ID: 1176136903

View in Genome Browser
Species Human (GRCh38)
Location 20:63527279-63527301
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176136903_1176136906 6 Left 1176136903 20:63527279-63527301 CCACTTGATACAGACTTCAGAGA No data
Right 1176136906 20:63527308-63527330 CCCAGCAACTCTCGTACAGACGG No data
1176136903_1176136910 25 Left 1176136903 20:63527279-63527301 CCACTTGATACAGACTTCAGAGA No data
Right 1176136910 20:63527327-63527349 ACGGCTTTCGTGCCCAGGCTGGG No data
1176136903_1176136909 24 Left 1176136903 20:63527279-63527301 CCACTTGATACAGACTTCAGAGA No data
Right 1176136909 20:63527326-63527348 GACGGCTTTCGTGCCCAGGCTGG No data
1176136903_1176136908 20 Left 1176136903 20:63527279-63527301 CCACTTGATACAGACTTCAGAGA No data
Right 1176136908 20:63527322-63527344 TACAGACGGCTTTCGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176136903 Original CRISPR TCTCTGAAGTCTGTATCAAG TGG (reversed) Intergenic