ID: 1176131645

View in Genome Browser
Species Human (GRCh38)
Location 20:63498966-63498988
Sequence CCTGGGGGGCAGAGGGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1432
Summary {0: 1, 1: 0, 2: 9, 3: 142, 4: 1280}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176131645_1176131675 21 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131675 20:63499010-63499032 TCGGAAGACGGGGGCGGGGGCGG 0: 1
1: 0
2: 5
3: 41
4: 482
1176131645_1176131668 12 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131668 20:63499001-63499023 GGTCCCTCTTCGGAAGACGGGGG 0: 1
1: 0
2: 0
3: 4
4: 40
1176131645_1176131672 16 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131672 20:63499005-63499027 CCTCTTCGGAAGACGGGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 158
1176131645_1176131677 29 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131677 20:63499018-63499040 CGGGGGCGGGGGCGGAGGCCCGG 0: 2
1: 13
2: 151
3: 532
4: 2922
1176131645_1176131665 9 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131665 20:63498998-63499020 GGGGGTCCCTCTTCGGAAGACGG 0: 1
1: 0
2: 0
3: 2
4: 64
1176131645_1176131676 24 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131676 20:63499013-63499035 GAAGACGGGGGCGGGGGCGGAGG 0: 1
1: 3
2: 39
3: 381
4: 2404
1176131645_1176131673 17 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131673 20:63499006-63499028 CTCTTCGGAAGACGGGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 93
1176131645_1176131678 30 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131678 20:63499019-63499041 GGGGGCGGGGGCGGAGGCCCGGG 0: 1
1: 1
2: 48
3: 442
4: 2720
1176131645_1176131655 -9 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131655 20:63498980-63499002 CCCCCCAGGACCGGCCCCGGGGG 0: 1
1: 0
2: 1
3: 30
4: 284
1176131645_1176131674 18 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131674 20:63499007-63499029 TCTTCGGAAGACGGGGGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 132
1176131645_1176131670 15 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131670 20:63499004-63499026 CCCTCTTCGGAAGACGGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 73
1176131645_1176131653 -10 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131653 20:63498979-63499001 GCCCCCCAGGACCGGCCCCGGGG 0: 1
1: 0
2: 5
3: 28
4: 302
1176131645_1176131666 10 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131666 20:63498999-63499021 GGGGTCCCTCTTCGGAAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 61
1176131645_1176131661 2 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131661 20:63498991-63499013 CGGCCCCGGGGGTCCCTCTTCGG 0: 1
1: 0
2: 0
3: 4
4: 75
1176131645_1176131667 11 Left 1176131645 20:63498966-63498988 CCGGCCACCCTCTGCCCCCCAGG 0: 1
1: 0
2: 9
3: 142
4: 1280
Right 1176131667 20:63499000-63499022 GGGTCCCTCTTCGGAAGACGGGG 0: 1
1: 0
2: 0
3: 5
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176131645 Original CRISPR CCTGGGGGGCAGAGGGTGGC CGG (reversed) Intronic
900119096 1:1041017-1041039 CCTGGGGGGCGGAGCGGGGCGGG + Intronic
900119134 1:1041092-1041114 CCTGGGGGGCGGAGCGGGGCGGG + Intronic
900154400 1:1198216-1198238 GCTGAGGGGCACAGGGTGGTGGG - Intergenic
900203705 1:1422156-1422178 CCTGGGAGGCTGAAGGGGGCTGG - Intergenic
900226293 1:1535032-1535054 CCTGGGGGGCAGGTGGGGGCAGG - Intergenic
900365775 1:2311394-2311416 TCTGGGGGGCAGAGGATGGGCGG + Intergenic
900396614 1:2455633-2455655 CCTGGGGGTCAGGCGGGGGCAGG + Intronic
900477634 1:2883412-2883434 CCTGTGGGGCTGAGGCTGCCTGG + Intergenic
900479989 1:2893314-2893336 CCTGTGGGGCAGTGGGTGAGGGG + Intergenic
900560755 1:3304904-3304926 CCTGGGTGGCAGCGGAGGGCAGG - Intronic
900623132 1:3596499-3596521 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623151 1:3596543-3596565 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623170 1:3596587-3596609 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623188 1:3596631-3596653 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
901029214 1:6297112-6297134 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
901059693 1:6466220-6466242 CCTGGCGGGCGGGGGGAGGCGGG + Exonic
901088217 1:6625052-6625074 CCTGGGGAGACGCGGGTGGCTGG + Intronic
901207259 1:7504209-7504231 CCTGGGCAGCAGAGCCTGGCAGG - Intronic
901242201 1:7702052-7702074 CCTGTGGTGCAGTGAGTGGCAGG + Intronic
901254464 1:7809928-7809950 CCTGGGGAGCAGCGGGTCGCAGG + Exonic
901456839 1:9367933-9367955 CCTGGGGGTCCCAGGGTGGTGGG + Exonic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
901520875 1:9783915-9783937 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
901758527 1:11455914-11455936 CCTGGGGTGCCGAGGATGGCTGG + Intergenic
901775949 1:11560540-11560562 CAGGTGGGGCAGAGGGTGGGGGG + Intergenic
901870593 1:12136571-12136593 CCTGGGGGACAGAGGTTGCAGGG + Intronic
902241635 1:15094087-15094109 CCCGGGAGGCAGAGGGTGGTGGG - Intronic
902242170 1:15096423-15096445 CCTGGGAGGCAGAGGACGGTGGG - Intronic
902478913 1:16701597-16701619 TCTGGGAGGCAGAGGGGGCCGGG - Intergenic
902549315 1:17209960-17209982 CTTGGGGGGCAGAGGAGTGCAGG - Intronic
902669785 1:17965055-17965077 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
902771188 1:18646540-18646562 GCAGGCGGGCAGAGGGTGGGAGG + Intronic
902891075 1:19444080-19444102 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
902921015 1:19665819-19665841 CCCGGGGGGCAGCGGCTGGGTGG + Exonic
903034819 1:20486541-20486563 CCTGGGGGGCAGATGCTGCGGGG + Intergenic
903217349 1:21850563-21850585 CTTGGGGGTCAGAGTGAGGCAGG - Intronic
903397730 1:23014916-23014938 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
903541033 1:24096448-24096470 ACGGGTGGGCAGAGGGAGGCAGG + Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903939187 1:26917180-26917202 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904009590 1:27382263-27382285 CCTGGGGGGCAGGCTATGGCTGG + Intronic
904322511 1:29707008-29707030 CCTGGGGAGCCGAGCTTGGCTGG + Intergenic
904342516 1:29846032-29846054 CCTGCAGGGCTGACGGTGGCTGG - Intergenic
904438445 1:30514428-30514450 CCTAGGGGACAGAGTGAGGCTGG + Intergenic
904496542 1:30890229-30890251 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904525869 1:31133422-31133444 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
904624036 1:31792237-31792259 CCTGGTGGGCAGGGGCTGGAAGG + Exonic
904738231 1:32651343-32651365 CCAGGAGGGCAGTGGGTGCCTGG + Intronic
905343215 1:37293365-37293387 ACTGGGGAGGAGAGGGTGGTGGG - Intergenic
905419741 1:37832928-37832950 CCTGGGCGGCAGAGGTTGCAGGG + Intronic
905474523 1:38216690-38216712 CCTGTGGGGCAGTAGTTGGCAGG + Intergenic
905557436 1:38898226-38898248 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
905782369 1:40723458-40723480 TCTGTGGGGCAGAGGGGGTCTGG + Intronic
905890030 1:41513096-41513118 CCCAGGGGGCAGAGGGTGAGAGG + Exonic
905991963 1:42345594-42345616 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
906143511 1:43547092-43547114 CCTGGGGGCCTGGGGGTGGGAGG - Intronic
906204371 1:43979294-43979316 CCCGGGGGGCAGGGCGGGGCCGG - Intronic
906383029 1:45344877-45344899 CCTGAGGTGGAGAAGGTGGCTGG + Exonic
906438342 1:45816751-45816773 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
906662706 1:47593892-47593914 CCTGAAGGGCAGAGTTTGGCTGG - Intergenic
906982139 1:50642914-50642936 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
907267621 1:53272425-53272447 CCTGGGGGGCAGAGGGGGAGAGG - Intronic
907388401 1:54140505-54140527 CCTGGAGGGCAGAGAGTGTTTGG - Intronic
907455922 1:54575406-54575428 CCTTGGGGGTGGAGGGAGGCAGG + Intronic
908682863 1:66682099-66682121 CCTGGGGGGCCGAGAGGGCCTGG - Exonic
908697262 1:66857608-66857630 CCTGGGAGGCAGAGGTTGTGGGG - Intronic
908733084 1:67247378-67247400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
908981328 1:69962819-69962841 ACTGGAGGACAGAGGGTGGGAGG + Intronic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
909613043 1:77573193-77573215 CCCGGGAGGCAGAGGTTGCCAGG - Intronic
910568508 1:88674581-88674603 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
910572794 1:88724645-88724667 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
910806462 1:91193555-91193577 CCTGGGGGGTAGAGGAGGGGTGG - Intergenic
912220767 1:107672191-107672213 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
912404956 1:109429470-109429492 ACTGGAGGGCGGAGGGTGGCAGG - Intergenic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
912550955 1:110484988-110485010 CCGTGTGGGCAGAGAGTGGCTGG - Intergenic
912818921 1:112851257-112851279 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
912965865 1:114236882-114236904 CCTGGGAGGCAGAGGTTGAAGGG + Intergenic
913028677 1:114873972-114873994 TTTGGGAGGCAGAGGTTGGCAGG - Intronic
913247103 1:116879492-116879514 CCTGGTGGACTGAGTGTGGCGGG + Intergenic
913250740 1:116910336-116910358 CCTGGGGCGCCGAGGGTGCCCGG + Intronic
913253902 1:116937172-116937194 CCTTGGGAGCAGAGCATGGCTGG + Intronic
913285628 1:117224059-117224081 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
913505368 1:119512031-119512053 CCTGGGAGGCAAGGGGTGTCTGG - Intronic
913592482 1:120342118-120342140 CGTGGGGGGCCGAGGGTGCCGGG + Intergenic
913650868 1:120913012-120913034 CGTGGGGGGCCGAGGGTGCCGGG - Intergenic
914170245 1:145216055-145216077 CGTGGGGGGCCGAGGGTGCCGGG + Intergenic
914525362 1:148460021-148460043 CGTGGGGGGCCGAGGGTGCCGGG + Intergenic
914598312 1:149175809-149175831 CGTGGGGGGCCGAGGGTGCCGGG - Intergenic
914641039 1:149607107-149607129 CGTGGGGGGCCGAGGGTGCCGGG - Intergenic
914696182 1:150082428-150082450 CCTGGGAGGCGGAGGTTGGGAGG + Intronic
914726756 1:150334435-150334457 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
914893330 1:151648128-151648150 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
915249081 1:154575962-154575984 ACTGTGCAGCAGAGGGTGGCAGG - Exonic
915480756 1:156183207-156183229 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
916745260 1:167680275-167680297 CCTGGAGGGTAGATGCTGGCAGG + Intronic
916824364 1:168429953-168429975 TCTGAGGGGCAGAGGCTGCCTGG + Intergenic
917743587 1:177985641-177985663 CCTGGGGGGCTGAGGTTGAGAGG + Intergenic
917798359 1:178548320-178548342 CCTGGTGGGCAGAGGTTACCTGG + Intronic
917802190 1:178581048-178581070 TCTAGGGGTCAGAGGCTGGCAGG + Intergenic
917965503 1:180176083-180176105 CCTGGGAGTGAGAGGGTGGTGGG + Intronic
917970411 1:180202412-180202434 CGTGGTGGGCAGAGGTTCGCAGG - Exonic
917974432 1:180230012-180230034 CCGGCGGGGCGGAGGGGGGCGGG - Intergenic
918071940 1:181139649-181139671 CCTGCGGGGCATAAGGAGGCTGG + Intergenic
918139855 1:181711075-181711097 CCTGGGGGGCTGCAGGAGGCTGG + Intronic
918678546 1:187321879-187321901 CCTGGGAGGCTGAGTGAGGCAGG - Intergenic
919075621 1:192809205-192809227 AGTGTGGGGCAGGGGGTGGCGGG - Intronic
919153075 1:193724769-193724791 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
919221643 1:194638277-194638299 CCTGGAAGGCGGAGGGTGGGAGG - Intergenic
919451161 1:197775019-197775041 CCCGGGCGGCCGAGGTTGGCCGG - Intronic
919608431 1:199715290-199715312 ACTGGGGGGTGGAGGGTGGAAGG + Intergenic
919796525 1:201324552-201324574 TCTGTGCAGCAGAGGGTGGCGGG - Exonic
919860520 1:201736919-201736941 CCTGGGGTGCAGGGAGTGGGGGG - Intronic
919893691 1:201994740-201994762 CCTGGGTGGCAGAGGTTGCGGGG - Intronic
920007574 1:202844688-202844710 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
920208540 1:204311413-204311435 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
920320456 1:205117883-205117905 CCTGTGAGGCAGAGGTTGGAGGG - Intronic
920537924 1:206752413-206752435 CCTGGAGGGTGGAGGGTGGGAGG - Intergenic
920764784 1:208821786-208821808 CCTGGGGGGTTGGGGGTGGGGGG - Intergenic
921649832 1:217664363-217664385 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
921952908 1:220950547-220950569 CCTGGGAGGCTGAGTGAGGCAGG + Intergenic
922204187 1:223432244-223432266 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
922213224 1:223501039-223501061 TCTGGGGGTGAGAGGGTGGTGGG - Intergenic
922239249 1:223744783-223744805 CCTGGGAGGCAGAGGTTGGGAGG + Intronic
922344493 1:224684946-224684968 CCAGGGAGGCAAATGGTGGCAGG + Intronic
922474777 1:225899335-225899357 CCTGGAGGGCAGCAGGGGGCAGG - Intronic
922696559 1:227733832-227733854 ACTGGGAGGCCCAGGGTGGCAGG - Intronic
923013031 1:230104185-230104207 GGTGGGGGGCCGAGGGAGGCAGG + Intronic
923160779 1:231312797-231312819 CCTGGAGGGCTGATGGTAGCCGG + Intergenic
923506522 1:234609928-234609950 CCGGGGGGGCAGGGGGCGGGGGG + Intergenic
923677230 1:236090477-236090499 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
923691470 1:236197744-236197766 CCTGGGTGACAGAGTGAGGCAGG - Intronic
923739930 1:236645910-236645932 CCTGGGGTGCAGCAGGTGACTGG + Intergenic
923967525 1:239157874-239157896 CCAGGGAAGCAGAGGTTGGCTGG + Intergenic
924300358 1:242631850-242631872 CCTGGGGGACAGAGGTTGCAGGG - Intergenic
924500157 1:244629974-244629996 CCTGGAGGGCAGGAGGTAGCAGG - Intronic
924765858 1:247031807-247031829 CTTGGGAGGCTGAGGCTGGCGGG - Intergenic
1062772505 10:114029-114051 CCTGGGAGGCAGAGGTTGCAAGG + Intergenic
