ID: 1176125762

View in Genome Browser
Species Human (GRCh38)
Location 20:63473760-63473782
Sequence GGTCCCTCTGGAGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176125750_1176125762 7 Left 1176125750 20:63473730-63473752 CCCCTGCCGGCAGCCATGTGTCC No data
Right 1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG No data
1176125749_1176125762 8 Left 1176125749 20:63473729-63473751 CCCCCTGCCGGCAGCCATGTGTC No data
Right 1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG No data
1176125755_1176125762 1 Left 1176125755 20:63473736-63473758 CCGGCAGCCATGTGTCCTGGGAG No data
Right 1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG No data
1176125759_1176125762 -6 Left 1176125759 20:63473743-63473765 CCATGTGTCCTGGGAGGGGTCCC No data
Right 1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG No data
1176125747_1176125762 12 Left 1176125747 20:63473725-63473747 CCTCCCCCCTGCCGGCAGCCATG No data
Right 1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG No data
1176125748_1176125762 9 Left 1176125748 20:63473728-63473750 CCCCCCTGCCGGCAGCCATGTGT No data
Right 1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG No data
1176125752_1176125762 5 Left 1176125752 20:63473732-63473754 CCTGCCGGCAGCCATGTGTCCTG No data
Right 1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG No data
1176125751_1176125762 6 Left 1176125751 20:63473731-63473753 CCCTGCCGGCAGCCATGTGTCCT No data
Right 1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176125762 Original CRISPR GGTCCCTCTGGAGCTGCTGC TGG Intergenic
No off target data available for this crispr