ID: 1176123668

View in Genome Browser
Species Human (GRCh38)
Location 20:63465537-63465559
Sequence CGAAATCAACAGAGAAAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176123655_1176123668 24 Left 1176123655 20:63465490-63465512 CCCTGCCACTCAGAGCCCACTAG 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1176123668 20:63465537-63465559 CGAAATCAACAGAGAAAGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 242
1176123664_1176123668 -10 Left 1176123664 20:63465524-63465546 CCAGAACCCACTCCGAAATCAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1176123668 20:63465537-63465559 CGAAATCAACAGAGAAAGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 242
1176123659_1176123668 19 Left 1176123659 20:63465495-63465517 CCACTCAGAGCCCACTAGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1176123668 20:63465537-63465559 CGAAATCAACAGAGAAAGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 242
1176123656_1176123668 23 Left 1176123656 20:63465491-63465513 CCTGCCACTCAGAGCCCACTAGG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 1176123668 20:63465537-63465559 CGAAATCAACAGAGAAAGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 242
1176123663_1176123668 8 Left 1176123663 20:63465506-63465528 CCACTAGGGAGGCAGGAACCAGA 0: 1
1: 0
2: 1
3: 22
4: 244
Right 1176123668 20:63465537-63465559 CGAAATCAACAGAGAAAGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 242
1176123662_1176123668 9 Left 1176123662 20:63465505-63465527 CCCACTAGGGAGGCAGGAACCAG 0: 1
1: 0
2: 0
3: 20
4: 182
Right 1176123668 20:63465537-63465559 CGAAATCAACAGAGAAAGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176123668 Original CRISPR CGAAATCAACAGAGAAAGCT CGG Intronic
904250042 1:29216837-29216859 AGAAATCAACACAGGAGGCTGGG + Intronic
904346035 1:29870616-29870638 TGATATCAACAGGGAAAGCAGGG + Intergenic
905692010 1:39950357-39950379 TGAAATTAAAAGAGAATGCTGGG - Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
907801071 1:57766340-57766362 AGAAATCAAGGGAGAAGGCTGGG - Intronic
908598766 1:65716724-65716746 CGAAATCAACATACAAAAATCGG - Intergenic
908700027 1:66888994-66889016 GAATATCTACAGAGAAAGCTGGG + Intronic
908896170 1:68902652-68902674 CTAAGTCAACAGAGCATGCTTGG + Intergenic
908914740 1:69113214-69113236 CCTAATCAAAAGAGAATGCTGGG - Intergenic
909213808 1:72859575-72859597 TAAAATGGACAGAGAAAGCTTGG + Intergenic
909316510 1:74226333-74226355 GGAAATCAACAAAGAAACATTGG + Intronic
910252024 1:85207987-85208009 CAATCTCAACAGAGAAAGCAGGG - Intergenic
910290144 1:85592480-85592502 CAAAATCAACAAAGAAACATTGG + Intergenic
910756784 1:90702402-90702424 AGAAAACAACAGGGTAAGCTTGG + Intergenic
911366861 1:96949141-96949163 CATAATCAGCAGAGAAAGTTTGG - Intergenic
912020767 1:105106915-105106937 AGAAATGAACAAAGACAGCTTGG + Intergenic