1062871020 10:904476-904498 CCTGGGGGGCGGAGGGTTGGGGG + Intronic
1063097050 10:2917588-2917610 CCTGGGTGACAGGGGGTGGGGGG + Intergenic
1063308804 10:4933611-4933633 CCTGGTAGGCAGTGGGTGCCTGG - Intronic
1063400333 10:5737542-5737564 CCTGAAGGGCAGAGGTTGCCTGG - Intronic
1063450213 10:6145624-6145646 CCCGGGGGTCAGAGGGCGGGAGG - Intronic
1063606351 10:7526274-7526296 GCAGCGGGGCTGAGGGTGGCGGG - Intergenic
1063609987 10:7553908-7553930 CTTGGGGGGCAGAGGTGGGTTGG - Intergenic
1063773265 10:9228919-9228941 CCTGGAGGGAAGAGAGTGGGTGG - Intergenic
1064147406 10:12836480-12836502 CCTTGGGGGCAGAGAGAGTCAGG - Intergenic
1064764498 10:18657687-18657709 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1064906623 10:20353505-20353527 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065181567 10:23131343-23131365 GTTGGAGGGCAGAGGGTGGAAGG + Intergenic
1065387253 10:25146112-25146134 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1065516224 10:26527050-26527072 CTTGGTGGGCTGAGGGAGGCTGG - Intronic
1065885331 10:30071700-30071722 CCTGGGGGGCGGAGGTTGCAAGG + Intronic
1066084374 10:31962243-31962265 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1066202861 10:33158873-33158895 ACTCGGGGGGAGAGGGTGGGAGG + Intergenic
1066559885 10:36658686-36658708 CCTGGGAGGCAGAGGTTGCGGGG + Intergenic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1066665679 10:37780734-37780756 CCTGTGAGTCGGAGGGTGGCCGG - Intronic
1067097574 10:43312544-43312566 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1067396451 10:45924512-45924534 CTTGGGAGGCTGAGGGTGACAGG - Intergenic
1067415362 10:46098087-46098109 CCCGGGGTGCAGGGGCTGGCAGG - Intergenic
1067435404 10:46273164-46273186 CCTGGGGTGCAGGGGCTGGCAGG - Intergenic
1067524219 10:47028564-47028586 CCTGGAGGTCAGAGGTGGGCAGG - Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067582201 10:47452854-47452876 CCTTGGGTGCAGGGGCTGGCGGG - Intergenic
1067864773 10:49893620-49893642 CTTGGGAGGCTGAGGGTGACAGG - Intronic
1067945292 10:50685112-50685134 CCTGGGGAGGAGAGGTTGGCCGG - Intergenic
1068009168 10:51426203-51426225 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1068025479 10:51637761-51637783 CCTGTTGGGCAGGGGGTGGAAGG + Intronic
1068427921 10:56891740-56891762 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1069086892 10:64151117-64151139 GCTGGTGGGCAGAGGGTGTAGGG - Intergenic
1069444332 10:68458770-68458792 CCTGGGAGGCGGAGGTTGCCGGG + Intronic
1069477816 10:68751101-68751123 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1069607293 10:69747711-69747733 CCAGGGGTGCAAGGGGTGGCCGG + Intergenic
1069861728 10:71475778-71475800 CCTGAGGGGCGGAGGCTGGAAGG + Intronic
1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG + Intronic
1069905243 10:71728417-71728439 TCTGGGGTGGGGAGGGTGGCAGG - Intronic
1069908519 10:71746339-71746361 CCTGGGGGGACGAGGGTCTCAGG - Intronic
1070004454 10:72409613-72409635 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1070055130 10:72927213-72927235 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1070350187 10:75584147-75584169 TATGGGGAGCAGGGGGTGGCAGG - Intronic
1070461408 10:76674102-76674124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1070736733 10:78868122-78868144 ACTGGGGCACAGAGAGTGGCTGG - Intergenic
1070795665 10:79214964-79214986 CCTGGGGGGCAGTGTGGGACGGG - Intronic
1070880592 10:79850105-79850127 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071294118 10:84206870-84206892 CCTGTGGGGCTGAGGGTAGGTGG + Intronic
1071367985 10:84920361-84920383 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1071548556 10:86547740-86547762 CTAGGGAGGCTGAGGGTGGCAGG + Intergenic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1071633714 10:87234207-87234229 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071647162 10:87366423-87366445 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071820225 10:89272243-89272265 ACTGGAGGGCAGGGGGTGGGAGG - Intronic
1071974343 10:90939998-90940020 CCTGTGGAGCAGAGGTGGGCGGG + Intergenic
1072125196 10:92439384-92439406 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1072226326 10:93373265-93373287 GCTGGGAGGCAGACTGTGGCTGG + Intronic
1072803892 10:98412083-98412105 CATGGGGAACAGAGGGTGCCAGG + Intronic
1072808979 10:98445259-98445281 CCTGGGGAGGACAGGGAGGCAGG - Intronic
1073026357 10:100489889-100489911 CCTGTTGGGTGGAGGGTGGCTGG - Intronic
1073078298 10:100838490-100838512 CCTGAGGGACAGAGGGGGACAGG + Intergenic
1073189271 10:101639181-101639203 CCTGAGGGGCAGAGAGAGACTGG - Intronic
1073206255 10:101770937-101770959 CCTGGGGGGGTGAGAGGGGCAGG - Intronic
1073249840 10:102114665-102114687 CCTGGGGGGCGGGGGGCCGCGGG + Intronic
1073301396 10:102473171-102473193 CATGGGGGGCAGGGTGTGGTGGG + Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074318568 10:112380450-112380472 GTTGGGGGGCGGGGGGTGGCAGG - Intronic
1074370978 10:112900646-112900668 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074578208 10:114690755-114690777 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074866828 10:117549063-117549085 ACGGGGGGGCTGGGGGTGGCGGG + Exonic
1074884902 10:117685780-117685802 GTTGGGGGACAGAGGCTGGCAGG + Intergenic
1075535073 10:123264187-123264209 CCAGGGAGGCTGAGGGGGGCAGG + Intergenic
1075767708 10:124907473-124907495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1075794173 10:125107049-125107071 CTTGGGGGGTGGAGGGAGGCTGG + Intronic
1075982245 10:126750071-126750093 CCTGGGGGGAAGAGTGAGGGGGG - Intergenic
1076230338 10:128815034-128815056 GCTGGGGGGTAGGGGGTGGGGGG + Intergenic
1076258903 10:129050455-129050477 CCTGTGGGGTAGAGCCTGGCTGG + Intergenic
1076284720 10:129282235-129282257 ACTGGGGGGCAGGGTGGGGCGGG + Intergenic
1076352425 10:129826152-129826174 CCTGGGGAGCAGGTGGTGGTGGG + Intergenic
1076425666 10:130365862-130365884 CCTGTCGGGCAGAGGGGGGTGGG - Intergenic
1076500997 10:130936021-130936043 CCTGGGGGCCTGAGGATGGAGGG + Intergenic
1076502696 10:130949704-130949726 GGTGCGGGGCAGAGGGAGGCTGG - Intergenic
1076540314 10:131210332-131210354 CCCTGGGGGCAGAGGGTTGGGGG - Intronic
1076570922 10:131432397-131432419 GCTGGGAGGCAGCGGGTGTCGGG + Intergenic
1076653919 10:132008621-132008643 CCTGGGAGGCAGAGGTTGTGGGG + Intergenic
1076740063 10:132478518-132478540 CCCAGAGGGCAGAGGGTGCCGGG - Intergenic
1076830535 10:132992224-132992246 CCTCGAGGACAGAGGGTGGACGG + Intergenic
1076856188 10:133116545-133116567 GCTGGGGGGCAGCTGGTGGGCGG - Intronic
1076888167 10:133272003-133272025 CCTGGTGGGGTGAGGGTGGCAGG - Intronic
1076921273 10:133455916-133455938 CTTGGGAGGCAGAGAGTGGGTGG + Intergenic
1077017891 11:404979-405001 CCTCAGGGGCAGGGGGTGCCTGG - Intergenic
1077066891 11:645085-645107 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1077105220 11:839235-839257 GCTGGGGGCCAGAGGGTAGGAGG + Intronic
1077143805 11:1036097-1036119 CGTGGGGGGAAGAGGGGGGAAGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077182909 11:1224465-1224487 CCTGGGGGGGAGGGGTTGCCTGG + Intronic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077227087 11:1443165-1443187 TCTGTGGGGCCCAGGGTGGCGGG + Intronic
1077254249 11:1573325-1573347 CCTGGGGGGCCCAGGCTGGCTGG - Intergenic
1077296168 11:1827210-1827232 CCTGGAGAGCAGGGGGTGTCGGG - Intergenic
1077333495 11:1993531-1993553 CCAGGGGTGCCCAGGGTGGCGGG - Intergenic
1077365823 11:2161199-2161221 CCTGGAGGGCTGAGGGCTGCTGG + Exonic
1077370574 11:2179882-2179904 CCTCAGGAGCACAGGGTGGCAGG - Intergenic
1077393066 11:2308715-2308737 CCCTGGGGGCAGAGCGGGGCTGG - Exonic
1077459562 11:2702037-2702059 CCTGGGGGCCACAGTGAGGCTGG - Intronic
1077539676 11:3140640-3140662 GCTGGGGGACAGAGGGGAGCCGG - Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1078133182 11:8630308-8630330 CCTGGGGTCTAGAGGGTGGGTGG - Intronic
1078201093 11:9183973-9183995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1079728451 11:23907609-23907631 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1080488625 11:32737540-32737562 TCTGGGAGGCAGAGGTTGCCTGG + Intronic
1081088799 11:38835560-38835582 CCCGGAGGGCAGAGGGTGAGAGG + Intergenic
1081640906 11:44753514-44753536 CCTGGGGGTCCCAGGGTAGCTGG + Intronic
1081669386 11:44934747-44934769 CCAGGGAGGCAGGGGGTGGGGGG - Exonic
1081786365 11:45750562-45750584 CCAGGGGAGCAGAGCGTGGGGGG + Intergenic
1081911726 11:46704363-46704385 CCTGGATGCCAGAGGGTGACTGG - Exonic
1081947435 11:47009719-47009741 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1082783284 11:57302782-57302804 CCTGGGAGCCGGAGGGTGGGGGG + Exonic
1082806351 11:57454128-57454150 CCTTGGGGGCAGAGGTTGCCCGG - Intergenic
1083276039 11:61597696-61597718 AATGGGGGGCAGAGGGTGGGAGG - Intergenic
1083297451 11:61722695-61722717 CCTGGGAGGCGGGGGGTGGGGGG + Intronic
1083299455 11:61732721-61732743 CCTGTGGGGCAGAGAGAGGCAGG + Intronic
1083673894 11:64314979-64315001 CCTAGGGGGCAGCGGGGAGCGGG - Exonic
1083816827 11:65137547-65137569 CCTGAAGGGCAGAGTGTGGGAGG - Intergenic
1084153644 11:67302646-67302668 CCTGAGGGGCGGAGGGTGGGGGG - Intergenic
1084222138 11:67688866-67688888 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1084358358 11:68653844-68653866 CCTGGGCGGCTGGGAGTGGCTGG + Intergenic
1084379133 11:68799645-68799667 CCTGGGGGGCTGAGGTTGGGAGG + Intronic
1084551583 11:69846445-69846467 CATGGGGGCCAGAGGCTGGGAGG + Intergenic
1084556464 11:69879036-69879058 CCTGGGGGCCAAAGGGGGTCAGG + Intergenic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1084934060 11:72577604-72577626 CATGGGGGGCAGAGGGCGAGAGG + Intronic
1084954193 11:72682915-72682937 GCTGGGGGGCAGAGGGGAGAGGG - Intergenic
1085342580 11:75743046-75743068 GCTGGAGGGTAGAGAGTGGCTGG - Intergenic
1085349621 11:75790166-75790188 CCTGGGGGGCAGATGGCCACAGG - Exonic
1085359350 11:75872462-75872484 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1085820377 11:79786689-79786711 GATGGGCGGCAGAGGGTGGAGGG + Intergenic
1086381329 11:86258092-86258114 ACTGGAGGGTAGAGGGTGGGAGG - Intronic
1086455679 11:86956356-86956378 CCTGGTGGGGAGGGGGTGCCCGG - Intergenic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1087484789 11:98747888-98747910 ACTGAGGGCCAGAGGGTAGCTGG + Intergenic
1087774526 11:102245213-102245235 CCTGGGGGACAGAGGCTCTCTGG - Intergenic
1087940156 11:104087099-104087121 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088831929 11:113544162-113544184 CCTGGGGTGATGAGGGTGGGTGG + Intergenic
1088870449 11:113886193-113886215 CGGGGGGGGCAGGGGGTGGGGGG - Intergenic
1088935057 11:114391094-114391116 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1089064758 11:115654085-115654107 CCTGGGCGGCCGAGGCTGGGTGG - Intergenic
1089230232 11:116967819-116967841 CCTGATGGGCACAGGGAGGCTGG - Intronic
1089381599 11:118036675-118036697 CCATGGGGGCAGAGGGTAGCAGG + Intergenic
1089431986 11:118432903-118432925 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1089528730 11:119113202-119113224 GCTGGAGGGCTGAGGGTAGCAGG - Intronic
1089642952 11:119859620-119859642 CCTGGGGTGCTGAGGCTGGCTGG + Intergenic
1089713606 11:120336106-120336128 CCTACGGGGCAGAGGGAGGTGGG - Intergenic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090346407 11:126075192-126075214 CCTGGGGGCCAGAGAGAGGCTGG + Intergenic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1090444537 11:126752633-126752655 CTTGGGAGGCAGTGGGTGGGGGG - Intronic
1090591430 11:128274356-128274378 ACTGGAGGGTAGAGGGTGGGAGG - Intergenic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1202816475 11_KI270721v1_random:48713-48735 CCAGGGGTGCCCAGGGTGGCGGG - Intergenic
1091450266 12:568537-568559 CCTGCGGGGCACAGGCTGCCAGG - Intronic
1091574451 12:1720334-1720356 ACTGGTGGGCAGGGGGTGGAGGG + Intronic
1091750710 12:3019800-3019822 CCTGGGGGACAGAAGGCAGCAGG - Intronic
1091776527 12:3188463-3188485 CCTGGGTGGCAGAGGAAGGGAGG + Intronic
1093090611 12:14916015-14916037 CTTGGGGGGTGGAGGGTGGGAGG + Intronic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093166212 12:15806812-15806834 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093180955 12:15966386-15966408 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093963382 12:25300558-25300580 ACTGGGGAGAAGAGGGTGGGGGG - Intergenic
1094110796 12:26860155-26860177 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1094399613 12:30047851-30047873 ACTGGGGGAGAGAGGGTGGTTGG - Intergenic
1094486109 12:30926923-30926945 CCGGGCGGGCAGAGGGAAGCCGG + Intronic
1095311455 12:40702518-40702540 CCTGGGAGGCAGAGGTTGCGGGG - Intronic
1096148376 12:49294415-49294437 CATAGGGGGCTGAGGGTGGCTGG - Exonic
1096275890 12:50207812-50207834 CCAGGGGGGCAGAGGTTGCAGGG + Intronic
1096751093 12:53759276-53759298 CCTGCTGGGTAGAGGGTGGGAGG - Intergenic
1096983631 12:55743161-55743183 CCCGGGGGGCCGGGGGCGGCGGG - Intergenic
1097053924 12:56239044-56239066 TTGGGAGGGCAGAGGGTGGCGGG - Exonic
1097078120 12:56410173-56410195 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1097265179 12:57740203-57740225 GGTGGGGGGCTGAGGGTGGGGGG + Intronic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1098966626 12:76797185-76797207 CCTGGGAGGCAGAGGTTGTAGGG + Intronic
