ID: 1176135223

View in Genome Browser
Species Human (GRCh38)
Location 20:63519601-63519623
Sequence CCACGTGCTCAGGGGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176135213_1176135223 -5 Left 1176135213 20:63519583-63519605 CCCAGGACAGCGCCTTCCCCACG No data
Right 1176135223 20:63519601-63519623 CCACGTGCTCAGGGGGCACAAGG No data
1176135214_1176135223 -6 Left 1176135214 20:63519584-63519606 CCAGGACAGCGCCTTCCCCACGT No data
Right 1176135223 20:63519601-63519623 CCACGTGCTCAGGGGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176135223 Original CRISPR CCACGTGCTCAGGGGGCACA AGG Intergenic
No off target data available for this crispr