ID: 1176123085

View in Genome Browser
Species Human (GRCh38)
Location 20:63462795-63462817
Sequence GTCCCCCTCTAGGCTCCGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 60}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176123085_1176123091 -9 Left 1176123085 20:63462795-63462817 CCCGACGGAGCCTAGAGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 60
Right 1176123091 20:63462809-63462831 GAGGGGGACATGCAGGGAGAGGG 0: 1
1: 2
2: 11
3: 133
4: 1061
1176123085_1176123095 11 Left 1176123085 20:63462795-63462817 CCCGACGGAGCCTAGAGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 60
Right 1176123095 20:63462829-63462851 GGGGGCCACACGCACAAGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 127
1176123085_1176123094 7 Left 1176123085 20:63462795-63462817 CCCGACGGAGCCTAGAGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 60
Right 1176123094 20:63462825-63462847 GAGAGGGGGCCACACGCACAAGG 0: 1
1: 0
2: 0
3: 11
4: 194
1176123085_1176123090 -10 Left 1176123085 20:63462795-63462817 CCCGACGGAGCCTAGAGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 60
Right 1176123090 20:63462808-63462830 AGAGGGGGACATGCAGGGAGAGG 0: 1
1: 0
2: 6
3: 85
4: 881
1176123085_1176123097 17 Left 1176123085 20:63462795-63462817 CCCGACGGAGCCTAGAGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 60
Right 1176123097 20:63462835-63462857 CACACGCACAAGGCAGGACACGG 0: 1
1: 0
2: 2
3: 11
4: 214
1176123085_1176123092 -8 Left 1176123085 20:63462795-63462817 CCCGACGGAGCCTAGAGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 60
Right 1176123092 20:63462810-63462832 AGGGGGACATGCAGGGAGAGGGG 0: 1
1: 0
2: 7
3: 115
4: 1168
1176123085_1176123093 -7 Left 1176123085 20:63462795-63462817 CCCGACGGAGCCTAGAGGGGGAC 0: 1
1: 0
2: 1
3: 10
4: 60
Right 1176123093 20:63462811-63462833 GGGGGACATGCAGGGAGAGGGGG 0: 1
1: 0
2: 3
3: 109
4: 1036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176123085 Original CRISPR GTCCCCCTCTAGGCTCCGTC GGG (reversed) Intronic
900176520 1:1293698-1293720 GCCTCCCCGTAGGCTCCGTCTGG - Exonic
903175013 1:21575537-21575559 GTCCCTCTCTGGCCTCCGTCAGG + Intronic
912457735 1:109808904-109808926 GTCCCCAGCTAGGCTCAGCCTGG + Intergenic
912710186 1:111944443-111944465 CTCCCTCTGGAGGCTCCGTCTGG + Intronic
1070585758 10:77764727-77764749 GTCCCTCACTAGCCTCCCTCTGG - Intergenic
1070743217 10:78916241-78916263 GGCTCCCTCTAAGCTCCCTCGGG - Intergenic
1072028198 10:91486534-91486556 GTTCCCCTCTAGGTTCAGGCTGG - Intronic
1072546922 10:96447167-96447189 GTCCCCGTCTAGGCTCCTTCTGG - Intronic
1073240594 10:102055594-102055616 GTCCCTCTCCAGGCTCTGACAGG - Intronic
1077860170 11:6170976-6170998 GTACCCCTCTAGGCTTCCTCTGG - Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1081668897 11:44932533-44932555 GGCCCGCTCTACGCTCCGTTTGG - Exonic
1081845470 11:46237928-46237950 TTCCCCCTCTGTCCTCCGTCCGG - Intergenic
1083196231 11:61090264-61090286 GTCCCCCTCTGTGCTCCCTCAGG + Intergenic
1092298294 12:7220241-7220263 ATCCCCACCTAGGCTCCGTGGGG + Intergenic
1096692080 12:53327593-53327615 GCCCCCCTCTTGGCACCCTCTGG + Exonic
1104001460 12:124863379-124863401 GTTCCCCCCTAGCCTCAGTCTGG + Intronic
1113917849 13:113884822-113884844 GTTGCCCTCTAGGCTCTGTCGGG + Intergenic
1113939311 13:114010320-114010342 GGCCCCCTCGGGGCTCCGTCTGG - Intronic
1122864705 14:104598249-104598271 GTCCCCCTCAGGGCTCCCACTGG - Intronic
1123843207 15:24269826-24269848 TTCGCCCTCTTGGCACCGTCAGG - Intergenic
1123858283 15:24436043-24436065 TTCGCCCTCTTGGCACCGTCAGG - Intergenic