1099127193 12:78777053-78777075 CCTGAAGGCCAGAGGCTGGCTGG + Intergenic
1099603229 12:84768295-84768317 ACTGGAGGGCGGAGGGTGGGAGG - Intergenic
1100836467 12:98571474-98571496 CCTGGGAGGCAGAGGCTGTGTGG - Intergenic
1101050367 12:100856786-100856808 CATGTGAGGCAGAGAGTGGCAGG + Intronic
1101120958 12:101579690-101579712 CCTGGGAGGCAGAGGTTGTGGGG - Intronic
1101467236 12:104960456-104960478 CCTGGGAGGGAGAGGTGGGCGGG + Intergenic
1101598756 12:106190090-106190112 CATAGAGGCCAGAGGGTGGCTGG + Intergenic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1101903693 12:108810073-108810095 CCTGTGGGACAGGAGGTGGCAGG - Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102500617 12:113349739-113349761 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1102934716 12:116886746-116886768 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1103044339 12:117722972-117722994 CCTGAGGGCCAGTGGATGGCAGG + Intronic
1103450626 12:121026104-121026126 CCTGGGAGGCAGAGGGGAGCCGG + Intronic
1103495243 12:121357054-121357076 CTTGGGAGGCCGAGGGTGGGAGG + Intronic
1103609493 12:122114061-122114083 CCTGGGAGGCAGAGGTTGCGCGG - Intronic
1103724358 12:122990399-122990421 CCTGGTGGGTAGAGGGAGGGAGG - Intronic
1103908016 12:124337112-124337134 CCCAGTGGGCAGTGGGTGGCAGG + Exonic
1104051143 12:125194671-125194693 CCTGGCGAGCAGAGGGGGCCAGG + Intronic
1104198783 12:126567310-126567332 ACTGTGGGGCAGGGGGTGGGTGG - Intergenic
1104239582 12:126975000-126975022 CCAGAAGGTCAGAGGGTGGCAGG - Intergenic
1104252956 12:127113311-127113333 GCTGGGAGGCAGAAGGAGGCTGG + Intergenic
1104595410 12:130117026-130117048 CCAGCAGGGCAGAGGGTGGGCGG + Intergenic
1104720547 12:131042990-131043012 CCAGGAGGGCACAGGTTGGCAGG - Intronic
1104825561 12:131706260-131706282 CCTGGGAGGCTGAGGTTGCCAGG + Intergenic
1104940374 12:132392183-132392205 CCTGGGGAGAACGGGGTGGCCGG - Intergenic
1104961522 12:132490429-132490451 CCTGGGCGGCGGCGGGCGGCGGG - Exonic
1104974999 12:132548349-132548371 CCTGGGCAGCAGAGGGCAGCTGG + Intronic
1104997830 12:132669812-132669834 CCTGTTGGGCGGAGGGTGGCTGG - Intronic
1105429574 13:20324875-20324897 TCTGGGAGGCAGAGGTTTGCAGG + Intergenic
1105501259 13:20974831-20974853 CCTGGGAGGCAGCGAGTGGTGGG + Exonic
1105830502 13:24160203-24160225 CCTGGGGGGTGGGGGCTGGCTGG + Intronic
1106040859 13:26091488-26091510 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1106413334 13:29525944-29525966 CCAGGGTGGGAGTGGGTGGCCGG - Intronic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107466908 13:40659237-40659259 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1107485838 13:40826873-40826895 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107549965 13:41464945-41464967 CCTGGGCAGGAGAGGGTGGGGGG + Intronic
1107697853 13:43018261-43018283 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107718323 13:43222302-43222324 GCTGGCGGGGAGGGGGTGGCGGG - Intronic
1107887198 13:44883387-44883409 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1108228589 13:48316258-48316280 CCAGGGGGGCGGTGGGGGGCGGG + Intronic
1108524934 13:51278558-51278580 CCTGGGTGGCAGCAGGAGGCAGG - Intronic
1108642525 13:52395923-52395945 ACTTGGGTGCAGTGGGTGGCTGG + Intronic
1108807806 13:54181413-54181435 ACTTGTGGGCAGAGGGTGGGAGG - Intergenic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109308052 13:60662169-60662191 GCTGGGGGGGTGGGGGTGGCAGG - Intergenic
1110279460 13:73675937-73675959 ACAGAGGGGCAGAGAGTGGCAGG + Intergenic
1110482089 13:75990544-75990566 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1110727642 13:78843752-78843774 CGTGGGTGGCAGGGGGTGGCGGG - Intergenic
1110825731 13:79969603-79969625 ACTGGAGGGCGGAGGGTGGGAGG - Intergenic
1110870930 13:80451970-80451992 CCTGGGTCCCAGAGGGTGGAGGG - Intergenic
1111260906 13:85738449-85738471 ACTGGAGGGGAGAGGGTGGGAGG + Intergenic
1111450858 13:88413385-88413407 ACTGGAGGGCAGAGGGTGGGAGG + Intergenic
1111535736 13:89600179-89600201 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
1112150978 13:96763413-96763435 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1112621910 13:101061909-101061931 CCTGCGGGGCAGGGCGGGGCGGG + Intronic
1112720673 13:102240995-102241017 TCAGGGTGGCAGAGGGTGGGGGG + Intronic
1112746369 13:102531647-102531669 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
1113106279 13:106775054-106775076 CCTGGGAGGAAGAGAGTGGGAGG - Intergenic
1113486087 13:110653173-110653195 CCTGGGGTGGGGAGGGGGGCTGG + Intronic
1113786960 13:113006961-113006983 CCCTTGGGGGAGAGGGTGGCAGG + Intronic
1113814469 13:113161743-113161765 ACGGGGGGGCAGGGGGTGGCAGG - Intronic
1114520635 14:23332667-23332689 CCTGGGGGGCAGAGCTTGCAGGG - Intergenic
1114523365 14:23352454-23352476 GTTGGGGGGCAGGGGGTGGCAGG + Intronic
1114610062 14:24034240-24034262 ACTGAGGGGCTGAGGGTTGCAGG - Intergenic
1114641093 14:24221671-24221693 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1115456933 14:33614483-33614505 CCTGGAGAGGTGAGGGTGGCAGG + Intronic
1115464737 14:33702702-33702724 CCTGAAGGGGAGAGGGTGGGAGG + Intronic
1115653860 14:35424108-35424130 ATCCGGGGGCAGAGGGTGGCGGG - Intergenic
1116237539 14:42298038-42298060 CCTGGAAGGCAGAGTGTTGCAGG - Intergenic
1117459378 14:55929895-55929917 ACGGGGGGGCAGGGGGTGGGGGG - Intergenic
1117726744 14:58682240-58682262 CCTGGGGAGCAAAGGGAGGGAGG - Intergenic
1117948122 14:61053032-61053054 GCTGGTGGGTAGAGGGTGGGAGG - Intronic
1118528107 14:66668954-66668976 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1118900213 14:69980062-69980084 AGTGGGGGGGTGAGGGTGGCTGG + Intronic
1119003903 14:70907521-70907543 GCTGGCGGGCCGCGGGTGGCGGG + Exonic
1119556360 14:75556330-75556352 GCTGGGGGACAGAGGGTGCAAGG - Intergenic
1119702221 14:76762825-76762847 CCAGGGGGGAAGAAGGTGGCTGG + Exonic
1120230146 14:81833129-81833151 TCTGGTGGGCAGATGGTGGGAGG - Intergenic
1120356671 14:83442852-83442874 CCTGAGGGGCACATGGAGGCTGG + Intergenic
1120788084 14:88554916-88554938 CCGTGGGGGCGGGGGGTGGCAGG + Intergenic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121347897 14:93149665-93149687 CCTGCCGGGGTGAGGGTGGCGGG - Intergenic
1121777200 14:96598544-96598566 CATGAGGGGCTGTGGGTGGCGGG - Intergenic
1122299153 14:100722322-100722344 ACCTGGGGGCAGAGGGTGGAGGG - Intergenic
1122548676 14:102538713-102538735 GCTGGGGGGCAGAGTGTGGCAGG - Intergenic
1122568947 14:102680727-102680749 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122710673 14:103655149-103655171 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122804211 14:104248421-104248443 CTTGGGGGTCAGACAGTGGCAGG + Intergenic
1122970309 14:105149779-105149801 CGTGGGCGGCCGAGGGTGGTAGG + Intronic
1123024966 14:105420133-105420155 CCTGCGGGGCAGAGGGGCGGGGG - Intronic
1123062971 14:105602468-105602490 CCCGGTGGGCAGAGCGGGGCTGG - Intergenic
1123465364 15:20510973-20510995 CCTGGGTGGCAGAGGTTGCAGGG + Intergenic
1123652752 15:22490058-22490080 CCTGGGTGGCAGAGGTTGCAGGG - Intergenic
1123677320 15:22723519-22723541 ACTGGGGGGCAGGGGGTGCTGGG - Intergenic
1124006626 15:25800057-25800079 CCTGGGGGCCAGGGTGAGGCAGG + Intronic
1124083264 15:26520443-26520465 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1124237671 15:28004010-28004032 CCTGGGTGGCAGCGGCTGGACGG - Intronic
1124329532 15:28797788-28797810 ACTGGGGGGCAGGGGGTGCTGGG - Intergenic
1124681566 15:31736056-31736078 ACTGGAGGGCAGAGGGTGGGAGG + Intronic
1124688701 15:31804016-31804038 CCAGGGGAGCAGAGGATGACAGG + Intronic
1124807406 15:32899435-32899457 CATGGGGGGCAGGGGGGTGCAGG - Intronic
1124818885 15:33022936-33022958 TTTGGGTGGCAGAGGGTGGGAGG + Intronic
1124930241 15:34112665-34112687 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1125442371 15:39716888-39716910 CCCGGGAGGCAGAGGTTGCCGGG - Intronic
1125443608 15:39729882-39729904 ACTTGAGGGCAGAGGGTGGTAGG + Intronic
1125447850 15:39776999-39777021 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1125532547 15:40423045-40423067 ACTGGGGGGCTGGGGGTGGGTGG - Intronic
1125563444 15:40656858-40656880 CCTGGGTGACAGAGGGAGACAGG + Intronic
1125570144 15:40710424-40710446 CCCGGGGGGCAGAGGTTGCAGGG + Intronic
1125649813 15:41307381-41307403 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
1125652020 15:41325160-41325182 TCTGGGAGGCCGAGGGAGGCAGG + Intronic
1125925295 15:43558301-43558323 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1126283403 15:46983866-46983888 ACTTGAGGGCAGAGGGTGGAAGG - Intergenic
1126876378 15:53045945-53045967 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1126999359 15:54483695-54483717 CCTGGGAGGCAGAGGCAGACGGG - Intronic
1127169875 15:56290210-56290232 GTTGGGGGGCAGAGGGGTGCAGG + Intronic
1127246149 15:57177343-57177365 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127436711 15:58964984-58965006 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1127578021 15:60311631-60311653 CCTGTTGGGCAGAGCGGGGCTGG + Intergenic
1127672859 15:61212473-61212495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127674795 15:61228885-61228907 TCTGGGGGGCGGAGGGGGGAGGG + Intronic
1128086326 15:64888999-64889021 CCTGGGGGTCAGGGGGTGGGGGG + Intronic
1128145053 15:65328413-65328435 CCTGGGGGGCAGTGGGGCGGTGG - Exonic
1128237925 15:66080136-66080158 CCTGGGGGGCTGTGGGCCGCAGG - Intronic
1128423755 15:67519744-67519766 CTTGGGAGGCTGAGGGTGGGAGG + Intergenic
1128547898 15:68579719-68579741 CATGGGCGGCAGAGGCTGGCAGG - Intronic
1129190037 15:73931760-73931782 CCTGGAGGGCAGAGGTGGGCAGG - Intronic
1129301404 15:74627744-74627766 CCTGGGTGGCAGAGAATGACAGG - Intronic
1129333669 15:74840185-74840207 ACTGGGGGGCAGAGGGAGTCAGG - Intronic
1129510963 15:76122119-76122141 CCTGGAGGGCAGCTGTTGGCTGG + Intronic
1129607919 15:77033777-77033799 CCTGGGAGGCAGAGGCTCGTGGG + Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129875540 15:78973216-78973238 CTTGGGGGGCAGAGTGTGGGTGG + Intronic
1130001471 15:80050971-80050993 CCTGGGAGGCTGAGGTTGGAGGG + Intergenic
1130028840 15:80294100-80294122 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
1130040369 15:80401226-80401248 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
1130088966 15:80803219-80803241 CCTTGGGGCCACAGGATGGCTGG + Intronic
1130101793 15:80900073-80900095 CCTGGGGTGCAGATGGGGACTGG - Intronic
1130109936 15:80955694-80955716 CCTGGGGGGCGGAGGTTGCAGGG - Intronic
1130165687 15:81455623-81455645 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130222653 15:82033651-82033673 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130348640 15:83070906-83070928 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1130878279 15:88032806-88032828 CCTGGGGAGGGGAGGGTGGTTGG - Intronic
1130972287 15:88742285-88742307 CCTGGGGGCCATAGGGAGACTGG - Intergenic
1131062295 15:89411428-89411450 CGCGGGGGGAAGGGGGTGGCGGG + Intergenic
1131366732 15:91847810-91847832 CCTGAGGGGTAGTGGGTGCCAGG - Intergenic
1131383810 15:91986107-91986129 CCTGGTGGGCAGAGGCTGAGTGG + Intronic
1131531281 15:93194816-93194838 CCTGGAGGGTGGAGGGTGGGAGG - Intergenic
1131892336 15:96985470-96985492 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1132040754 15:98523053-98523075 CCTGGGGGGCTGAGGAGGGAGGG - Intergenic
1132158002 15:99509885-99509907 CCTGGGGGTGGGAGGGTGGTGGG + Intergenic
1132567644 16:630707-630729 CCTGGGGTCCAGAGGGCGCCAGG + Intronic
1132657346 16:1046805-1046827 GCCGGCGGGCAGCGGGTGGCGGG + Intergenic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1132682846 16:1150687-1150709 TCTGGAGGACAGAGTGTGGCCGG + Intergenic
1132750330 16:1454685-1454707 CCCCGGGTGCTGAGGGTGGCAGG - Intronic
1132786753 16:1661294-1661316 CCTGGGTGACAGAGGGGGCCGGG + Intronic
1132852569 16:2031372-2031394 CCTGGGGGAGGGAAGGTGGCTGG - Intronic
1133027567 16:2995380-2995402 CCTGGGGGACAGATGGAGGTGGG - Intergenic
1133042433 16:3067750-3067772 CCTGGGTGGCAGTGAGTGGGCGG + Intronic
1133081540 16:3325055-3325077 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133227069 16:4346123-4346145 GCTGCAGGGCAGAGGGGGGCTGG + Intronic
1133237186 16:4392781-4392803 CCTGGGCGGAAGTGGGGGGCAGG + Intronic
1133336580 16:5010565-5010587 CCCGGTGGGGAGAGGGTGGAGGG + Intronic
1133566744 16:7002634-7002656 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1133607948 16:7406453-7406475 CCTGTGGCCCAGAGGGTGGATGG + Intronic
1133792755 16:9021952-9021974 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133806924 16:9132760-9132782 CCTGGGAGGCAGAGGTTGCTGGG + Intergenic
1133856686 16:9556306-9556328 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134656244 16:15949996-15950018 CCTGCGGAGCAGAGCGTGGGGGG + Intronic
1134752815 16:16639721-16639743 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134993243 16:18719355-18719377 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1135032891 16:19052786-19052808 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1135035468 16:19073231-19073253 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1135289089 16:21219196-21219218 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1135335908 16:21600226-21600248 CTTTGGGGCCAGAGCGTGGCTGG + Intronic