912633003 1:111264611-111264633 GGAAATCAACAAAGAAACATTGG - Intergenic
912930618 1:113956508-113956530 TGTAATCAAAAGAGAAACCTGGG - Intronic
913083953 1:115416885-115416907 GGAAACCAAAAAAGAAAGCTAGG - Intergenic
915904280 1:159866473-159866495 CCAAATCATCACTGAAAGCTGGG - Intronic
916055558 1:161066997-161067019 CAAAATCAGCAGAGAAGGATAGG - Intronic
920777878 1:208958112-208958134 CAAAATCAACAGAGAGAGTGAGG - Intergenic
921226443 1:213025139-213025161 AAAAATCAACAAAGAAATCTTGG - Intergenic
921850801 1:219929976-219929998 AGAAACCAACAAAGAAACCTAGG - Intronic
923356199 1:233158212-233158234 AGAATTCAACAGTGAAAGATAGG - Intronic
923872127 1:238006821-238006843 AAATATAAACAGAGAAAGCTTGG - Intergenic
1063269068 10:4486667-4486689 TGAAATCAAGAGAGGATGCTGGG + Intergenic
1063692708 10:8302487-8302509 GGAAATCAAAAGAGAAAGTGTGG + Intergenic
1065007551 10:21393815-21393837 AGAAATGAACAGGGATAGCTTGG - Intergenic
1065315766 10:24462503-24462525 CGCAAACAACCGAGGAAGCTGGG + Intronic
1065509594 10:26464990-26465012 CAAAACCAACAGAGAACTCTGGG + Intronic
1065689909 10:28322508-28322530 CAAAAGTAACAGAGAAAGGTTGG - Intronic
1065901127 10:30209086-30209108 GAAAATCAACAGAGGAAGCATGG - Intergenic
1067247005 10:44555670-44555692 TGAAATAAAAAGAGAAATCTAGG - Intergenic
1068241296 10:54304470-54304492 CAAAATGAACAGCAAAAGCTTGG + Intronic
1069015812 10:63427668-63427690 CGAAATCCGCAGAGAAGCCTGGG + Intronic
1071732519 10:88262648-88262670 TGAAATCCAAAGAGTAAGCTTGG - Intergenic
1072777856 10:98218714-98218736 GAAAATCAACAGAGAAACATTGG - Intronic
1077976765 11:7254702-7254724 GGACAATAACAGAGAAAGCTGGG - Intronic
1081292636 11:41345540-41345562 GGAAATCAAAAGAGAAAACCAGG - Intronic
1082729171 11:56774179-56774201 CAAAATCAAGAGGTAAAGCTAGG + Intergenic
1087922548 11:103883042-103883064 AGAAAACAACATAGAAAGATAGG - Intergenic
1090953326 11:131493400-131493422 CGAAACACACAGAGAAAGCAGGG - Intronic
1092273766 12:7043681-7043703 GGAATTCTACAGAGAATGCTGGG + Intronic
1092351768 12:7761628-7761650 AAAAAGCAACAGAGAAATCTGGG - Intergenic
1092351927 12:7762678-7762700 CAAAAGCAACAGAGAAGGCCGGG - Intergenic
1093875845 12:24348677-24348699 AGAAGTCAACAGAGCAGGCTGGG - Intergenic
1093951478 12:25167995-25168017 CGAAAATAACAGTGAAAGGTTGG + Intronic
1095190461 12:39251802-39251824 CCAAATCAACAGACAAAGAAAGG + Intergenic
1095423623 12:42051231-42051253 AGAAATTAACAGATAAAGGTCGG + Intergenic
1095721817 12:45408993-45409015 GAAAATCAACAGAGAAAACAAGG - Intronic
1097984201 12:65766348-65766370 TGATATCAACAGAGCAAGCCTGG - Intergenic
1100731200 12:97471614-97471636 TGAAATCACCATAGAAAGTTAGG - Intergenic
1100742591 12:97610108-97610130 TGAAATGAACAGAAGAAGCTGGG + Intergenic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1104173641 12:126307136-126307158 CGAAATCAACATACAAAAATCGG - Intergenic
