ID: 1176136907

View in Genome Browser
Species Human (GRCh38)
Location 20:63527309-63527331
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176136907_1176136909 -6 Left 1176136907 20:63527309-63527331 CCAGCAACTCTCGTACAGACGGC No data
Right 1176136909 20:63527326-63527348 GACGGCTTTCGTGCCCAGGCTGG No data
1176136907_1176136908 -10 Left 1176136907 20:63527309-63527331 CCAGCAACTCTCGTACAGACGGC No data
Right 1176136908 20:63527322-63527344 TACAGACGGCTTTCGTGCCCAGG No data
1176136907_1176136910 -5 Left 1176136907 20:63527309-63527331 CCAGCAACTCTCGTACAGACGGC No data
Right 1176136910 20:63527327-63527349 ACGGCTTTCGTGCCCAGGCTGGG No data
1176136907_1176136915 28 Left 1176136907 20:63527309-63527331 CCAGCAACTCTCGTACAGACGGC No data
Right 1176136915 20:63527360-63527382 CAGGCCTGTAGTCCCGAGGCAGG No data
1176136907_1176136914 24 Left 1176136907 20:63527309-63527331 CCAGCAACTCTCGTACAGACGGC No data
Right 1176136914 20:63527356-63527378 AGCTCAGGCCTGTAGTCCCGAGG No data
1176136907_1176136913 9 Left 1176136907 20:63527309-63527331 CCAGCAACTCTCGTACAGACGGC No data
Right 1176136913 20:63527341-63527363 CAGGCTGGGCGCAGCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176136907 Original CRISPR GCCGTCTGTACGAGAGTTGC TGG (reversed) Intergenic