCTGACCATGG + Intergenic
936450072 2:112627257-112627279 ATGCAGCCACAGGCTGAGTTGGG + Intergenic
936822017 2:116533434-116533456 ATGCAGTCACATTCTGAGTATGG + Intergenic
937855673 2:126670678-126670700 ATGAAGTCCCAGACCTAGCACGG + Intronic
937920109 2:127122768-127122790 ATCCAGTCAGAGAAGGAGCAAGG - Intergenic
941694637 2:168537973-168537995 ATCCACTGACAGACTGAACATGG - Intronic
942395567 2:175544523-175544545 AAGCAGTCAGAAACTCAGCAAGG - Intergenic
942657183 2:178226141-178226163 ATGCAGTGACAGCCTGGGTAGGG + Intronic
943337778 2:186639658-186639680 ATGCAATAACAGATTGAGCATGG - Intronic
1170392833 20:15894009-15894031 TTGCAGCCAGTGACTGAGCATGG - Intronic
1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG + Intergenic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1170573276 20:17644579-17644601 CTGTAGTTACAGACTGGGCAGGG + Intronic
1170947765 20:20907091-20907113 AGGCTGTCAAAGACTGGGCAAGG + Intergenic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1172484099 20:35288145-35288167 ATGAGGTCACACACTAAGCAGGG - Intronic
1173268059 20:41504982-41505004 ATCCAGTCAGAGACTGAGTTGGG + Intronic
1175223885 20:57433667-57433689 ATGCAGCGACAGACTGAACAGGG + Intergenic
1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG + Intronic
1177686283 21:24440997-24441019 ATACAGTCAGAGACTGAGGCAGG - Intergenic
1178121371 21:29473574-29473596 ATGAGGTCACAGATTAAGCAGGG - Intronic
1178145836 21:29738678-29738700 ATGAATTCACAGACTGTACAAGG + Intronic
1179782020 21:43707471-43707493 ATGCAGTCACAGGCTGGGCGCGG + Intergenic
1179975783 21:44865181-44865203 CTGCAGTTACTGTCTGAGCATGG - Intronic
1181013976 22:20057757-20057779 GGGCAGTCACAGGCTCAGCATGG - Intronic
1181107567 22:20584101-20584123 AGGCATTCACAGCCTGATCAGGG + Intronic
1181492837 22:23271380-23271402 ATGAAGTCACAGGGTGTGCAGGG - Intronic
1181915825 22:26279133-26279155 GTGCAGTCACAGACAGAGCATGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182720698 22:32396542-32396564 ATGCATTCACATATTGAGAAAGG - Intronic
1184231508 22:43160606-43160628 CTGCAGTCACAGACTGACTCAGG + Intronic
1184388341 22:44188810-44188832 CTGCAGGCACAGGCTGATCAAGG + Intronic
1185271368 22:49930668-49930690 ACGCAGGCACACACTGAGGATGG + Intergenic
949095309 3:78656-78678 ATGCAAACACAGTCTGAGCTTGG + Intergenic
949506274 3:4730967-4730989 ATCCAGTCAGAGACTCAGGATGG + Intronic
950146864 3:10656295-10656317 ATGGGGTCAGGGACTGAGCATGG + Intronic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
952903922 3:38127424-38127446 ATGCTGCCACAGACCCAGCATGG + Intronic
953105105 3:39870083-39870105 ATGCAGTCACATCCAGGGCAAGG + Intronic
954662590 3:52234074-52234096 ATGCCCTCAGAGACTGGGCAGGG - Intronic
957629512 3:82701187-82701209 ATGCATTAACAGGCTGGGCACGG - Intergenic
958806828 3:98821755-98821777 ATGCAGACACTGGCTGGGCACGG + Intronic
962468121 3:135679441-135679463 AAGCTGTCACAGACAGAACATGG + Intergenic
962752898 3:138447176-138447198 AAGCAGGCAAAGACTAAGCAAGG + Intronic
962825413 3:139096207-139096229 CTGCAGTCTCAGACTGTCCAGGG - Intronic