1135481835 16:22827170-22827192 CCCTGAGGACAGAGGGTGGCTGG + Intronic
1135609656 16:23855144-23855166 CCGGCGGGGGAGGGGGTGGCAGG + Intronic
1135989883 16:27211752-27211774 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1136229560 16:28878471-28878493 GCTGGGGGCCGGGGGGTGGCCGG + Exonic
1136314695 16:29446208-29446230 CCTGGGGGGCTGAGGTGGGAGGG + Intronic
1136442822 16:30287967-30287989 CCTGGGGGGCTGAGGTGGGAGGG + Intergenic
1136512641 16:30748617-30748639 CCTGGGGGCGGGAGGATGGCAGG - Intronic
1136583847 16:31170997-31171019 CTTGGGGGGCAGAGTTGGGCGGG + Intergenic
1137555828 16:49469763-49469785 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1137759306 16:50927681-50927703 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1138418673 16:56885731-56885753 TCTGGTGGGAAGAGGATGGCAGG - Intronic
1138536731 16:57664165-57664187 ACTGGGGGGCTGAGGGAGGGAGG - Exonic
1139174178 16:64667332-64667354 TCTGGGGGGCTGAGGTTGGGAGG + Intergenic
1139532399 16:67548842-67548864 CCTGTGAGGCAGAGGGGGTCAGG - Intergenic
1139559085 16:67730318-67730340 CCTGCGGGGCACATGGTGCCAGG + Intronic
1139601496 16:67990189-67990211 CCAGGGATCCAGAGGGTGGCAGG - Intronic
1139765773 16:69228428-69228450 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1139910696 16:70395614-70395636 CCTGGGGCTCAGGGAGTGGCTGG - Intronic
1139953863 16:70684364-70684386 CATGAGGGGCAGGGGGTGGGGGG + Intronic
1140421777 16:74825131-74825153 TCTGGGAGGCTGAGGGTGGGAGG - Intergenic
1140470016 16:75208663-75208685 CCTGGTGGGCACTGGCTGGCAGG - Intergenic
1140755238 16:78060637-78060659 CCTGGGAGGCAGAGGTTGTATGG - Intronic
1140775249 16:78243509-78243531 ACTGGAGGGTAGAGGGTGGAAGG - Intronic
1141088871 16:81116516-81116538 CCTGGGTGACAGAGGGAGACTGG - Intergenic
1141205241 16:81928356-81928378 CCTGGCGGGGAGAGGGTGCCAGG - Intronic
1141236242 16:82219952-82219974 CCAAGGGGTCAGAGGGTGGGTGG + Intergenic
1141289276 16:82702785-82702807 CCTGGGGGCCACAGGGTTCCAGG - Intronic
1141524987 16:84605235-84605257 GCTGGGGTGCAGGGGGTGTCAGG + Intronic
1141586870 16:85039908-85039930 CCTGGGAGGCGGAGGGTGTAGGG - Intronic
1141623220 16:85248070-85248092 CCTGTGGGGCTGAGAGTGGGTGG + Intergenic
1141638837 16:85329584-85329606 CCTGGGGGGCTGCGGGGTGCGGG + Intergenic
1141662690 16:85449923-85449945 CCTGGTGGGCATGGTGTGGCAGG - Intergenic
1141671835 16:85496232-85496254 CCTTGGAGGCACGGGGTGGCGGG - Intergenic
1141673270 16:85504037-85504059 CGTGGGAGGCAGAGGGCGGGCGG - Intergenic
1141684915 16:85564686-85564708 CATGGGGACCAGAGGGTGTCCGG + Intergenic
1141717064 16:85732958-85732980 CGTGAGGGGCCGAGGGTGGGTGG + Intronic
1141762702 16:86039069-86039091 CCTGGAGGGAAGGGGGTGGTGGG + Intergenic
1141788888 16:86219581-86219603 CCTGGGCAGCACAGGGTGGGAGG - Intergenic
1141804319 16:86332678-86332700 CCTGGGGGACAGGGGATGGGGGG + Intergenic
1141896147 16:86959765-86959787 CCTGGGCATCAGCGGGTGGCAGG - Intergenic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142130396 16:88429375-88429397 CCTGGGGGTGAGTGGGTGGGTGG - Exonic
1142150999 16:88512539-88512561 CCTGGGGGGCAGGGCGGGGTGGG - Intronic
1142176114 16:88646197-88646219 CCTGGGGGACAGCGGGTGAGAGG + Exonic
1142246236 16:88971435-88971457 TCAGGTGGGCAGAGAGTGGCTGG - Intronic
1142338151 16:89503625-89503647 TCTGGGAGGCCGAGGGTGGGTGG - Intronic
1142375973 16:89707344-89707366 CCTGGGGTGCAGCTGGTGTCAGG - Exonic
1142429938 16:90020417-90020439 CCTGGTGGATAGTGGGTGGCAGG + Intronic
1142561115 17:809517-809539 CCTGGGAGGCAGAGAGGAGCGGG + Intronic
1142613895 17:1124153-1124175 TGTGGGGGGTGGAGGGTGGCCGG + Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142704582 17:1686466-1686488 CCTGGGTGACAGAGCGAGGCTGG + Intergenic
1142804278 17:2363317-2363339 GCTGGAGAGCAGAGGGTGGCTGG + Intronic
1143030489 17:3964529-3964551 CCCGGGGCGCGGAGGGCGGCCGG - Intergenic
1143115803 17:4581398-4581420 CCTGGGGTGCAGAGGGCTGGAGG + Intergenic
1143215191 17:5219550-5219572 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1143272114 17:5683481-5683503 CGTGGAGGGCAGGGGGTGGGCGG + Intergenic
1143273099 17:5690067-5690089 GGTAGGGGCCAGAGGGTGGCAGG + Intergenic
1143297064 17:5879161-5879183 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1143419665 17:6778936-6778958 CCTGGGGGACAGAGGAAGGATGG - Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1143899062 17:10159859-10159881 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1144776819 17:17788942-17788964 CCTTGGTGACAGTGGGTGGCTGG + Intronic
1144834206 17:18148474-18148496 CCTGGGGCGCAGCAGGTGCCGGG - Exonic
1144852199 17:18249455-18249477 CCTGAGGGGCAGTGGTTGGTGGG - Intronic
1144950680 17:18991964-18991986 CCTGGGGGGCAGAGGCAGGCAGG + Intronic
1145123559 17:20281858-20281880 CCTAGGGGTCAGAAGATGGCAGG + Intronic
1145763531 17:27442067-27442089 CCCGGGAGGCAGAGGTTGGGAGG + Intergenic
1146009112 17:29180036-29180058 CCTGGGGGGCGCAGGGAGGCAGG - Intronic
1146052868 17:29566983-29567005 CCCGGCGGGCAGCGGGCGGCGGG + Exonic
1146182182 17:30705601-30705623 CCTGGTGGGCAGTGGCTGTCTGG + Intergenic
1146688612 17:34857702-34857724 CCTGGTGGGAAGAGGCAGGCAGG + Intergenic
1146789675 17:35744194-35744216 GCTGGGGGGCAGGGGGAGGCAGG + Intronic
1146795043 17:35774725-35774747 GCTGGGAGGCAGAGGTTGGGTGG - Intronic
1147218648 17:38915302-38915324 CGTAGTGGGCAGAGGCTGGCTGG + Intronic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147384724 17:40074384-40074406 CCTGGGTGGCAGGGGGTGGGTGG + Exonic
1147411394 17:40255399-40255421 CCTGGGAGGCAGAGGTTGTTGGG - Intronic
1147453724 17:40521587-40521609 CCTGGGGGTCAGAGTGGAGCAGG - Intergenic
1147542655 17:41373684-41373706 TCTGGAGGGTAGAGGGTGGGAGG - Intronic
1147575653 17:41597783-41597805 CCTGGGAGGCAGACAGTGCCTGG - Intergenic
1147681421 17:42249734-42249756 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1147868381 17:43569644-43569666 GCTGGGTGACAGAGGGTGGAAGG - Intronic
1147889186 17:43704962-43704984 CTTGCGGGGTAGAGGGAGGCTGG - Intergenic
1148074442 17:44927412-44927434 CCTGTGGGGCAGAGGCTGGCAGG - Intronic
1148287739 17:46410631-46410653 CCTGGGAGGCTGAGGTTGGGAGG + Intergenic
1148309908 17:46628211-46628233 CCTGGGAGGCTGAGGTTGGGAGG + Intronic
1148486814 17:47996123-47996145 CCTTGGGAGCAGATGGTGGGAGG - Intergenic
1148556559 17:48582099-48582121 CCTGGACGGCGGAGGGTGGCTGG - Intronic
1148701170 17:49587857-49587879 CCTGGGGCGCAGTGAGGGGCAGG + Intergenic
1148755498 17:49970986-49971008 CCTGGGCTGCGGAGTGTGGCTGG + Intronic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1149565509 17:57638181-57638203 CCTGGAGAGGAGAGGGTGGGGGG - Intronic
1149702850 17:58669656-58669678 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1149801438 17:59571664-59571686 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150055269 17:62008681-62008703 CCTCGGGGGGAGGGGGCGGCGGG - Intronic
1150295518 17:64005408-64005430 ACTGGAGGGCAGGGGGTGGGGGG - Intronic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1150356076 17:64485990-64486012 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150583193 17:66494108-66494130 CGTAGGTGGAAGAGGGTGGCAGG - Intronic
1150626796 17:66847178-66847200 TCTGGGAGACAGAGGGTGCCAGG - Intronic
1150651509 17:67013222-67013244 CCTGGGGGCCAGAGGGTGTGTGG - Intronic
1150848989 17:68686802-68686824 CCAGCGGGGCAGGGGGTGGGAGG + Intergenic
1151239896 17:72749611-72749633 CCTGGGCAGCAGAGGTGGGCAGG + Intronic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151457264 17:74233472-74233494 CCTTGGGGTCAGCGGGAGGCTGG + Intronic
1151517792 17:74607597-74607619 CATGGAGGGCAGAGTGTGGAAGG + Intergenic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151678241 17:75610740-75610762 CCTGGAGGGCCAGGGGTGGCTGG + Intergenic
1151738969 17:75966052-75966074 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1151767030 17:76137937-76137959 CCTGGCGGGCAAAGGCTGGGTGG + Exonic
1151816558 17:76474142-76474164 CCTGGAGGGCAGAAGAAGGCTGG + Exonic
1151894821 17:76972857-76972879 CCTGGGAGACAGTGGATGGCAGG + Intergenic
1151957156 17:77386197-77386219 CCTGTGGGGCACAGGGCTGCAGG - Intronic
1152176760 17:78793009-78793031 CCTGGGGGGGTGAGGGGGGCGGG - Intronic
1152196768 17:78923251-78923273 CCAGGATGGCAGAGGGTGGAGGG - Intronic
1152262278 17:79273608-79273630 CCTGGGGGGCAGCGTGAGGCTGG + Intronic
1152337285 17:79706171-79706193 CCTGGGGGTCTGAGGGTGCCAGG - Intergenic
1152361592 17:79835497-79835519 CATGGGGGGCAGGAGGTGGGAGG + Intronic
1152613433 17:81327147-81327169 GCGGGGGGGCGGAGGGTGGGAGG - Intronic
1152644597 17:81463001-81463023 CCTGGGGCCCCGAGGGGGGCTGG - Intronic
1152782632 17:82232906-82232928 CCTGGGGGGCGGCGGGGGGGGGG + Intronic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1152992759 18:377879-377901 GCTGGGGGAAATAGGGTGGCGGG + Intronic
1153186564 18:2492816-2492838 CCTGGTGGGAAGAGAATGGCAGG - Intergenic
1153613349 18:6910073-6910095 GCTGAGGGGCAGAGTGTGCCTGG - Intronic
1154217228 18:12423944-12423966 CCAGCTGGGCAGAGTGTGGCTGG - Intronic
1154407671 18:14109029-14109051 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1155910325 18:31498131-31498153 GCGGGGAGGGAGAGGGTGGCCGG + Exonic
1156485646 18:37463982-37464004 CCTGGGAGTCTGCGGGTGGCAGG - Intronic
1156731442 18:40197981-40198003 GCTTGGGGACAGAGGGAGGCGGG - Intergenic
1156894384 18:42229003-42229025 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1157188778 18:45562792-45562814 CCTGGGGGGAAGGGGCTGGGTGG + Intronic
1157232223 18:45928118-45928140 CCTGGGAGGCAGAGGTTGTAGGG + Intronic
1157502699 18:48202472-48202494 GGTGGGGGGCGGGGGGTGGCTGG + Intronic
1157760265 18:50257957-50257979 CCTGGGAGGCAGAGGTTGCGGGG + Intronic
1158708344 18:59814867-59814889 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1158843981 18:61420973-61420995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1159209826 18:65304142-65304164 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1159952793 18:74496880-74496902 CCTGGGGTGGGGAGTGTGGCGGG + Intronic
1160134926 18:76263691-76263713 GCTGGGGAGGAGAGGGAGGCAGG - Intergenic
1160223736 18:76996694-76996716 GCTGGGGGGCAGGGAGTGGAGGG + Intronic
1160340032 18:78081904-78081926 CCTGTGAGGCAGTGGGAGGCGGG + Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160672720 19:373844-373866 CCTGGAGAGAGGAGGGTGGCTGG + Intronic
1160691825 19:463857-463879 CCTGCGGGGCACAGGCTGCCCGG - Exonic
1160826305 19:1082085-1082107 CCTGGGGAGGACAGGGTGGGCGG + Intronic
1160864287 19:1250263-1250285 GCTGGGGGGCTGGGGGCGGCGGG - Exonic
1160865129 19:1252947-1252969 GCTGGGGGGCTGCGGTTGGCAGG + Intronic
1161091740 19:2363665-2363687 CCTGGGGGACCGAGGGGCGCAGG - Intergenic
1161108020 19:2454215-2454237 CCCGGGAGGCAGAGGGTGCGGGG + Intronic
1161175846 19:2841777-2841799 CCTTGGGGCCAGAGGCGGGCGGG - Intronic
1161227083 19:3151648-3151670 CCTGGGAAGCAAAGGGAGGCTGG + Intronic
1161261183 19:3338693-3338715 CCAGGGTGGCACAGGGTGGGCGG + Intergenic
1161416986 19:4152896-4152918 GCTGGGGGCCGGAGGTTGGCAGG + Intergenic
1161420776 19:4174972-4174994 CGTGGGGGACAGAGGGTGCATGG + Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1161759813 19:6162864-6162886 CCTGGTGGGGGGAGGGTGGGCGG + Intronic
1161792804 19:6370748-6370770 CAAGGGGAGCAGAGGGTGGGGGG + Intergenic
1161915305 19:7223969-7223991 CCTGGGTGGCAGAGCGAGACTGG - Intronic
1162020429 19:7865726-7865748 GCTGGGTGGCGGTGGGTGGCGGG + Intergenic
1162088952 19:8265406-8265428 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162374105 19:10294979-10295001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162414160 19:10524373-10524395 CCTGGGGGTGAGCAGGTGGCAGG + Intergenic
1162418559 19:10552863-10552885 CCTGGCGGGAAGAGGGAGACAGG - Exonic
1162568972 19:11459939-11459961 CCTGGGGGGCCCAGTGTAGCTGG - Intronic
1162654889 19:12121174-12121196 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1162740878 19:12772912-12772934 CCTGGGGAGAAGGGGGTGTCAGG + Exonic
1162774484 19:12970921-12970943 CTTGGGGGGCCGAGGCAGGCGGG - Intronic
1162932453 19:13963746-13963768 CCTGGGGCACAGAGGGTGGGCGG + Exonic
1162963595 19:14144200-14144222 CCTGAGGGTCAGAGGTTGTCAGG + Intergenic
1163303593 19:16463223-16463245 CCTGGTGGGCAGAGCCTGGTGGG - Intronic
1163376923 19:16938744-16938766 GATGGGAGGAAGAGGGTGGCTGG - Intronic
1163562004 19:18024928-18024950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1163635449 19:18435177-18435199 CTTGGGGGGCTGTAGGTGGCAGG - Intronic
1164633018 19:29774051-29774073 CCTGTGGGGCAGGGGCTGGCTGG - Intergenic
1164702819 19:30297904-30297926 CCTGGGCGACAGAGGGGGGGGGG - Intronic
1164890773 19:31821330-31821352 CCTGGGGGGCCGGGGTTGTCAGG + Intergenic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1165144774 19:33724239-33724261 CCTGTGGGGCAGGGTGTGTCAGG - Intronic
1165232407 19:34395284-34395306 CTTGGGAGGCAGAGGCTGGGGGG + Intronic
1165399152 19:35586603-35586625 CCTGGGGGACAGAGTGAGACTGG - Intergenic
1165504552 19:36217136-36217158 CCTGGGGGGCAGAGGTTGCAGGG - Intronic
1165585432 19:36911285-36911307 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1165923126 19:39310978-39311000 CCAGGGCAGCCGAGGGTGGCTGG - Intronic