1125800771 15:42444681-42444703 GTCCCCCATTAGGCACAGTCTGG + Intronic
1130071313 15:80648682-80648704 CTCCCCTTCTAGACTCAGTCAGG - Intergenic
1132356221 15:101173402-101173424 GTCCACTTCTGGGCTCAGTCAGG + Intergenic
1143384956 17:6523678-6523700 GACCCCTTCTAGGCCCCCTCTGG + Intronic
1143520827 17:7443281-7443303 GTCAGCCCCTAGGCTCCCTCAGG - Exonic
1144728427 17:17513255-17513277 TTCCCCCACTAGGCTCCCTTTGG + Intronic
1150130506 17:62666405-62666427 GGCCCCCTCCAGGGTCCCTCGGG - Intronic
1154299753 18:13182765-13182787 GTCCCCCTCTAGGCTCAGATGGG - Intergenic
1164733164 19:30520925-30520947 GGCCGGCTCTGGGCTCCGTCTGG - Intronic
1165737073 19:38183585-38183607 GCCCCCCTCACGCCTCCGTCTGG - Intronic
1166380307 19:42352201-42352223 GTCCCCCTGTAGGCACCTGCAGG - Exonic
1167781233 19:51600770-51600792 GTCCACCTCCAGTCTCCTTCTGG + Intergenic
925891759 2:8440082-8440104 GTCATCCTCTAGGGTCTGTCGGG - Intergenic
933535475 2:83567712-83567734 GTCCTCCTCCAGGCTCACTCAGG + Intergenic
937310027 2:120896355-120896377 GGGCCCCTCTGGGCTCCCTCTGG - Intronic
948375831 2:237519735-237519757 CTCCCCCTCTGGGCTTGGTCAGG + Intronic
948586108 2:239020766-239020788 GTCCCCCTCCTGCCTCCCTCTGG + Intergenic
1173539303 20:43839105-43839127 GACCCCCTCGAGGCTCAGTTAGG - Intergenic
1175249601 20:57601229-57601251 GGACCCCTCTAGGCTGTGTCTGG + Intergenic
1176123085 20:63462795-63462817 GTCCCCCTCTAGGCTCCGTCGGG - Intronic
1181680845 22:24494957-24494979 GTCCCCCTCCCGCCTCCCTCAGG - Intronic
1183728239 22:39601417-39601439 GTCCCCAGCTTGGCTCAGTCGGG - Intronic
1184373547 22:44097746-44097768 GTTCCCCTCTAGGCGGGGTCAGG + Intronic
953490205 3:43343672-43343694 GTCCCCTTCTGGGCTCAGTGGGG + Intronic
954284226 3:49607347-49607369 GTCCCTCTGTTGGCTCAGTCTGG + Intronic
954347589 3:50013269-50013291 GTCCCCCACTGGGCTTTGTCAGG + Intronic
954458967 3:50615646-50615668 GACCTCCTCTAGGCTCTGTAAGG + Intronic
956718548 3:72099011-72099033 GCCCCCCTGTTGGCTCCTTCAGG - Intergenic
961438830 3:126938736-126938758 GTGGCCCTGTAGGCTCCCTCAGG + Intronic
967813643 3:193781110-193781132 CTCCCCCTCCATGCCCCGTCTGG - Intergenic
967820634 3:193835872-193835894 GTCCCTCTCCAGGCACCGTCTGG + Intergenic
968286112 3:197509926-197509948 GTCCCCCTCTGGGCTCTGGAGGG + Exonic
971809680 4:31408404-31408426 GTCCCCCACTAGGCTACTTAAGG - Intergenic
990508293 5:56466529-56466551 GTCTGCCTCTAGGCTCCCCCTGG - Intronic
1005495989 6:26388347-26388369 TTCCCGCTCTGGGCTCCATCTGG - Intronic
1013155848 6:107490464-107490486 CTCCCCCTCGCGGCTCGGTCCGG + Exonic
1014510676 6:122317723-122317745 GTCCACTTCCAGGCTCCTTCAGG - Intergenic
1016022809 6:139253883-139253905 GTTCCCCTCAAGGCTCTGTGTGG + Intronic
1023819454 7:43972544-43972566 CCTCCCCTCTAGGCTCCGTCTGG - Intergenic
1029744505 7:102509513-102509535 CCTCCCCTCTAGGCTCCGTCTGG - Intronic
1029762496 7:102608675-102608697 CCTCCCCTCTAGGCTCCGTCTGG - Intronic
1032839623 7:135703769-135703791 GTCCCTCTTCAGGCTCTGTCAGG + Intronic
1037512099 8:19593919-19593941 CTCTCCCTCTAGGCTGCTTCAGG + Intronic
1049689824 8:143953551-143953573 GTCCCCCTCCGGGCTCCACCTGG - Intronic
1053071601 9:35105293-35105315 GTCCAGCTCCAGGCTCCGGCGGG + Exonic
1053567539 9:39269044-39269066 GTCCCCCTAGAGCCTCCGTAGGG + Intronic
1054129604 9:61349954-61349976 GTCCCCCTAGAGCCTCCGTAGGG - Intergenic
1056262395 9:84862070-84862092 TTCCCCCTCCAGGCCCCATCTGG - Intronic
1190222378 X:48520685-48520707 ATCCCCCTCTAGGCCCCAGCAGG - Exonic
1200061400 X:153485378-153485400 GTCACCCTCTGAGCTCTGTCAGG + Intronic