1106079610 13:26489260-26489282 CGAAAACAGCAGAGATAGATAGG - Intergenic
1107757656 13:43642304-43642326 CCATATCAAGAAAGAAAGCTGGG + Intronic
1108860284 13:54849672-54849694 CTAAATCAACATAGAAAGGAAGG - Intergenic
1108890241 13:55249198-55249220 CAAAATCAACATACAAAACTAGG + Intergenic
1109676387 13:65680170-65680192 CACAATCAACAGAGAATCCTTGG + Intergenic
1110134011 13:72043096-72043118 AGCATTCAACAGAGAAAGGTGGG - Intergenic
1111137098 13:84061957-84061979 CGAAATCAACATACAAAAATTGG - Intergenic
1114241090 14:20869133-20869155 CAAAAGCAACACAGAAACCTAGG + Intergenic
1115245287 14:31288095-31288117 GGAAATCAACACAGCAAGATTGG - Intergenic
1115538676 14:34398206-34398228 GAAAATCAACAAAGAAACCTTGG + Intronic
1118470500 14:66070510-66070532 TGAAATCAAAAGAATAAGCTTGG + Intergenic
1119011436 14:70993933-70993955 ATAAATCAACAGATAAATCTTGG - Intronic
1119524439 14:75310985-75311007 AGAAATCCATAGAGAAGGCTCGG + Intergenic
1119617667 14:76109530-76109552 CCAAATCCACAGAGAAGGCTAGG - Intergenic
1120100571 14:80440341-80440363 GGAAATCAACAAAGAAACATTGG + Intergenic
1120262809 14:82208860-82208882 GAAAATCAACAAAGAAACCTTGG - Intergenic
1125082453 15:35690958-35690980 GGAAATCAAGAGTAAAAGCTTGG + Intergenic
1126016294 15:44354586-44354608 GAAAATCAATAGAGAAAGATAGG + Intronic
1127713870 15:61628126-61628148 CGGAATCAACAGCACAAGCTGGG - Intergenic
1127736690 15:61847131-61847153 CAAAATCAAAAGAGAAAGTGTGG - Intergenic
1130198961 15:81807658-81807680 CAAAGTCATCAGAGAAACCTAGG + Intergenic
1131957286 15:97749860-97749882 AGAAGTTGACAGAGAAAGCTTGG + Intergenic
1132371289 15:101301175-101301197 GGAAAGCAACAGTGAAGGCTGGG + Intronic
1136315394 16:29451936-29451958 AGAAAACAAAAAAGAAAGCTGGG + Intronic
1136429971 16:30191278-30191300 AGAAAACAAAAAAGAAAGCTGGG + Intergenic
1138820292 16:60251514-60251536 CTGAATGAACATAGAAAGCTAGG - Intergenic
1139215868 16:65123470-65123492 CGAAAACGGAAGAGAAAGCTTGG + Intronic
1142790336 17:2259216-2259238 CCAAACCAACAGAGAAGTCTTGG + Intronic
1143927025 17:10380378-10380400 CAAACTCAACAGAGCAAGTTTGG + Intergenic
1148324845 17:46777277-46777299 CCATATCCACAGAGAAAGCCAGG + Intronic
1148766704 17:50043821-50043843 CCAAGGAAACAGAGAAAGCTAGG - Intergenic
1151912171 17:77090825-77090847 CAAAATCAAAAAAGTAAGCTGGG + Intronic
1152220809 17:79064449-79064471 AGAAATCAACAGAATAGGCTGGG + Intergenic
1153079266 18:1201980-1202002 CAATAACAACAGAGAAAGATTGG - Intergenic
1153100929 18:1468785-1468807 CGAAATGAACAAGGACAGCTTGG - Intergenic
1153182500 18:2450822-2450844 CATAATCAACTAAGAAAGCTAGG - Intergenic
1154121582 18:11656655-11656677 CCCAATCAACAGACAGAGCTTGG + Intergenic
1154245967 18:12698979-12699001 TGAAGTACACAGAGAAAGCTTGG - Exonic
1154296317 18:13152869-13152891 AGAAATCAAGAAAGAAATCTGGG - Intergenic