1166014042 19:39966613-39966635 CCTGGGTGACAGAGGGAGACTGG + Intergenic
1166048973 19:40246886-40246908 CCTGGGGCTAAGAGGTTGGCGGG + Intronic
1166205399 19:41265585-41265607 CCTGGTGTCCAGAGGCTGGCGGG + Intronic
1166322701 19:42028483-42028505 CAGGAGGGGCAGAAGGTGGCTGG - Intronic
1166354420 19:42218435-42218457 CCTGGAGGGCAGAGATTGGAAGG - Intronic
1166364390 19:42271061-42271083 CCAGAGGGGCAGAGGGAGGGTGG + Intronic
1166558750 19:43718531-43718553 CCAGTGGTTCAGAGGGTGGCGGG - Exonic
1166698501 19:44867972-44867994 AGTGGGGGGCAGAGGGAAGCGGG + Intronic
1166733136 19:45069791-45069813 CCTGGGGAACAGAGGGAGGCAGG - Intronic
1166785358 19:45363956-45363978 ACTGGGGGGCAGCGGGGGGTCGG + Intronic
1166978197 19:46617350-46617372 CCCGAGGGGCAAAGGGTGGATGG + Intergenic
1167037324 19:47002059-47002081 GCTGGGGGGCAGAGGTGGCCAGG - Exonic
1167151000 19:47709602-47709624 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1167166474 19:47802980-47803002 CCTGGGGGGCAGAGGGGACAGGG + Exonic
1167175369 19:47860780-47860802 CCTGGGGGGCAGAGGGGACAGGG - Intergenic
1167250353 19:48395830-48395852 CCTTGGGGGAAGAGGGGAGCTGG + Intronic
1167277282 19:48545975-48545997 CCTGGGGGCTTAAGGGTGGCAGG - Intergenic
1167303269 19:48692148-48692170 CCTGGGAGGCAGAGGCGGGGTGG - Intergenic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167471455 19:49678161-49678183 CCTGGCGGGCGGAGGGAGGAGGG + Intronic
1167572599 19:50298521-50298543 TCTGGGAGGCCGAGGCTGGCAGG + Intronic
1167687353 19:50964847-50964869 ACTGGGGGGCAGAAGGTGCTGGG - Intronic
1167739673 19:51316939-51316961 CCTGGGAGGTAGGGGGTGGAGGG - Intronic
1167853845 19:52222077-52222099 CCTGGGGGCCAGTGAGTGGCAGG - Exonic
1168052642 19:53840880-53840902 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1168117173 19:54229512-54229534 CGTGGGGGTCATGGGGTGGCAGG + Intronic
1168246548 19:55115553-55115575 CCTGGGAGGGAGAGCTTGGCAGG - Intronic
1168306915 19:55440793-55440815 GCCTGGGGGCTGAGGGTGGCAGG + Intronic
1168711710 19:58504571-58504593 CCTGGGGGGGGGGGGGGGGCGGG + Intronic
1202712954 1_KI270714v1_random:27504-27526 TCTGGGAGGCAGAGGGGGCCGGG - Intergenic
925056360 2:860550-860572 CATGGAGGGGAGAGGGTGGAGGG - Intergenic
925063374 2:910517-910539 CCTGGGGTGCAGAGGCTGTTGGG - Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925752510 2:7102254-7102276 CCTGGGAGGCAGAGGTTGTAGGG - Intergenic
925915772 2:8604765-8604787 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
925926837 2:8676957-8676979 GCTGGTGGGCAGAGGGGGGGTGG + Intergenic
926091869 2:10056364-10056386 CCTGGGAGGCGGAGGGTGCAGGG + Intergenic
926295416 2:11565309-11565331 CCTGTGGGGGAGACGCTGGCAGG - Intronic
926423324 2:12718795-12718817 CCCGGGGAGGAGAGGGCGGCGGG + Intronic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
926566198 2:14477147-14477169 ACTGGGAGGCAGAGGTTGCCAGG + Intergenic
926615185 2:14990346-14990368 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
927135951 2:20096682-20096704 AATGGAGGGCAGAGGGTGGGTGG - Intergenic
927165618 2:20317701-20317723 CCTTGAGGGTAGAGGGTGGGAGG - Intronic
927205729 2:20609168-20609190 CCTTGGGGGCAGAGGCCGCCAGG + Intronic
927501843 2:23588390-23588412 CCTGGGAGGCTGAAGGTGGGTGG - Intronic
927697449 2:25247795-25247817 CATGGGGGGATCAGGGTGGCAGG - Intronic
927756025 2:25708533-25708555 CCTTGGGGGAAGAGGGTAGTAGG + Intergenic
928518253 2:32063878-32063900 CCTGGGAGGCACCGGGTTGCTGG - Exonic
928944419 2:36760068-36760090 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
929109419 2:38393925-38393947 CCTGGGAGGCTGAGGGTGGGTGG + Intergenic
929181775 2:39048474-39048496 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
929593650 2:43162419-43162441 CCTGGGGCTCAGAGGGGAGCTGG - Intergenic
929679146 2:43971022-43971044 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
929788839 2:45009702-45009724 CCTGGGAGGCGGAGAGGGGCCGG + Intergenic
929789690 2:45013757-45013779 CCTGGAGGGCAGAGGGGTGGCGG - Intergenic
930002326 2:46869727-46869749 CCTGGGGGTCTGAGGCAGGCAGG - Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931173933 2:59834022-59834044 CCTGGGGTGCTGAGGGAGCCTGG - Intergenic
931352350 2:61503039-61503061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
931512519 2:63016504-63016526 CCTGGGAGGCAGAGGTTGCTGGG - Intronic
932150927 2:69371150-69371172 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932181675 2:69652086-69652108 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932389834 2:71377187-71377209 CCTGGGAGGCGGAGGTTGGCTGG + Intronic
932429771 2:71667364-71667386 TCTCTGGGGCAGAGGCTGGCAGG + Exonic
932440425 2:71731294-71731316 CCTGGGGCCCAGCGTGTGGCTGG + Intergenic
932827870 2:74958441-74958463 CGTCGGGGCCAGAGGGTCGCCGG + Intergenic
932843997 2:75116178-75116200 CCTGGGAGGCAGAGGTTGAGAGG - Intronic
933354387 2:81195453-81195475 CATGGGGGGCAAGGGGTGTCGGG + Intergenic
933508875 2:83214563-83214585 CCTGGGGGGCAGAGGTTGCAGGG - Intergenic
933593074 2:84254531-84254553 CCTTGAGGGTAGAGGGTGGGAGG - Intergenic
934046948 2:88180137-88180159 TCTGGGCTGCAGAGGGCGGCTGG - Intronic
934070720 2:88381632-88381654 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
934583959 2:95472600-95472622 CCTGGGTGGCAGAGGTTGCAAGG - Intergenic
934595493 2:95604114-95604136 CCTGGGTGGCAGAGGTTGCAAGG + Intergenic
934787281 2:97021369-97021391 CCTGGGTGGCAGAGGTTGCAAGG - Intergenic
934926895 2:98388455-98388477 CCTGGAGGGGAGAGGGTGCTTGG + Intronic
935035648 2:99369898-99369920 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
935293183 2:101626948-101626970 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
935655671 2:105420692-105420714 GGTGGGGGGCAGAGGGTTTCAGG + Intronic
935794181 2:106624914-106624936 TGGTGGGGGCAGAGGGTGGCAGG - Intergenic
935845603 2:107162860-107162882 GCTGAGGGGCAGAGCCTGGCAGG + Intergenic
937111723 2:119371772-119371794 TCTGGGGAGAAGAGGGTGCCTGG + Intronic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
937325024 2:120985237-120985259 GCTGGGGGAGTGAGGGTGGCTGG + Intronic
937782962 2:125860335-125860357 ACTTGGGGGCAGAGAGTGGGAGG - Intergenic
938541978 2:132290661-132290683 CCCGGGAGGCAGAGGTTGGAGGG + Intergenic
938763608 2:134445850-134445872 CCTGGGCTGCAGAGGCTGTCTGG + Intronic
938954184 2:136283097-136283119 CTTGGGTGGGGGAGGGTGGCTGG - Intergenic
939315495 2:140544468-140544490 ACTGGAGGGCAGAGGGTGAGAGG - Intronic
940864194 2:158800913-158800935 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
941096064 2:161239688-161239710 ACTGTGGGGCAGATGGGGGCAGG + Intergenic
941239960 2:163025001-163025023 ACTGGAGGGCAGAGGGTAGGAGG + Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941670759 2:168289743-168289765 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
942160531 2:173181272-173181294 CTTGTGAGGCAGAGGATGGCAGG + Intronic
942541275 2:177017771-177017793 CCCTGGGGACAGAGGGTGGGAGG + Intergenic
943295138 2:186128815-186128837 CCTGTGGGGCACAGGGCTGCTGG + Intergenic
944125074 2:196283449-196283471 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
944743285 2:202633277-202633299 CCCGGGAGGCAGAGGTTGGAAGG - Intergenic
945139825 2:206673077-206673099 ACTGGAGGGCAGAGGGTGGGAGG - Intronic
945234590 2:207622981-207623003 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
945278854 2:208016399-208016421 CTTTGGGGGGAGATGGTGGCAGG + Intronic
946163038 2:217847650-217847672 CCTGGAGGGCTGTGGGTGGTCGG + Exonic
946193886 2:218022014-218022036 CCGGGAGGGCAGAGGGTGAAGGG + Intergenic
946699045 2:222392729-222392751 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
946737759 2:222771749-222771771 TCTGGGAGGCAGAGGCGGGCTGG - Intergenic
947119429 2:226799873-226799895 GCTGGGGGGCGGAGAGGGGCGGG - Intergenic
947281428 2:228460078-228460100 ACTGGTGGGCACAGGGTTGCTGG + Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947907614 2:233776836-233776858 CCTGGCTGACAGAGTGTGGCAGG + Intronic
947918561 2:233850371-233850393 CCTGGTGGGCAGAGGTGGTCGGG + Intronic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948331278 2:237167946-237167968 ACTGGAGGGCGGAGGGTGGGAGG - Intergenic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948486680 2:238285724-238285746 CCCGCGGGGTAGATGGTGGCTGG - Intronic
948607853 2:239147221-239147243 CCTAGGGGGCAGAAGGCAGCCGG + Intronic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948693582 2:239721665-239721687 CCTGGGGGGCAGCTCTTGGCCGG + Intergenic
948695151 2:239729521-239729543 CGGGTGGGGCAGAGGGAGGCGGG + Intergenic
948765344 2:240216558-240216580 CCTGGGGAGCAGGGGGAGGTGGG + Intergenic
948783642 2:240340011-240340033 CCTGGTGGGCAGATGCTGCCTGG - Intergenic
948839680 2:240642794-240642816 CCTGGGGGGCGGCAGGTGGGAGG - Intergenic
948947604 2:241229012-241229034 CCTGAGAGGCAGAGGGTGACGGG - Exonic
949007557 2:241658312-241658334 GCAGGGGGGCAGTGGGGGGCAGG + Intronic
949021353 2:241742974-241742996 CCAGGGCGCCAGAGCGTGGCAGG + Intronic
949057560 2:241936748-241936770 GCTGGCGGGCAGGGGGTGGGGGG + Intergenic
1169193927 20:3673496-3673518 CCTGGGGGGCCGTGGGAGGGCGG + Exonic
1169215000 20:3788059-3788081 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1170611263 20:17915421-17915443 TCTGGGAGGCCGAGGTTGGCAGG + Intergenic
1171085241 20:22232593-22232615 GCTGGGGGGCGGTGGGGGGCGGG + Intergenic
1171389125 20:24789941-24789963 CTTGGATGGCAGAGGATGGCTGG + Intergenic
1171984184 20:31648062-31648084 CCTAGGGGGCAGAGGTTGCAGGG - Intergenic
1172106032 20:32517781-32517803 CCTGGGACGCAGCGGGTGCCTGG - Intronic
1172427539 20:34865258-34865280 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172575616 20:36006102-36006124 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172871906 20:38141385-38141407 CCTGAGGGGGATAGGGGGGCGGG + Exonic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1173752378 20:45487486-45487508 CCGGTGGGGCAGCGGCTGGCGGG - Intergenic
1173797916 20:45875575-45875597 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1173959503 20:47060106-47060128 CTTATGGGGCAGAGGTTGGCTGG + Intronic
1173993871 20:47323172-47323194 CCTGGGGGGAAGAGGGGGCCAGG + Intronic
1174132302 20:48354364-48354386 CCTGGAGCTCAGAGGGTGGGAGG + Intergenic
1174173507 20:48631041-48631063 CCTGGGGAGCAGAGGGCTGGGGG - Intronic
1174311604 20:49660035-49660057 CCTGAGTGGGAGAGGGTGTCTGG - Intronic
1174339287 20:49886072-49886094 CAGGGAGGGCAGAGGATGGCCGG - Intronic
1174390477 20:50215847-50215869 ACTGGGGGGCTGGGGGTGGGAGG + Intergenic
1174412216 20:50343591-50343613 CCTGGTGGGCAGATGGGAGCAGG + Intergenic
1174455016 20:50642707-50642729 CATGTGGGGCAGAGGGTGAGAGG - Intronic
1174471790 20:50766999-50767021 CATGTGGGGCAGAGGGTGAGGGG + Intergenic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1174568191 20:51482112-51482134 CTTGGGGGGCTGGGGGTGGGGGG - Intronic
1174568371 20:51483594-51483616 GGTGGGGGGGAGAGGGTGGAAGG - Intronic
1174638797 20:52025222-52025244 CCTGGGAGGCAGAGTTTGCCAGG - Intergenic
1174750727 20:53108949-53108971 CTTGGAGGGTAGAGGGTGGAGGG - Intronic
1175028607 20:55929859-55929881 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1175108578 20:56630622-56630644 CCAGGGCGGCGCAGGGTGGCGGG + Intronic
1175164238 20:57031700-57031722 CCTGGGGGGCAAGGGGTGAAGGG - Intergenic
1175786765 20:61716830-61716852 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1175971212 20:62687639-62687661 CTTGGGGCGCAGAGTCTGGCTGG - Intergenic
1175997321 20:62817579-62817601 CCTGGGGGGCCGGGGGGGCCGGG - Exonic
1176038745 20:63053198-63053220 CCTGGGGCCCAGAGCGGGGCTGG - Intergenic
1176069016 20:63216368-63216390 CCTGGCGGGAAGGGGCTGGCGGG + Intergenic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176155249 20:63616744-63616766 CCAGTGGGGCTGAGGATGGCAGG - Intronic
1176177757 20:63736724-63736746 CCTGGGGGGCAGCTGGGGTCTGG + Intronic
1176382655 21:6120915-6120937 CCTGGGTGGGTGAGGGTGGCGGG + Intronic
1176410230 21:6445760-6445782 CCATGGGGGCCCAGGGTGGCTGG + Intergenic
1176893468 21:14347325-14347347 CCTGGGAGGCAGAGGTTTGCAGG + Intergenic
1177454323 21:21316617-21316639 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
1178293212 21:31387069-31387091 CCTGGGGGGCCCAGGGTGGTGGG - Intronic
1178335544 21:31739436-31739458 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1178375960 21:32067684-32067706 GCTGGGGGGCAGAGGGAGAGAGG + Intergenic
1178431536 21:32522387-32522409 CCTGGGGTGCAGATGGCTGCAGG - Intergenic
1178493614 21:33070074-33070096 CCTGCGGGGCAGCGGGTGGCGGG - Intergenic
1178586751 21:33877127-33877149 CCTGGGAGGCAGAGGTTGCGGGG - Intronic
1179626947 21:42654067-42654089 CCTGGGGGGTGGGGGGTGGGGGG + Intronic
1179685723 21:43054082-43054104 CCATGGGGGCCCAGGGTGGCTGG + Intronic
1179740814 21:43417324-43417346 CCTGGGTGGGTGAGGGTGGCGGG - Intronic
1179819887 21:43930613-43930635 CCTGGCGGGGTGAGGGTGGGTGG + Intronic
1180061998 21:45390394-45390416 CCCGGGGGGCACAGGTGGGCAGG - Intergenic
1180084987 21:45504500-45504522 CCTGGGGGGCCGGGGGGGCCGGG - Exonic
1180155059 21:45973544-45973566 CCCGTGAGGCAAAGGGTGGCGGG - Intergenic
1180170339 21:46055091-46055113 TGTGCGGGGCAGAGGGAGGCAGG - Intergenic
