ID: 1176136904

View in Genome Browser
Species Human (GRCh38)
Location 20:63527307-63527329
Sequence CGTCTGTACGAGAGTTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176136904_1176136914 26 Left 1176136904 20:63527307-63527329 CCCCAGCAACTCTCGTACAGACG No data
Right 1176136914 20:63527356-63527378 AGCTCAGGCCTGTAGTCCCGAGG No data
1176136904_1176136915 30 Left 1176136904 20:63527307-63527329 CCCCAGCAACTCTCGTACAGACG No data
Right 1176136915 20:63527360-63527382 CAGGCCTGTAGTCCCGAGGCAGG No data
1176136904_1176136913 11 Left 1176136904 20:63527307-63527329 CCCCAGCAACTCTCGTACAGACG No data
Right 1176136913 20:63527341-63527363 CAGGCTGGGCGCAGCAGCTCAGG No data
1176136904_1176136909 -4 Left 1176136904 20:63527307-63527329 CCCCAGCAACTCTCGTACAGACG No data
Right 1176136909 20:63527326-63527348 GACGGCTTTCGTGCCCAGGCTGG No data
1176136904_1176136908 -8 Left 1176136904 20:63527307-63527329 CCCCAGCAACTCTCGTACAGACG No data
Right 1176136908 20:63527322-63527344 TACAGACGGCTTTCGTGCCCAGG No data
1176136904_1176136910 -3 Left 1176136904 20:63527307-63527329 CCCCAGCAACTCTCGTACAGACG No data
Right 1176136910 20:63527327-63527349 ACGGCTTTCGTGCCCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176136904 Original CRISPR CGTCTGTACGAGAGTTGCTG GGG (reversed) Intergenic