1155531767 18:26774608-26774630 GGGACTCAGCAGAGAAAGCTTGG - Intergenic
1156254485 18:35382026-35382048 CAAAGTCAACAGACAAACCTGGG + Intergenic
1156353855 18:36323977-36323999 GAAAATCAACAGAGAATGCTGGG - Intronic
1156722931 18:40092546-40092568 TGCAATCAGCAGAGAAGGCTTGG - Intergenic
1158606642 18:58901806-58901828 CGAAGCCAACAGAGAAATCCTGG - Intronic
1158948770 18:62472420-62472442 GAAAATCAACAGAGAAACATTGG - Intergenic
1159666789 18:71171210-71171232 CCAACTCAACAGAGTAAACTGGG - Intergenic
1159686441 18:71426923-71426945 CAAAATCAACAGACAAAACAGGG + Intergenic
1160617762 18:80146640-80146662 CAAAATCAACAGAAAGGGCTTGG - Intronic
1160843798 19:1157843-1157865 CGGACTCAAGAGAGAGAGCTGGG - Intronic
1163511523 19:17738346-17738368 CAAATTAAAAAGAGAAAGCTGGG + Intergenic
1164428181 19:28163093-28163115 CCAAATGAACAAAGAAATCTTGG - Intergenic
1164654796 19:29912417-29912439 CAAAATAAAGATAGAAAGCTGGG - Intergenic
1166850862 19:45760170-45760192 TGAAATCAAAAGACTAAGCTGGG + Intronic
925694435 2:6560755-6560777 CGAAGGGAAGAGAGAAAGCTGGG + Intergenic
926960407 2:18352090-18352112 TGCAATCAACAGAAAAAACTGGG + Intronic
929820430 2:45269155-45269177 CTACATCAACAGAGAGAACTGGG + Intergenic
932053352 2:68420476-68420498 CTAAATCAGCTGAGATAGCTAGG - Intergenic
935038153 2:99399091-99399113 CAGCACCAACAGAGAAAGCTAGG + Intronic
935480774 2:103585911-103585933 GGAAAAGAAAAGAGAAAGCTAGG + Intergenic
935549109 2:104432874-104432896 TGAAAGCAACAGAGAAACCAAGG + Intergenic
936766604 2:115857412-115857434 GAAAATCAACAGAGAAACATAGG - Intergenic
937545165 2:123007677-123007699 CGAAATCAACAAAGAAACATTGG + Intergenic
939200588 2:139029854-139029876 GAAAATCAACAGAGAAACTTTGG - Intergenic
940121313 2:150269597-150269619 CCAAATAAATAGAGAAACCTAGG - Intergenic
940760114 2:157729286-157729308 CACCATCAACAGGGAAAGCTGGG + Intergenic
941331163 2:164179071-164179093 TCAACTCAATAGAGAAAGCTTGG + Intergenic
945790733 2:214302320-214302342 AGAAATCAACAAAGAAACTTTGG - Intronic
948255665 2:236566780-236566802 AGAAAGCAACAGAGAAAGGCAGG - Intergenic
948774940 2:240280742-240280764 GAAAATCAACAAAGAAACCTCGG + Intergenic
1173208640 20:41014551-41014573 CTAAATAAACTGAGAAAGCCGGG + Intergenic
1173242823 20:41312934-41312956 AGAAAGCAACAGTGGAAGCTGGG + Intronic
1173958302 20:47051832-47051854 GGAAAACAACAGAGCAAGGTCGG - Intronic
1176123668 20:63465537-63465559 CGAAATCAACAGAGAAAGCTCGG + Intronic
1177121982 21:17149040-17149062 CAAAATCAACAAAGAAATATTGG + Intergenic
1178015224 21:28338084-28338106 TGAAATCAACACAGACAGTTTGG - Intergenic
1184598657 22:45529501-45529523 CGAAAACTACACAGCAAGCTTGG - Intronic
950241004 3:11369905-11369927 TGAAATTAACAGACAAAGCTGGG - Intronic
954496509 3:50969021-50969043 TGAAATCAACAAAGAAATCCTGG - Intronic
957136582 3:76296244-76296266 CTAAAGCCCCAGAGAAAGCTTGG + Intronic