1180231531 21:46429437-46429459 CGTGAGGGGCACAGGGGGGCCGG + Intronic
1180650347 22:17370720-17370742 CCTGGAGCGCGGCGGGTGGCGGG + Intronic
1180674025 22:17574761-17574783 TCTGGGAGGCCGAGGGTGGGTGG - Intronic
1180700723 22:17780253-17780275 TCTGGAGGGCAGAGGGTGCGTGG + Intergenic
1180727986 22:17960678-17960700 CATGGGGGTGAGAGGGTGGGGGG + Intronic
1180728139 22:17961488-17961510 CATGGGGGTGAGAGGGTGGGGGG - Intronic
1180785352 22:18544007-18544029 CCTGGGTGGCAGCAGGTGGCAGG - Intergenic
1180841018 22:18958894-18958916 CATGGCGGGCAGAGTGTGGAGGG - Intergenic
1180946418 22:19696215-19696237 CCTGGGGGGCTGGGGGCTGCGGG - Intergenic
1180977297 22:19855329-19855351 CCTGGGGGGCTGCAGGTGTCGGG + Intergenic
1180979237 22:19871016-19871038 TCTGGGAGGCAGAGTGTGGGAGG - Intergenic
1180994135 22:19956450-19956472 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181013920 22:20057485-20057507 CCAGGGTCACAGAGGGTGGCCGG - Intronic
1181018917 22:20088066-20088088 GCTGGGGTGCACAAGGTGGCAGG + Intronic
1181057396 22:20266653-20266675 CCTGGTGGGTAGGGAGTGGCTGG + Intronic
1181083401 22:20428378-20428400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181128934 22:20718048-20718070 CCTGGGTGGCAGCAGGTGGCAGG - Intronic
1181242256 22:21483360-21483382 CCTGGGTGGCAGCAGGTGGCAGG - Intergenic
1181280926 22:21719934-21719956 CCTGGGGGGCGGAGGTTGCAGGG + Intronic
1181302779 22:21893248-21893270 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1181492026 22:23266463-23266485 CCTGGGAGGCAGAGGTTGCAAGG - Intronic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181616952 22:24061431-24061453 CCTGGTGGGCAGAAGCTGCCAGG - Intronic
1181636952 22:24178910-24178932 CCTGGGTGCCAGTGGGTGGGAGG + Intergenic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1181967853 22:26669092-26669114 CTTGGGGAACAGAAGGTGGCAGG + Intergenic
1182274994 22:29182492-29182514 CCTGGGTGGCAGAGTGAGACGGG + Intergenic
1182293422 22:29299309-29299331 CCGGGGGCGGAAAGGGTGGCGGG - Exonic
1182354165 22:29714777-29714799 CCTGGGGGGCAGGGTGTGCCGGG + Intergenic
1182585994 22:31344734-31344756 CCAGGGGGCCTGAGGGAGGCAGG - Exonic
1182975946 22:34624214-34624236 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1183228287 22:36564886-36564908 CCTGCGGGGCGCAGGGTGGCGGG + Exonic
1183309335 22:37101022-37101044 GTTGGGGGGCAGAGGGAGCCAGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183925868 22:41205473-41205495 CCTGGAGGGTGGAGGGTGGGAGG + Intronic
1183995008 22:41626528-41626550 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1184049926 22:41996938-41996960 GCAGTGGGGCAGGGGGTGGCTGG - Exonic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184172738 22:42769283-42769305 CTTGAGGGGCAGAGGGTGGGGGG + Intergenic
1184333791 22:43841548-43841570 CCTGGGGGGCACAGGGCTGAGGG - Intronic
1184652446 22:45925408-45925430 CCAGGATGGCAGAGGGTGGGAGG + Intronic
1184866486 22:47204476-47204498 CCTGTGGGGAGGAGGGTCGCAGG - Intergenic
1185161099 22:49230309-49230331 CCTGTGGGCCACAGGATGGCAGG + Intergenic
1185169308 22:49283167-49283189 CCTGGTGGGCAGAGGAGGCCAGG + Intergenic
1185338812 22:50282672-50282694 TGTGGGGAGCAGAGGGGGGCGGG + Intronic
1185379520 22:50501928-50501950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949624973 3:5855150-5855172 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
950098790 3:10345033-10345055 CCACGAGGGCAGAGGGAGGCAGG - Intronic
950182842 3:10927266-10927288 CCTGCCTGGCAGAGGGAGGCAGG + Intronic
950520498 3:13495133-13495155 CCAGGTGGAGAGAGGGTGGCTGG - Intronic
950569896 3:13793382-13793404 CCAGGGCGGCAGACGGTCGCTGG - Intergenic
950905157 3:16531093-16531115 CCTGTGGTGTAGAGGATGGCTGG + Intergenic
951000710 3:17556088-17556110 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
951204977 3:19916437-19916459 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
951957251 3:28271004-28271026 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
952508991 3:34035409-34035431 CCTGAGGGGCTGGGGCTGGCTGG + Intergenic
953232394 3:41076549-41076571 CCTGGGAAGCAGAGCATGGCAGG + Intergenic
953290921 3:41661644-41661666 CCTGTGAGGCAGAGGGTGTGGGG + Intronic
953549755 3:43892592-43892614 CTTGTGGGGCAGACGGTGGCAGG + Intergenic
953549895 3:43894036-43894058 CCAGGGGGGCGGGGGGGGGCGGG + Intergenic
953613505 3:44468669-44468691 CCTCGGGGGGAGGGGGTGGAGGG - Intronic
953754287 3:45633194-45633216 CCTGTGGAGGGGAGGGTGGCGGG - Intronic
953787423 3:45921574-45921596 CCTCGGGGGCTAAGAGTGGCCGG + Exonic
954053183 3:47999691-47999713 CCTGGAGGGTGGAGGGTGGGAGG + Intronic
954125488 3:48525518-48525540 CCAGGCGGGCAGTAGGTGGCTGG + Intronic
954293105 3:49660136-49660158 AATGTGAGGCAGAGGGTGGCAGG + Intronic
954343065 3:49971188-49971210 CCTGGGAGGCAGAGGTTGCGGGG + Intronic
954574227 3:51666401-51666423 CCTGAGGGGGGCAGGGTGGCTGG + Exonic
954622787 3:52005376-52005398 CCTGGTGGGCAGAGGCTGGTGGG + Intergenic
954668946 3:52277882-52277904 CCTGGTGGGCCCAGGGTGGGCGG + Intronic
954855803 3:53642611-53642633 CTGGGGCGGCAGAGGCTGGCAGG - Intronic
954980026 3:54737512-54737534 CCTGGGAAGAAGAGGGTGGTTGG + Intronic
954985371 3:54786002-54786024 CCATGATGGCAGAGGGTGGCTGG - Intronic
955003854 3:54951598-54951620 CCTGGGAGCCACAGGGCGGCTGG + Intronic
955223307 3:57040824-57040846 TCTGGTGGGCAGCGGTTGGCAGG - Intronic
955238973 3:57163793-57163815 CGGGGGGGGAAGGGGGTGGCGGG + Intronic
955942963 3:64164128-64164150 CTTGGGGGGCTGAGGCGGGCGGG + Intronic
955961228 3:64343231-64343253 GCAGGGGGGCAGAGGGTTGTTGG - Intronic
956322069 3:68008082-68008104 GCTGGGGGAAACAGGGTGGCAGG - Intronic
957016469 3:75069879-75069901 CCAGAGGAGCAGGGGGTGGCGGG - Intergenic
957552596 3:81726655-81726677 CCTGGGAGGCAGAGGTTGCTAGG - Intronic
958692722 3:97488490-97488512 CCTGCTGGGTTGAGGGTGGCAGG - Intronic
959451387 3:106507393-106507415 ACTTGAGGGCAGAGGGTGGGAGG - Intergenic
959710501 3:109381167-109381189 TTTGGGAGGCAGAGGGGGGCAGG - Intergenic
960272518 3:115690221-115690243 AATGGTGGGCAGGGGGTGGCGGG - Intronic
960630332 3:119724090-119724112 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
960638111 3:119803831-119803853 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
960794558 3:121471664-121471686 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
961183638 3:124895896-124895918 ACTGAGGTCCAGAGGGTGGCAGG - Intronic
961317654 3:126051483-126051505 ACCTGGGGGCAGAGGGAGGCAGG - Intronic
961457186 3:127030070-127030092 CCTGGCTGGCAGATGGGGGCAGG + Intronic
961509436 3:127391965-127391987 GCTGGAGGGCAGAGGGCGGGCGG + Intergenic
961550598 3:127668625-127668647 CCAGGAGGGCAGTGGGAGGCGGG + Intronic
961597718 3:128032124-128032146 GCTGGGGTGCAGAGTGAGGCAGG - Intergenic
961768647 3:129231881-129231903 CCAGGGTGGCACAGGGTGGGAGG + Intergenic
961773185 3:129265115-129265137 CCTGGGTGACAGATGGAGGCCGG - Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961869768 3:129978857-129978879 CTTTTGGGGCAGAGGGAGGCAGG + Intergenic
961927668 3:130498511-130498533 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
962089701 3:132230374-132230396 ACTGGGGAGGAGAGGGTGGGAGG - Intronic
962126493 3:132624760-132624782 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
963509657 3:146231014-146231036 TCTGGAGGGCAGAAGGTGGGAGG - Intronic
963699186 3:148602393-148602415 CCTGGGAGGCTGAGGGTAGCAGG - Intergenic
963906778 3:150779451-150779473 CTGGAGGGGCCGAGGGTGGCTGG + Intergenic
964093474 3:152902947-152902969 CCTGGGAGGCAGAGGTTGCTTGG + Intergenic
964652319 3:159026051-159026073 CCTGGGGGGTGGGGGGTGGGGGG + Intronic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
964976728 3:162630319-162630341 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
964993144 3:162840561-162840583 ACTGGGGCTCAGAGGGTGGAGGG - Intergenic
965066094 3:163850629-163850651 CTTGTGGGGCAGGGGGTGGAGGG + Intergenic
965688788 3:171333479-171333501 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
965758685 3:172052191-172052213 CGTGGGAGGCTGAGGGTGGAAGG - Intronic
966168625 3:177051290-177051312 CCTGGGGGGTGGAGGGTGGGAGG + Intronic
966267547 3:178064484-178064506 CCTGGGAGGCAGAGGTTGCGGGG - Intergenic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
966647784 3:182266097-182266119 ACTGGAGGGTAGAGGGTGGGAGG + Intergenic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
967010831 3:185432013-185432035 CATGGGGGCCAGGGGGTGGAGGG - Intronic
967234938 3:187374881-187374903 CCCAGAGGGCAGAGGGTGGGAGG - Intergenic
967840210 3:193999058-193999080 CCAGGGTGCCAGAGGGTGCCCGG + Intergenic
967948722 3:194824104-194824126 CATGGTGGGCACAGGGTAGCGGG - Intergenic
968074324 3:195808289-195808311 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
968360839 3:198145597-198145619 CGTGGGAGGCTGAGGGTCGCTGG - Intergenic
968461244 4:726076-726098 GCTGTGGGGCAGAGGCTGGCGGG + Intronic
968510756 4:994731-994753 GTTGGGGGGCAGGGGGCGGCCGG - Intronic
968616363 4:1579350-1579372 CGTGGGGGCCCGAGGGCGGCCGG - Intergenic
968622157 4:1608677-1608699 ACTGGTGGGCAGCGGGTGTCAGG - Intergenic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968645488 4:1738454-1738476 CCTGGGGACCACAGTGTGGCTGG + Intronic
968693737 4:2009873-2009895 TCTGGGAGGCAGAGGCGGGCGGG - Exonic
968741409 4:2333325-2333347 CCTGGGAGGCAAGGGGAGGCGGG - Intronic
968903551 4:3441965-3441987 CCTGAGGGGCAGTGGGAGGCGGG - Exonic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
969131180 4:4992130-4992152 CCTGGGCGACAGAGCGAGGCTGG - Intergenic
969261150 4:6034723-6034745 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
969328060 4:6455413-6455435 CTGGGGGTGCAGATGGTGGCAGG - Intronic
969442947 4:7227946-7227968 GCTGTGAGGCAGGGGGTGGCGGG + Intronic
969483298 4:7458195-7458217 CCTGTGGGGCGGGGGGAGGCGGG + Intronic
969511594 4:7620989-7621011 CCAGGGAGGCAGTGGCTGGCAGG + Intronic
969584736 4:8085190-8085212 CCTGGGGAGGGGAGAGTGGCTGG - Intronic
969669041 4:8579730-8579752 TCTGAGGGACAAAGGGTGGCTGG - Intronic
970321142 4:14876774-14876796 ACTGGAGGGCAGAGGGTAGGAGG + Intergenic
970464090 4:16306016-16306038 CCTGGGCGACAGAGGGAGACTGG - Intergenic
970514823 4:16818060-16818082 CCTGATGGGAGGAGGGTGGCTGG + Intronic
970624711 4:17863992-17864014 ACTTGAGGGCAGAGGGTGGGAGG + Intronic
970887146 4:20999566-20999588 GTTTGGGGGAAGAGGGTGGCTGG + Intronic
971915264 4:32862093-32862115 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
972764712 4:42141928-42141950 CCTGGGTGACAGAGGGAGACTGG - Intronic
973320239 4:48802643-48802665 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
974090505 4:57305817-57305839 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
975774583 4:77771235-77771257 CCTGGGAGGCGGAGGTTGCCGGG + Intronic
976178755 4:82379879-82379901 CTTGGGAGGCTGAGGGTGGGAGG - Intergenic
976367940 4:84251097-84251119 GCTTGAGGGAAGAGGGTGGCAGG + Intergenic
978352030 4:107830025-107830047 ACTTGAGGGCAGAGGGTGGGAGG - Intronic
978504631 4:109443482-109443504 TCTGGGAGGCAGAGGTTGGAGGG - Intronic
978508087 4:109482712-109482734 CCTGGGAGGCGAAGGTTGGCAGG - Intronic
978705733 4:111708243-111708265 TCTGGGAGGCTGAGGCTGGCAGG - Intergenic
979259025 4:118632066-118632088 GCTGGGAGGCCGAAGGTGGCTGG - Intergenic
980053160 4:128057856-128057878 CTTGGGAGGCTGAGGCTGGCAGG + Intergenic
980134381 4:128845846-128845868 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
980693160 4:136321403-136321425 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
981057536 4:140380271-140380293 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981296712 4:143140907-143140929 CCTGGGGGAAGGGGGGTGGCTGG + Intergenic
981312747 4:143312989-143313011 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
981627157 4:146771406-146771428 ACTGGAGGGCAGAGGGTGGTAGG - Intronic
982631647 4:157838014-157838036 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
982687345 4:158506808-158506830 CCTGGGAGGCAGAGGTTGCAAGG + Intronic
983018677 4:162647252-162647274 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
983696912 4:170543610-170543632 GCTGGGGGGTAGAGGGTGGGAGG + Intergenic
983728426 4:170961032-170961054 ACTGGAGGGTAGAGGGTGGGAGG + Intergenic
984021000 4:174484704-174484726 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
984298536 4:177885471-177885493 ACTGGGGGTGAGAGGGTGGCAGG - Intronic
984858656 4:184217747-184217769 TCCGGCGGGCAGAGGCTGGCTGG + Exonic
985482360 5:122493-122515 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
985576476 5:675594-675616 CATGGGGGGTACAGTGTGGCCGG + Intronic
985641647 5:1066110-1066132 CCTGAAGGTCAGAGGGTGGGAGG - Intronic
985647176 5:1090425-1090447 CCTGGAGAGGAGAGGGTGACGGG + Intronic
985727516 5:1523880-1523902 CCTGGGGCGCCGAGCGGGGCCGG + Exonic
986270721 5:6228418-6228440 CCGCGGTGCCAGAGGGTGGCGGG - Intergenic
986299304 5:6465955-6465977 CCTGGGCAGCAGAGGGAGACAGG - Intronic
986585969 5:9318986-9319008 CCTGAGAGGCAGAGGTTGCCAGG + Intronic
986691869 5:10319949-10319971 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
986910956 5:12556363-12556385 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
987123697 5:14791805-14791827 CCTGCGTGGCAGAGGTTTGCTGG - Intronic