967952711 3:194853251-194853273 ATGCAGCCACAGGCTGTGGAAGG + Intergenic
970249602 4:14100316-14100338 ATGGAGACAAAGAGTGAGCAAGG + Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
973314570 4:48746642-48746664 AGGCAGTCACAGACTGCTCAGGG - Intronic
973826008 4:54708346-54708368 ATGCAGGGATAGACTGACCAGGG + Intronic
974359564 4:60859466-60859488 ATACAGTCACAGACTGATAGAGG + Intergenic
974607559 4:64173357-64173379 ATGCAGTTACAGAGTGACTATGG - Intergenic
975705978 4:77112511-77112533 ATGCAATCAAAGACTGTGCTGGG - Intergenic
979720946 4:123899842-123899864 ATGATGTGACAGGCTGAGCAGGG - Intergenic
981554358 4:145976894-145976916 AGGATGTCAGAGACTGAGCAGGG + Intergenic
981587412 4:146319179-146319201 ATGATGTCAGAGACAGAGCAGGG - Intronic
981922917 4:150106641-150106663 ATGCAGTCAGTGACTGTTCATGG - Intronic
985605751 5:857318-857340 ATGGAGTCCCAGTCTGAGAAGGG - Intronic
992260128 5:74961132-74961154 ATCAAGTCACAGGCTGAGCGTGG - Intergenic
993526283 5:88969724-88969746 ATGCAGTCACAGTTTTGGCAAGG + Intergenic
996058719 5:119009237-119009259 ATGCTGACTCAGACTGAGGATGG + Intergenic
997390641 5:133512099-133512121 ATGCAGGCCCACACTGGGCAAGG + Intronic
998140525 5:139697280-139697302 CTGCAGTCACAGTGAGAGCAGGG + Intergenic
999459468 5:151745477-151745499 ATCCAGCCACAGTCTCAGCAGGG - Intronic
999798640 5:155011627-155011649 ATGCAATTACAGAGTCAGCAGGG - Intergenic
999842223 5:155440440-155440462 ATACAGTCACATACTGAAGAAGG - Intergenic
1000247789 5:159463254-159463276 ATGCAGGAAGGGACTGAGCAGGG - Intergenic
1000248760 5:159472330-159472352 ATGTAGTCAAAGACTAAGCATGG + Intergenic
1001026792 5:168231483-168231505 ATGCAGCCAGAGACTGCACATGG + Intronic
1003126673 6:3361387-3361409 ATCCAGCCACAGCCTGAGCCAGG - Intronic
1005977805 6:30813589-30813611 AAGCAGTCACAGCCAGAGCAGGG + Intergenic
1006831601 6:36971455-36971477 CTGCTGTCACATACAGAGCAAGG - Intronic
1007271217 6:40638652-40638674 AAGCAGGCAGAGACTGTGCAAGG + Intergenic
1008084398 6:47229040-47229062 ATGCAGCCTCAGGCTGGGCATGG + Intergenic
1009024657 6:57984225-57984247 ATCCAGGCGAAGACTGAGCAAGG + Intergenic
1012146057 6:95683226-95683248 ATGCACTTACAGAAAGAGCAAGG + Intergenic
1013893771 6:115059336-115059358 CAGAACTCACAGACTGAGCAGGG - Intergenic
1015455498 6:133422957-133422979 AAGCAGTCAGAGAGTGGGCAAGG - Intronic
1015916515 6:138222961-138222983 ATGGAGTCACAGAGTAAACAAGG - Intronic
1016008400 6:139112904-139112926 ATGCGGTGAGAGACTGGGCACGG + Intergenic
1016730229 6:147420658-147420680 ATGCAGTGACAGAGTGAAAAGGG - Intergenic
1020435577 7:8158915-8158937 AGGCATTCACAAACTGATCATGG + Intronic
1021739029 7:23666930-23666952 ATGCAGTCAGAGAGGAAGCAGGG - Intergenic
1023629368 7:42148393-42148415 ATGCAGCCACAGAATGTCCAGGG - Exonic
1024140308 7:46456320-46456342 AAACAGACACAGACTGAACAAGG + Intergenic
1026490043 7:70855466-70855488 CTAGAGTCACAGACAGAGCAGGG - Intergenic
1026580546 7:71612808-71612830 ATGCAGACATAAACTGGGCAGGG + Intronic
