ID: 1176136902

View in Genome Browser
Species Human (GRCh38)
Location 20:63527278-63527300
Sequence CTCTGAAGTCTGTATCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176136902_1176136906 7 Left 1176136902 20:63527278-63527300 CCCACTTGATACAGACTTCAGAG No data
Right 1176136906 20:63527308-63527330 CCCAGCAACTCTCGTACAGACGG No data
1176136902_1176136909 25 Left 1176136902 20:63527278-63527300 CCCACTTGATACAGACTTCAGAG No data
Right 1176136909 20:63527326-63527348 GACGGCTTTCGTGCCCAGGCTGG No data
1176136902_1176136910 26 Left 1176136902 20:63527278-63527300 CCCACTTGATACAGACTTCAGAG No data
Right 1176136910 20:63527327-63527349 ACGGCTTTCGTGCCCAGGCTGGG No data
1176136902_1176136908 21 Left 1176136902 20:63527278-63527300 CCCACTTGATACAGACTTCAGAG No data
Right 1176136908 20:63527322-63527344 TACAGACGGCTTTCGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176136902 Original CRISPR CTCTGAAGTCTGTATCAAGT GGG (reversed) Intergenic