987182878 5:15385609-15385631 GCAGGGTGGCAGAGAGTGGCGGG - Intergenic
988856803 5:35234965-35234987 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
989052573 5:37335842-37335864 CATGGCGGGGAGGGGGTGGCGGG + Intronic
989593599 5:43135072-43135094 CCTGGGAGGCGGAGGTTGGGGGG - Intronic
990097514 5:52135403-52135425 CCTGGGTGACAGAGCGAGGCTGG + Intergenic
990407530 5:55505979-55506001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
990632544 5:57686434-57686456 GGTGTGGGGCAGAGGGTAGCAGG - Intergenic
991657488 5:68918582-68918604 TCTGGGGGGCAGGGGGTGGTGGG + Intergenic
992105836 5:73448409-73448431 GCTGGGGCGCAGAGGGAGCCCGG - Intergenic
992365478 5:76084811-76084833 CCGGCGGGGCAGAGGGGGGCGGG + Intronic
992732278 5:79683810-79683832 CTTGGGAGGCTGAGGGAGGCAGG + Intronic
992911294 5:81398473-81398495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
993310034 5:86318090-86318112 CCTGGGAGGCAGAGGATGCAGGG - Intergenic
993590256 5:89786118-89786140 TCTGGGGGGCTGAGGTGGGCAGG + Intergenic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
993847060 5:92957144-92957166 CTTGTGGGGTGGAGGGTGGCAGG + Intergenic
994645699 5:102466174-102466196 ACTGGAGGGCAGAGGGTGGGGGG - Intronic
995441445 5:112196868-112196890 ACTGTGGGTCAGAGGGTTGCAGG - Intronic
995684478 5:114757347-114757369 ACTGGGGGCTAGAGGGTGGGCGG - Intergenic
996308724 5:122078652-122078674 GCTGGGGGTGAGAGGGGGGCGGG + Intergenic
996631043 5:125632879-125632901 ACTGGGGGCGAGAGGGAGGCTGG + Intergenic
997116657 5:131132462-131132484 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997186009 5:131882858-131882880 CCTGGGGGGCAGAGCATGCCAGG - Intronic
997206576 5:132053746-132053768 CCTGGGGGGCAGAGGTGGAGTGG + Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997514412 5:134476504-134476526 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997555281 5:134792099-134792121 CCTGGGAGGCACAGGGTGTAGGG + Intronic
997601519 5:135141768-135141790 CCTGGGATGCTGAGGGTGTCAGG + Intronic
997658227 5:135570802-135570824 ACTGGGGGGCAGTGTGTGGAGGG + Exonic
997690788 5:135826176-135826198 CCTGGTGGGCTGAGAGGGGCTGG - Intergenic
997937734 5:138129117-138129139 TTTGGGGGGCAGAGGGTGGCAGG - Intronic
997988763 5:138526535-138526557 CCTGGGGGGCAGGGGGTAGGCGG - Intronic
998334855 5:141362169-141362191 CCTGGGGGTCAGAGGGCTCCCGG - Exonic
998339062 5:141400149-141400171 CCTGGGGGTCAGAGGGTACAGGG - Exonic
998895723 5:146797877-146797899 CCTGGAGTTCAGAGGTTGGCAGG + Intronic
998979732 5:147689088-147689110 CCTGGGGGGGAAAGCGTGCCAGG + Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999313729 5:150570450-150570472 ACTGGGGGGCAGATGGGGGCTGG - Intergenic
999762873 5:154716193-154716215 CCCGGGAGGCAGAGGGTGCAGGG - Intronic
1000317383 5:160105460-160105482 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1000798455 5:165693673-165693695 CCTGGGAAGCAGAAGGTGTCAGG - Intergenic
1001012630 5:168112370-168112392 TCTGGAGGGTAGAGGGTGGGAGG - Intronic
1001045238 5:168366112-168366134 CCTGGGGGACGGGGGGTGGCTGG + Intronic
1001089404 5:168726385-168726407 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001089410 5:168726403-168726425 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001111568 5:168900952-168900974 CGTGAGGGGTAGAAGGTGGCTGG + Intronic
1001223472 5:169924066-169924088 GCAGGGAGGAAGAGGGTGGCAGG - Intronic
1001316875 5:170649482-170649504 CTTGGGGAGCAGAGCATGGCTGG - Intronic
1001342916 5:170863272-170863294 CAGGGGAGGCAGTGGGTGGCAGG + Intronic
1001489956 5:172148303-172148325 GGTGGGGGGCAGAGGGAAGCAGG + Intronic
1001503480 5:172257135-172257157 CCTTGAGGGCAGAGGATGGGAGG - Intronic
1001599037 5:172917008-172917030 GCTGGGCTGGAGAGGGTGGCAGG + Intronic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1002095453 5:176828322-176828344 CCTGGGGGGCAGTGGGGGTGAGG + Intronic
1002103399 5:176868422-176868444 CCAGGGGGCCATGGGGTGGCTGG - Intronic
1002127947 5:177060730-177060752 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1002182306 5:177437028-177437050 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1002487489 5:179549683-179549705 CTTGGGGGGCTGAGAGTGGGAGG - Intergenic
1002514893 5:179750421-179750443 CCTAGGGCCCAGAGAGTGGCTGG + Intronic
1002702785 5:181137845-181137867 CCTGAGTGTGAGAGGGTGGCTGG + Intergenic
1002924759 6:1599029-1599051 CCTGGGGAGCAGAGGCTGCCTGG - Intergenic
1003058208 6:2841715-2841737 CCTGGGGGGTGGGGGGTGCCGGG + Intronic
1003101219 6:3177828-3177850 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1003118145 6:3297033-3297055 GCTGTGGGATAGAGGGTGGCAGG - Intronic
1003463460 6:6353667-6353689 CCTGAGGGGCAAAGCGTGCCTGG - Intergenic
1003625261 6:7735651-7735673 CCTGTGGGGCAGGGGGTACCTGG - Intronic
1003868479 6:10383618-10383640 CCTAGGCTGCAGAGGGCGGCGGG - Intergenic
1003909619 6:10731674-10731696 CCCGGGAGGCAGAGGTTGCCTGG - Intergenic
1004227003 6:13794724-13794746 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1004395698 6:15245255-15245277 CCCGGGGGGCGGAGGAGGGCCGG + Intergenic
1004493296 6:16138829-16138851 CCTGGAGTGCAGAGGATGCCTGG - Intronic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1004793705 6:19057571-19057593 ACTCGGGGGTAGAGGGTGGGAGG + Intergenic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1005937384 6:30533737-30533759 CCTGGGGGGCGGAGGTTGCAGGG - Intergenic
1006113565 6:31763263-31763285 CCTGGAGGGCAAGGGGAGGCAGG - Intronic
1006269230 6:32951072-32951094 CCAGGGAGGCAGAGGTTGCCGGG + Intronic
1006330062 6:33383917-33383939 TCTGGGGAGCTGAGGCTGGCGGG - Intergenic
1006338261 6:33432044-33432066 GCTGAGGGGCAGAGGGAGGTGGG + Intronic
1006514387 6:34538026-34538048 CCTGGAGGACAGAGGGAGACAGG - Exonic
1006809981 6:36813763-36813785 TCTGGGGGGCAGGGTGTTGCAGG - Intronic
1006825089 6:36928771-36928793 CCCAGGGAGCAGAGGGAGGCAGG + Intronic
1006826323 6:36938858-36938880 AGTGGGGGGCTGGGGGTGGCTGG - Intergenic
1006860425 6:37168961-37168983 CAAGGGAGGCAGAGGGTGGGGGG + Intergenic
1006898628 6:37486071-37486093 CCTGGGTGTCAGTGGGTGGAAGG + Intronic
1006919792 6:37619871-37619893 GCTGGGAGGCAGTGGGTAGCGGG - Intergenic
1006987914 6:38189061-38189083 CCTGGAGGGCAGAGGATGCAGGG - Intronic
1007072865 6:39049298-39049320 ACTGTGGGGCAGAGGGAGTCCGG - Intronic
1007656773 6:43455417-43455439 CCCGGGGCGCAGAGAGAGGCCGG + Intronic
1008520313 6:52356783-52356805 CCTGGGGGAGAGAGGGAGGTGGG - Intergenic
1008590592 6:52989950-52989972 CTTGGGAGGCTGAGGGTGGCAGG - Intronic
1008591071 6:52994603-52994625 GCTGGGGGATAGGGGGTGGCAGG + Intronic
1009288947 6:61860366-61860388 ATCGGGGGGCAGAGGGTGGGAGG - Intronic
1009435302 6:63610742-63610764 TTTGGGAGGCAGAGGCTGGCGGG + Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1009913988 6:69969804-69969826 CCAGGTTGGCTGAGGGTGGCTGG + Intronic
1010022142 6:71173209-71173231 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010231516 6:73539364-73539386 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1010391208 6:75339870-75339892 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1011714121 6:90086516-90086538 CTTGTGGGGCAGAGGGCGACAGG - Intronic
1012566064 6:100653610-100653632 CCTGGGCGACAGAGCGAGGCTGG + Intronic
1012638090 6:101572922-101572944 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1013074520 6:106759491-106759513 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1013252692 6:108349979-108350001 TTTGGGGGGCTGAGGGGGGCGGG + Intronic
1013601574 6:111710112-111710134 GCTGGGCGGGAGAGGGTGGAGGG - Intronic
1013612927 6:111811990-111812012 CCTGGGGTGCAGAGGGTCCTAGG - Intronic
1013766581 6:113581016-113581038 CCTTGAGGGTTGAGGGTGGCAGG + Intergenic
1014109773 6:117607538-117607560 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1014575017 6:123059044-123059066 CCTGGAGGAGAGAGGGAGGCAGG - Intronic
1015284109 6:131465336-131465358 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1016058505 6:139603701-139603723 TCTGGGAGGCAGAGAGTGGGTGG + Intergenic
1016286648 6:142481170-142481192 TCTGGGGAGGAGAGGGAGGCTGG + Intergenic
1016466297 6:144328857-144328879 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1016546736 6:145232486-145232508 ACTTGAGGGCAGAGGGTGGGAGG - Intergenic
1016830124 6:148425755-148425777 CCTGGGGGACACAGGGGGACAGG - Intronic
1017103585 6:150867871-150867893 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1017654659 6:156615909-156615931 CCCGGGGGGCAGAGGTTGCAGGG + Intergenic
1017759908 6:157560300-157560322 CCTGTGGGGCAGCAGGTGCCCGG + Intronic
1017760237 6:157562868-157562890 CTTGGGGGGCGGTGGGAGGCGGG - Intronic
1017775025 6:157673765-157673787 CCGGGGCTGCAGAGGGCGGCTGG + Exonic
1018087086 6:160312193-160312215 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1018129685 6:160717189-160717211 CTTGGGGAGCAGAGGGTGAGTGG + Intronic
1018149223 6:160923076-160923098 ATTGGCGGGCAGAGTGTGGCAGG - Intergenic
1018520052 6:164639121-164639143 CCTTGAGGGCAGAGGGTAGGAGG - Intergenic
1018550590 6:164992967-164992989 CCTGGGAGGCAGAGGTTGTGGGG + Intergenic
1018610283 6:165641888-165641910 CGTGGGAGGTACAGGGTGGCTGG - Intronic
1018677562 6:166236117-166236139 GCTGGTGGGCAGGGGGTGGGGGG - Intergenic
1018701778 6:166432917-166432939 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1018811962 6:167304941-167304963 CCTTGAGGGGAGAAGGTGGCAGG - Intronic
1019259172 7:71057-71079 CGTGGGAGGCTGAGGGTCGCTGG + Intergenic
1019274095 7:166837-166859 CCTGGGGGGCAGCGGTGGCCTGG - Intergenic
1019287399 7:230500-230522 CCTGTGGGGCCGTGGGTGGATGG + Intronic
1019315076 7:380548-380570 GCAGGGGGACAGAGGGAGGCAGG + Intergenic
1019345901 7:530852-530874 CCTGGGGGCCAGAGCCAGGCAGG - Intergenic
1019346012 7:531211-531233 CCAGGGTGGCAGGGGGTGGGGGG + Intergenic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019398056 7:834097-834119 CTTGGTGGGCAGGGGCTGGCTGG + Intronic
1019398070 7:834150-834172 CTTGGTGGGCAGGGGCTGGCCGG + Intronic
1019398085 7:834203-834225 CTTGGTGGGCAGGGGCTGGCCGG + Intronic
1019404738 7:877451-877473 GGCGGGGGGCAGAGGGAGGCAGG - Intronic
1019478721 7:1256322-1256344 CCAGGGACGCAGAAGGTGGCTGG - Intergenic
1019485641 7:1288091-1288113 CCTGGGCCCCTGAGGGTGGCAGG - Intergenic
1019503390 7:1376952-1376974 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1019524147 7:1473207-1473229 CCTGGGAGGAAGACGCTGGCAGG + Intronic
1019540466 7:1548859-1548881 CGTGGGGAGCTGGGGGTGGCTGG + Intronic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019597793 7:1866320-1866342 CTTGGAGGGCAGAGGCTGTCGGG - Intronic
1019612026 7:1941492-1941514 GTTGGGGGCCAGAGGGTGACAGG - Intronic
1019664440 7:2244457-2244479 TCTGGGAGGCAGTGGGGGGCGGG - Intronic
1019779381 7:2930504-2930526 CCTGGCGGGGAGGGGGTGGTGGG + Intronic
1019859571 7:3644808-3644830 ACGGCGGGGCAGGGGGTGGCAGG + Intronic
1019929606 7:4214977-4214999 CCTGGGTGGCACTGGGGGGCAGG - Intronic
1020016272 7:4833932-4833954 GCGGGGCGGCAGAGGGTGACCGG + Intronic
1020072146 7:5234136-5234158 CCTGGGAGGCAGAGGTTGCCAGG + Intergenic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020176014 7:5882673-5882695 CCTGGGGTGCAGTGGGGGCCAGG + Intronic
1020176324 7:5885042-5885064 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020190871 7:5996477-5996499 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020705949 7:11544264-11544286 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020824559 7:13010746-13010768 TTTGGGGGGCAGAGGCGGGCAGG + Intergenic
1020920453 7:14257501-14257523 CCTGGGAGGCACATGGTGGGAGG + Intronic
1021083218 7:16388089-16388111 CTTGGGAGGCTGAGGCTGGCAGG - Intronic
1021679474 7:23115617-23115639 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1022103008 7:27180313-27180335 CCTGGGGGGCAGGGAGGGGGCGG - Intergenic
1022704105 7:32787160-32787182 AGTGGGGGTCAGTGGGTGGCAGG + Intergenic
1022964416 7:35459192-35459214 TATGGGGGGCAGGGGGTGGGGGG - Intergenic
1023647165 7:42330092-42330114 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1023787480 7:43722473-43722495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1024539961 7:50468138-50468160 CCTCGCGGGCAGGGGGTGGCTGG + Intronic
1024573643 7:50746774-50746796 CCCGGGGGGCAGAGACTGGGTGG - Intronic
1025212972 7:57031580-57031602 GCTGGGGGGCCGGGGGTGGGCGG - Intergenic
1025658981 7:63545244-63545266 GCTGGGGGGCCGGGGGTGGGCGG + Intergenic
1026162099 7:67878541-67878563 CTTGGGAGGCTGAGGCTGGCGGG + Intergenic
1026286008 7:68963446-68963468 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1026576228 7:71573823-71573845 ACTTGAGGGCAGAGGGTGGGAGG - Intronic
1026636874 7:72091083-72091105 TTTGGGAGGCAGAGGGTGGGCGG + Intronic
1026772845 7:73213160-73213182 CCTGGGTGGCAGAGGGCAACTGG + Intergenic
1026818190 7:73528790-73528812 CCTGGGCGGCAGAGGTTGCAAGG - Intergenic
1026901424 7:74039518-74039540 CCTTGGTGACAGAGGGTGGGTGG + Intronic
1026966696 7:74444693-74444715 CTTGGGGGGCTGAGGGAGGATGG - Intergenic
1027013709 7:74766557-74766579 CCTGGGTGGCAGAGGGCAACTGG + Intergenic
1027074329 7:75179475-75179497 CCTGGGTGGCAGAGGGCAACTGG - Intergenic