1029916881 7:104219344-104219366 AAGCAGTCACAGATTGATGATGG - Intergenic
1032186277 7:129729453-129729475 TGGCAGTCACAGACTGAGGATGG - Intronic
1034880997 7:154762539-154762561 TTGAATTCGCAGACTGAGCATGG + Intronic
1037785639 8:21901478-21901500 ATGGAGGCACAGACAGGGCATGG - Intergenic
1037882960 8:22581756-22581778 GTGCAGTCACAGGCTGGGCAGGG + Intronic
1039975666 8:42362755-42362777 ATGAAGTCACACACTCAGAATGG - Intronic
1041534028 8:58905501-58905523 ATGCTGTCAGAGAGTGACCATGG + Intronic
1041882675 8:62770187-62770209 ATGCAGTCACCCAATGAGCCAGG - Intronic
1042857542 8:73283338-73283360 TTCCAGTCAATGACTGAGCAGGG + Intergenic
1043176232 8:77026380-77026402 AGGCAGGCACAGACAGAGCTGGG + Intergenic
1046638161 8:116695734-116695756 GTGGAGTCAGAGACTGAGCAAGG + Intronic
1046961126 8:120114074-120114096 ATACAGTCACAGAGGGAGCAGGG + Intronic
1047120648 8:121900550-121900572 ATCCAGTCAGAGACTGAGAAGGG - Intergenic
1049423416 8:142526710-142526732 CTGCAGTCTCAGATTGGGCATGG - Intronic
1049912077 9:278799-278821 ATGCAGTCATAGAGAAAGCAGGG + Intronic
1051174998 9:14351708-14351730 ATTCAGTCACAGTCTTTGCAAGG - Intronic
1052209836 9:25891072-25891094 ATTCAGTCACTGACTTAACATGG - Intergenic
1052348672 9:27435932-27435954 AGGAAGTCACAGAGGGAGCAGGG - Intronic
1052423506 9:28273978-28274000 ATAATGGCACAGACTGAGCAGGG + Intronic
1055494189 9:76838352-76838374 ATGCAGGCAGAGGCTGGGCATGG + Intronic
1056303491 9:85267104-85267126 ATGCAGTCATAGAGGGAGAAGGG - Intergenic
1056463370 9:86829637-86829659 ATGCAGTCATTGTATGAGCAGGG + Intergenic
1056515558 9:87345896-87345918 ACCCAGTCACAGACCGTGCAGGG + Intergenic
1057840292 9:98480839-98480861 TCCCACTCACAGACTGAGCAGGG + Intronic
1058352664 9:104044320-104044342 ATGCAGTGACAGACAGTGAAGGG + Intergenic
1059152028 9:111957521-111957543 CTGTAGTCAATGACTGAGCACGG + Intergenic
1060809145 9:126600161-126600183 ATGCAGGTAGAGACTGAGCAAGG + Intergenic
1062105574 9:134753101-134753123 AGGCAGTCACAGCCTGTGCGAGG - Intronic
1186361643 X:8848568-8848590 ATGCTGTAACAGAATGAACAGGG - Intergenic
1186537822 X:10368139-10368161 ATGCAGTCTCAGGCTGGGCGCGG + Intergenic
1186738309 X:12490148-12490170 ATGCAGTACGAGACTGACCATGG + Intronic
1187296384 X:18005297-18005319 ATGCAGCCACAGATTAAGCATGG + Intergenic
1189167040 X:38870554-38870576 AGTCAGTCACAGGCTGTGCAGGG - Intergenic
1190011767 X:46791279-46791301 TTGCTGTCAGAGACTGAGCTTGG - Intergenic
1190101288 X:47524468-47524490 CTGCAGTCCCAGACTAAGGAAGG + Intergenic
1190777199 X:53562424-53562446 ATGCATCAACACACTGAGCAGGG + Intronic
1192177084 X:68892921-68892943 AAGCAGTCCCAGACTGAGCTGGG - Intergenic
1193219222 X:78902462-78902484 TTGCAGTCATAGACAAAGCAAGG + Intergenic
1193337574 X:80308101-80308123 ATGCATTTAAAGACTGAGTAAGG + Intergenic
1193937242 X:87637656-87637678 AAGCAGTCACAGGCTAGGCATGG + Intronic
1194123388 X:89987164-89987186 ATCCAGCCACAGGCTGACCATGG - Intergenic
1194454319 X:94083121-94083143 ATGTAGTCAAAGACCTAGCATGG + Intergenic
1200476273 Y:3644781-3644803 ATCCAGCCACAGGCTGACCATGG - Intergenic