957395345 3:79629100-79629122 GAAAATCAACAAAGAAACCTTGG + Intronic
957441863 3:80258087-80258109 GGAAACCAATAGAGAAAGATGGG + Intergenic
959407940 3:105984169-105984191 CAAAATCAACAGACAAAATTTGG + Intergenic
959496049 3:107053120-107053142 GGAAATCTACAGAGACAGCTTGG - Intergenic
959876390 3:111387426-111387448 GAAAATCAACAAAGAAATCTTGG + Intronic
961015512 3:123465333-123465355 CAGAATCAGCAGAGACAGCTGGG - Intergenic
961097842 3:124173290-124173312 AAAAATAAAAAGAGAAAGCTTGG + Intronic
962038077 3:131675351-131675373 GAAAATCAACAAAGAAACCTTGG - Intronic
962693823 3:137928045-137928067 CCAAATCAACCTAGAAGGCTTGG + Intergenic
963427603 3:145152403-145152425 AGAAATCATCAGAGATAGATAGG + Intergenic
963505431 3:146179075-146179097 AGAAGTCAACACAGGAAGCTTGG - Intergenic
964137620 3:153362748-153362770 AGAAATAAAAAGAGAAAGCCTGG + Intergenic
964180565 3:153878960-153878982 TGAAATCAAGAGAGAAAAATAGG + Intergenic
966533931 3:181009873-181009895 AGAAATGAACAAAGACAGCTTGG + Intergenic
967216763 3:187217823-187217845 AGAAATAAACAGAATAAGCTGGG + Intronic
967738135 3:192975513-192975535 GAAAATCAACAGAGAAACATGGG + Intergenic
968206508 3:196806964-196806986 TGAGATAAACAGAGAAAGCTTGG - Intronic
971195363 4:24468244-24468266 CAACATCAAAAGATAAAGCTCGG + Intergenic
971567565 4:28165195-28165217 AGAAATCAACATAGAAACATTGG - Intergenic
972365215 4:38368096-38368118 GGAAATCTACAGAGAAAGATGGG + Intergenic
974150114 4:57995581-57995603 CGCAATCTGCAGGGAAAGCTGGG + Intergenic
974497379 4:62650042-62650064 GGAAATCAACAAAGAAATTTTGG - Intergenic
974508154 4:62804208-62804230 GAAAATCAACAGAGAAGGCTGGG - Intergenic
974914084 4:68157849-68157871 CAAAATCAACATAGAAAAGTTGG - Intergenic
976108138 4:81641367-81641389 AGAAATCCATAGAGAAATCTTGG - Intronic
976836177 4:89376810-89376832 GGAAATCTTCAGAGAAAGCCTGG - Intergenic
976932422 4:90584425-90584447 TGACAGCAACAGAAAAAGCTTGG + Intronic
978184891 4:105845702-105845724 GGAAAGCAACAGGGAAATCTTGG + Exonic
978255579 4:106688966-106688988 AGAAATAAGCAGAGATAGCTAGG - Intergenic
979444635 4:120797101-120797123 CAAAATCAACAGAAGAAACTAGG + Intronic
979822812 4:125194715-125194737 CAAAATCTAAAGAGAAAACTGGG + Intergenic
980545999 4:134262381-134262403 CAAAAACAAAAGAGAAAGCATGG + Intergenic
981623879 4:146735088-146735110 TGAAATTAAAAGAGAATGCTGGG + Intronic
984208642 4:176818034-176818056 CGGAATGAAGAGATAAAGCTGGG - Intergenic
985075997 4:186215404-186215426 AGAAAGCAAGAGAGAAAGCAAGG - Intronic
985144893 4:186886429-186886451 CGGAATCCACAGAGCAAGGTGGG - Intergenic
986231916 5:5872856-5872878 CGATATAAATAGAGAAAGCTTGG - Intergenic
986436658 5:7740124-7740146 CGAAATAAAATGAGAAAGGTTGG + Intronic
986630905 5:9772544-9772566 CAAAATCAACAAAGAAACATTGG - Intergenic
987152159 5:15054080-15054102 GGAAATCAACAGAGAAATGCTGG - Intergenic