1027202158 7:76070979-76071001 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1027390838 7:77702039-77702061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1028029491 7:85892159-85892181 CCTGGGAGGCTGAGGTTGGGAGG + Intergenic
1028464501 7:91135202-91135224 ACTGGGGGACAGAGGGTTGGGGG + Intronic
1028521030 7:91731006-91731028 CCTGGGAGGCCGAGGCTGGCGGG - Intronic
1029082812 7:97988346-97988368 CCTGGGGTGCAGTGGGGGCCAGG - Intronic
1029408069 7:100389834-100389856 CCCTGGGGGCACAGGGTGTCTGG - Intronic
1029679055 7:102095251-102095273 TTTGGGAGGCCGAGGGTGGCCGG - Intronic
1030210668 7:106992912-106992934 TGTGGGGGGCTGAGGGTGGGGGG - Intergenic
1031622492 7:123951695-123951717 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1031936139 7:127737497-127737519 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1032066956 7:128778972-128778994 CATGGGGGGAACAGGGTGGGAGG + Intergenic
1032075962 7:128836314-128836336 GCCGGGGAGCAGAGGGTGGGAGG + Intronic
1032167467 7:129556701-129556723 CCAGAGGGGCAGAGAGAGGCTGG + Intergenic
1032200418 7:129818647-129818669 CCTGGGAGGCAGAGGTTGCAAGG - Intergenic
1032231684 7:130079965-130079987 CCTGGGCGACAGAGGGAGGGAGG - Intronic
1032376745 7:131427627-131427649 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032386933 7:131531654-131531676 CCATGAGGGCAGAGGTTGGCGGG - Intronic
1032461868 7:132117850-132117872 CATGGAGGGCAGGGGGTGCCTGG + Intergenic
1032553497 7:132807280-132807302 CCTGGGGGGCAGAGAGGACCTGG - Intronic
1032559460 7:132873487-132873509 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032762148 7:134953398-134953420 CCTGGGAGGCAGAGGTTAGCTGG + Intronic
1032862536 7:135894102-135894124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1033769045 7:144527931-144527953 ACTTGAGGGCAGAGGGTGGGAGG + Intronic
1034198758 7:149267370-149267392 CCTGGGCAGGAGTGGGTGGCTGG + Intronic
1034267460 7:149788211-149788233 CATGGAGGGCACAGGGTGTCTGG - Intergenic
1034272416 7:149809577-149809599 CCTGGGGACCATGGGGTGGCAGG + Intergenic
1035027125 7:155833392-155833414 CATGGCGGGCAGAGGGTGTGAGG - Intergenic
1035209045 7:157314235-157314257 CCTGGGGGCCAGAGGCCTGCAGG + Intergenic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035521066 8:275259-275281 CCTGTGGGGCAGAGGCTTGCAGG + Intergenic
1035587187 8:785624-785646 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587200 8:785658-785680 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587225 8:785726-785748 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587238 8:785760-785782 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587251 8:785794-785816 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587262 8:785828-785850 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035772259 8:2156968-2156990 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1035774509 8:2177941-2177963 TCTGGAGGGTAGAGGGTGGAAGG - Intergenic
1036181949 8:6593428-6593450 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1036704973 8:11040024-11040046 TGAGGGAGGCAGAGGGTGGCGGG - Intronic
1037693988 8:21207892-21207914 GGTGGGGGGTAGAGGGTGGGCGG - Intergenic
1037837795 8:22224433-22224455 TCTGGCGGACAGAGGTTGGCCGG - Intronic
1037877168 8:22553954-22553976 CCTGGAGGGCAGTGGGCGGGTGG + Intronic
1038394516 8:27237041-27237063 CGAGAGGGGCAGAAGGTGGCAGG + Intronic
1038633681 8:29268613-29268635 CCTGGGAGGCAGAGGTTGCGCGG - Intergenic
1039200905 8:35092554-35092576 CCTGGAGGGCAGAGAGTGGCAGG + Intergenic
1039347503 8:36723570-36723592 CCTGGGAGGCAGAGGATGCAGGG + Intergenic
1039495013 8:37974070-37974092 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1039965101 8:42278278-42278300 CCTGGGTGGCTGAGGGTGGACGG + Intronic
1041266363 8:56069372-56069394 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1041600894 8:59716393-59716415 CCTGGGGGTCCCAGGGAGGCTGG + Intergenic
1043984116 8:86673432-86673454 GCCAGGTGGCAGAGGGTGGCAGG + Intronic
1045341334 8:101257358-101257380 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045891668 8:107165166-107165188 TCTGGGAGGCAGAGGTGGGCGGG - Intergenic
1045903661 8:107315957-107315979 CCTGTGGGACAGAGTCTGGCAGG - Intronic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1046720385 8:117612485-117612507 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1047322195 8:123796983-123797005 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1047647488 8:126884028-126884050 CTTGAGGGTCAGAGGATGGCAGG + Intergenic
1047949966 8:129924290-129924312 CCGGGGGGGGGGGGGGTGGCGGG + Intronic
1048214212 8:132480702-132480724 CCTGGGGGGCAGGGGAGGCCAGG + Exonic
1048716102 8:137272030-137272052 GCTTGGGGGCAGAGGGTGGGAGG + Intergenic
1049138366 8:140927506-140927528 CCTGGGGGTCTGATGGTGTCAGG + Intronic
1049164787 8:141119108-141119130 CCAGGGGAGCAGGGGGTGCCTGG + Intronic
1049196977 8:141321012-141321034 GCTGGGGTGCAGGGGCTGGCTGG + Intergenic
1049220527 8:141426834-141426856 TCTGAGAGGCAGAGGGTGCCAGG - Intronic
1049319739 8:141989736-141989758 CCTGGAGGGGAGAGGGTGGTGGG - Intergenic
1049352457 8:142171465-142171487 CCTGGGGGGCAGCTGGTTGCCGG + Intergenic
1049423371 8:142526520-142526542 CCTGCCGGGCAGAGAGTGGTGGG - Exonic
1049724699 8:144140313-144140335 CCACAGGGGCAGAGGGTGGCTGG - Exonic
1049790395 8:144469743-144469765 CCTGGAGGAGAGAGGGTGGCTGG + Intronic
1049804833 8:144534095-144534117 CCTGGGGGGCCGGGGAGGGCAGG - Intronic
1049818784 8:144621497-144621519 GCTGGGGGGCAGGGCCTGGCAGG + Intergenic
1049973856 9:843073-843095 CCTTGGGAGCAGAGGGTTTCGGG + Intronic
1050723626 9:8620608-8620630 GGCGGGGGGCAGGGGGTGGCAGG + Intronic
1050995924 9:12217651-12217673 CCCGGGAGGCAGAGGGTGCAGGG - Intergenic
1051561588 9:18447458-18447480 CCTGTGGGGAAGAGGGAGGGAGG + Intergenic
1051721534 9:20042105-20042127 CCTGGTGGGCAGACTGTGGCAGG + Intergenic
1051726182 9:20089685-20089707 AGTGGTGGGCAGGGGGTGGCGGG - Intergenic
1051777326 9:20650208-20650230 CCTGGAGGGCAGAAAGTGGGAGG + Intergenic
1051806519 9:20998934-20998956 ACTAGGGGACAGAGTGTGGCTGG + Intergenic
1052651693 9:31311667-31311689 CCCGGTGGGCAGGGGGTGGGTGG - Intergenic
1052767455 9:32656366-32656388 CCTGAGGGTGAGAGGGTGGGAGG + Intergenic
1052835785 9:33248918-33248940 TTTGGGAGGCTGAGGGTGGCAGG + Intronic
1053391549 9:37739957-37739979 ACTGAGGGCCAGAGGGTGGCTGG - Intronic
1055243894 9:74217703-74217725 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1055395445 9:75869016-75869038 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1055857440 9:80707232-80707254 TCTGGTGGGAAGAGGGAGGCTGG - Intergenic
1056436847 9:86582908-86582930 ACTGGAGGGCAGAGGGTAGGAGG + Intergenic
1056764086 9:89434177-89434199 CCTGGCTGGCAGCGGGTGACTGG - Intronic
1056765154 9:89440513-89440535 CCTTGGGGGCTGAGTGTGGAGGG - Intronic
1057039714 9:91839159-91839181 TCTGGGGGGCAGCAGGAGGCTGG + Intronic
1057117626 9:92540693-92540715 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
1057353633 9:94318944-94318966 CCTGGGGAGGAGAGGTTGGCCGG + Exonic
1057654118 9:96938648-96938670 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1057986069 9:99715379-99715401 CCCGGGAGGCAGAGGTTTGCAGG - Intergenic
1058176137 9:101738189-101738211 CCGGGCGGGCAGAGGATGCCAGG - Exonic
1058233560 9:102461508-102461530 CTGGTGGGGCAGGGGGTGGCGGG + Intergenic
1058736536 9:107899339-107899361 CCTGGGGGCCACAGCCTGGCGGG + Intergenic
1059115034 9:111593759-111593781 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1059407212 9:114108652-114108674 CCTGGCGGGTAGGGGGTGGCAGG - Intergenic
1059748269 9:117223991-117224013 GCTGGGGGGTAGTGGGTGGAAGG - Intronic
1060106657 9:120877041-120877063 CCGGGAGGGGAGAGCGTGGCGGG + Intronic
1060140016 9:121201638-121201660 CCTGGGGGGTTGCTGGTGGCTGG + Exonic
1060275234 9:122177506-122177528 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060395593 9:123314241-123314263 GCAGGGTGGCAGAGGGAGGCTGG - Intergenic
1060691723 9:125667393-125667415 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060722978 9:125990507-125990529 GCTCGGGGACAGAGGGTGGCGGG - Intergenic
1060813059 9:126620676-126620698 CCTTGGGGGCAGACGGAGGGTGG + Intronic
1060984854 9:127814009-127814031 ACTGCGGGACAGAGGGTGGCTGG + Exonic
1061234209 9:129333145-129333167 CCTGGGAGGCAGAGGCTGCGGGG - Intergenic
1061253043 9:129437629-129437651 TCTGGGTGGCAGAGGGGGGAAGG + Intergenic
1061334465 9:129922530-129922552 CCTGGGCTTCATAGGGTGGCTGG + Intronic
1061401399 9:130370316-130370338 CGTGCCAGGCAGAGGGTGGCTGG + Intronic
1061413070 9:130431448-130431470 GCTGGGGAGCAGACGGTAGCCGG - Exonic
1061488115 9:130930568-130930590 CATGGGGGGAGGTGGGTGGCAGG - Intronic
1061566612 9:131444883-131444905 CCTTGGAAGCCGAGGGTGGCTGG + Intronic
1061587675 9:131579169-131579191 CCTGGAGGGGAGTGGGTGGAAGG + Exonic
1061610547 9:131742553-131742575 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1061818656 9:133210445-133210467 CCCGGGGGGATGAGGGTGGGGGG - Intergenic
1061859638 9:133461245-133461267 CCAGGTGGGTAGAGGGTGGAGGG + Intronic
1061880394 9:133566075-133566097 ACTGGGGGACAGTGGGTGACAGG - Intronic
1061909287 9:133714314-133714336 CTTGAGGGGCAGAAGGTGGCAGG + Intronic
1062233798 9:135498540-135498562 CATGGGGGGCAGGGGGTGGGTGG - Intronic
1062320111 9:135986587-135986609 CCTGGGGGGCACGCGGTGGGCGG + Intergenic
1062377271 9:136267840-136267862 CCTGGGTGACAGAGGGGGGCAGG - Intergenic
1062385691 9:136310678-136310700 GCTGGGGCCCAGAGGGTGGGGGG - Intergenic
1062412207 9:136431253-136431275 CCTGGGGGGGCGGGCGTGGCGGG - Intronic
1062412316 9:136431544-136431566 CCTGGGGGGGCGGGCGTGGCGGG - Intronic
1062427025 9:136510805-136510827 CCTGCGGGGCAGGAGGAGGCCGG + Exonic
1062443955 9:136585604-136585626 AGGGGAGGGCAGAGGGTGGCTGG + Intergenic
1062447879 9:136603288-136603310 CCTGGGGGGCAGAGGGAGGTTGG + Intergenic
1062481699 9:136755333-136755355 GCTGTGGGGCACAGGGGGGCTGG + Exonic
1062483247 9:136762150-136762172 GCTGGGGGGCATGGGGTGGGCGG + Intronic
1062501581 9:136854197-136854219 CCTGGGGGGCTGGGTGGGGCAGG - Exonic
1062542963 9:137049625-137049647 TCTGGAGGGCAGGGGGAGGCCGG - Intronic
1062596766 9:137303025-137303047 CGTGGGCAGCAGAGGGAGGCAGG - Intergenic
1062745544 9:138209428-138209450 CGTGGGAGGCTGAGGGTCGCTGG - Intergenic
1185533291 X:839028-839050 CCTGGGGGGGTGGGGGTGGGGGG + Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1187180561 X:16939608-16939630 CCAAGGGTGCACAGGGTGGCAGG + Intergenic
1187381614 X:18807103-18807125 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1187405557 X:19000752-19000774 CCTGGGTGACAGAGGGGGGCCGG - Intronic
1188283014 X:28293385-28293407 CCTGGGTGACAGAGTGAGGCTGG + Intergenic
1189402829 X:40688139-40688161 CCTAGGAGGCAGAGGTTGGGAGG + Intronic
1189548642 X:42070490-42070512 CCTGTGGGGCAGAGGGGAGCAGG + Intergenic
1189638734 X:43043917-43043939 CCTTGAGGGTAGAGGGTGGGGGG - Intergenic
1189642878 X:43092934-43092956 CTTGGGGGGCTGAGGGTGGGAGG - Intergenic
1190334969 X:49256856-49256878 CTGGGGGGACAGAGGGTGTCAGG + Intronic
1190441100 X:50475062-50475084 TCTGGGGGGCTGGGGGTGGGTGG + Intergenic
1190600134 X:52083374-52083396 ACTGGAGGGCAGAGGGTGGGAGG - Intergenic
1190743506 X:53306335-53306357 CCAGGGGTCCAGAGGGAGGCAGG + Intronic
1192017487 X:67347120-67347142 CCTGGGTGCCAGAAGATGGCAGG + Intergenic
1192119970 X:68446401-68446423 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1192428228 X:71095927-71095949 CCCGGGGGGCGGGGGGTGGGGGG + Intergenic
1192639486 X:72848293-72848315 CCTGGGGCGGAGAGAGGGGCTGG - Exonic
1192642225 X:72872512-72872534 CCTGGGGCGGAGAGAGGGGCTGG + Exonic
1192945187 X:75958713-75958735 ACTGGGGGGTGGAGGGTGGAAGG - Intergenic
1194730509 X:97447801-97447823 CGTGTGGGGCAGAGAATGGCAGG + Intronic
1194887919 X:99340876-99340898 TCAGAGGGGAAGAGGGTGGCTGG - Intergenic
1195247106 X:103004730-103004752 TCTGGGCTGCTGAGGGTGGCAGG + Intergenic
1195668313 X:107449811-107449833 CGGGGCGGGCAGAGGTTGGCAGG - Intergenic
1196025588 X:111038369-111038391 CCAGGTGAGCAGAGGATGGCAGG - Intronic
1196174529 X:112626484-112626506 CTTGGGAGTCAGGGGGTGGCGGG - Intergenic
1196216812 X:113062396-113062418 ACTGGAGGGCAGAGAGTGGGAGG - Intergenic
1196706831 X:118724275-118724297 CATGGGGGACAGTGGGTGGGTGG + Intergenic
1197257467 X:124279135-124279157 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1197760594 X:130025206-130025228 CCTGGAGGACAGAGGCTGCCCGG + Exonic
1197771979 X:130094962-130094984 GCTGGTGGGCCGAGGGTGGTGGG + Intronic
1198165416 X:134050480-134050502 CCTGGGGGGCGGTGGGAGGAAGG - Intergenic
1198252134 X:134890025-134890047 GCTGGAGGGCAGTGGCTGGCTGG - Intronic
1198462359 X:136876197-136876219 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1199338392 X:146646195-146646217 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1199503572 X:148536350-148536372 CCTGGAGGGCTGGGGGTGCCTGG + Intronic
1199607315 X:149586871-149586893 ACTGGGGGTCAGAGAGTAGCGGG - Intronic
1199631808 X:149782496-149782518 ACTGGGGGTCAGAGAGTAGCGGG + Intronic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1201564897 Y:15355497-15355519 GGTGGAGGCCAGAGGGTGGCAGG - Intergenic
1202349518 Y:23972731-23972753 CCTGGGGGGTAGAGGGAAGGTGG - Intergenic
1202521257 Y:25697373-25697395 CCTGGGGGGTAGAGGGAAGGTGG + Intergenic