ID: 1176136114

View in Genome Browser
Species Human (GRCh38)
Location 20:63522688-63522710
Sequence GCATCATTCTGGCCTGGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176136105_1176136114 14 Left 1176136105 20:63522651-63522673 CCTGCCACAGGCAGCCCAGCTTA No data
Right 1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG No data
1176136106_1176136114 10 Left 1176136106 20:63522655-63522677 CCACAGGCAGCCCAGCTTAAAGT No data
Right 1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG No data
1176136110_1176136114 0 Left 1176136110 20:63522665-63522687 CCCAGCTTAAAGTGAGGGTGGCT No data
Right 1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG No data
1176136103_1176136114 29 Left 1176136103 20:63522636-63522658 CCGTGGAGGGGTCTTCCTGCCAC No data
Right 1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG No data
1176136111_1176136114 -1 Left 1176136111 20:63522666-63522688 CCAGCTTAAAGTGAGGGTGGCTG No data
Right 1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176136114 Original CRISPR GCATCATTCTGGCCTGGTAT AGG Intergenic
No off target data available for this crispr