989709972 5:44387212-44387234 GGAAGTCAACAGAGTAATCTGGG + Intronic
990660999 5:58014941-58014963 CAAATACAACAAAGAAAGCTAGG - Intergenic
991034197 5:62111339-62111361 AGAATTCACCGGAGAAAGCTAGG - Intergenic
993421996 5:87714284-87714306 AGAAATGAACAAAGACAGCTTGG + Intergenic
993723199 5:91341924-91341946 CGAAATTATCTGAGACAGCTGGG + Intergenic
994654142 5:102568589-102568611 AGAAATCAACAAAGAAATATTGG - Intergenic
995217714 5:109614316-109614338 TGGAATCAACAGAGAAATTTGGG - Intergenic
995372602 5:111436031-111436053 AAAAATGAACAGAAAAAGCTAGG - Intronic
995596131 5:113749827-113749849 AGAAATGAACAGGGATAGCTTGG + Intergenic
997802339 5:136877279-136877301 CAAAATCAACAAAGAAATATTGG + Intergenic
998016963 5:138740102-138740124 CTAAACCAACAGACAAAACTAGG + Intronic
999158553 5:149476113-149476135 CGTAATCAACAGAGGTAGCCTGG - Intergenic
1000477432 5:161728490-161728512 AGAGCTCAACAGAGAAATCTAGG + Intergenic
1000828578 5:166075985-166076007 TGAAATCAAGACAGAAAGCAAGG + Intergenic
1001293126 5:170479268-170479290 AGAAAGCACCAGAGAAAACTGGG + Intronic
1003128304 6:3373592-3373614 CTAAATCAAAAGAAGAAGCTGGG + Intronic
1003219448 6:4145652-4145674 GGAAATCAAGAGAGAGAGGTAGG + Intergenic
1003440276 6:6134436-6134458 AGAAATCAAGAGAGCAAGATAGG - Intergenic
1003658345 6:8035834-8035856 GAAAATCAACAGAGAAACATTGG + Intronic
1003993779 6:11516861-11516883 CGAAATCTACATTGAAATCTCGG - Intergenic
1004432783 6:15561085-15561107 CAAAAACAACAGACAAGGCTAGG - Intronic
1005895980 6:30178997-30179019 GAAAATCAACAGAGAAACATTGG - Intergenic
1008128155 6:47691452-47691474 AGAAATCAACAGAGAGAGAATGG - Intronic
1011407430 6:87030772-87030794 AGAAATCAAAAGAGAACTCTGGG - Intergenic
1012567089 6:100670996-100671018 CCAAATCAACTCAGAAAGATGGG - Intronic
1013686974 6:112596340-112596362 TGAGATCATCAGAGAGAGCTTGG - Intergenic
1014583320 6:123164795-123164817 GGAAATCAACAAAGAAACATTGG + Intergenic
1014901761 6:126974253-126974275 CAAAACAAACAGAGAAAGCAGGG + Intergenic
1014920475 6:127209098-127209120 GGAAGTCAAGAGAGAAAGTTGGG - Intergenic
1015173206 6:130277823-130277845 AGGAATGAACAGAGACAGCTTGG - Intronic
1016136608 6:140551858-140551880 GAAAATCAACAAAGAAAGATTGG - Intergenic
1021216809 7:17926096-17926118 CAAAAATAACAGAGAAAGTTGGG + Intronic
1023284185 7:38602266-38602288 AGAAATCAATTTAGAAAGCTGGG - Intronic
1027393259 7:77726560-77726582 CGAAATCAGTAGGGAAAGCTAGG - Intronic
1027566805 7:79805095-79805117 CAAAATCTACAAAGACAGCTGGG + Intergenic
1028001615 7:85504900-85504922 CAAAATCAACAAAGAAATATTGG + Intergenic
1028186512 7:87792313-87792335 CAAAATCAACAAAGAAACATTGG + Intronic
1028596707 7:92553690-92553712 GGAAATAAAGACAGAAAGCTGGG + Intergenic
1028645421 7:93090906-93090928 AGAAATCAACAAAGAAATATTGG - Intergenic
1029050367 7:97680543-97680565 TGAAATCAAAAGAGAATACTGGG + Intergenic
1029455371 7:100667956-100667978 GGAATTCAGCAGAGAAATCTGGG - Intergenic
1031188978 7:118521876-118521898 CAAAATCAACACACAAAACTTGG + Intergenic
1031233573 7:119142690-119142712 GGAAATCAACTGAGATAACTAGG + Intergenic
1032866660 7:135932354-135932376 CAGAATCAACAGGAAAAGCTGGG - Intronic
1033888113 7:145972906-145972928 AAAAATCAACTGAGAAAGATTGG + Intergenic
1033975544 7:147096019-147096041 CTAAATCAATAGAGAGAGCATGG - Intronic
1036567605 8:9950999-9951021 GGAAATCAAAAGAGAAATCAAGG - Intergenic
1039323407 8:36458581-36458603 CAAAATTAACATAGAAGGCTGGG + Intergenic
1043465241 8:80499581-80499603 CTAAATGAACAGAGAAAGAAAGG + Exonic
1044025938 8:87172410-87172432 GAAAATCAACAAAGAAAGATCGG - Intronic
1044154076 8:88821378-88821400 CAAACTCAAGAGAGAAAGCTGGG + Intergenic
1047004940 8:120610665-120610687 CCAAATCAAGAGGTAAAGCTGGG - Intronic
1047832315 8:128648153-128648175 AGAAACTAACAGAGAAAGCAAGG - Intergenic
1048219095 8:132525132-132525154 CCAACTCAAGCGAGAAAGCTGGG + Intergenic
1049226847 8:141457379-141457401 CGAAATAAACAAACAAAACTCGG + Intergenic
1052460353 9:28754924-28754946 AGAAATAAACAGATAAGGCTGGG - Intergenic
1052590553 9:30488306-30488328 TAAAATCAACAGAGAAATCGGGG + Intergenic
1053293532 9:36897684-36897706 GGAAAGCAACAGAGAAAACCTGG - Intronic
1055264902 9:74483655-74483677 AATAGTCAACAGAGAAAGCTTGG - Intergenic
1058144115 9:101391782-101391804 CAAAATCAACAAAGAAAGACTGG + Intronic
1059165612 9:112073857-112073879 CGTAAGCAACAGAGCAAGCCTGG + Intronic
1185880697 X:3737906-3737928 CAAACTCAACAAAGAAAGCATGG + Intergenic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1187429652 X:19210547-19210569 CAAAATGACCAGAGCAAGCTTGG + Intergenic
1187832706 X:23399056-23399078 GAAAACCAGCAGAGAAAGCTTGG + Exonic
1188883741 X:35523692-35523714 AGACGTTAACAGAGAAAGCTGGG + Intergenic
1189280147 X:39815560-39815582 CCAAAACAACACAGAAAGTTGGG + Intergenic
1189769350 X:44408053-44408075 AAAAAAAAACAGAGAAAGCTGGG - Intergenic
1191883097 X:65861738-65861760 AGAAAACAAAAGAGAAACCTTGG + Intergenic
1192017805 X:67350453-67350475 CCAAATAAACAGAAAATGCTAGG + Intergenic
1193697050 X:84721681-84721703 CAAAATCAACAAAGAAACATTGG - Intergenic
1193698056 X:84733505-84733527 AGAAATGAACAGAGAGAGTTGGG - Intergenic
1194460168 X:94156834-94156856 CAAAATCAACATAGAAAAATTGG - Intergenic
1195148409 X:102042042-102042064 GGAAATCAACAAAGAAATATTGG + Intergenic
1197120737 X:122888940-122888962 AAAAATGAACAGAGCAAGCTTGG - Intergenic
1197126485 X:122952676-122952698 CGAAATCAGCAAAGAAATATTGG - Intergenic
1197821681 X:130547653-130547675 CGAACTCAACAGAGATCTCTGGG + Intergenic
1198702318 X:139411045-139411067 CAAAATCAACAAAGAAACATTGG - Intergenic
1201570081 Y:15404224-15404246 AGAAAACCACACAGAAAGCTGGG + Intergenic