ID: 1176136909

View in Genome Browser
Species Human (GRCh38)
Location 20:63527326-63527348
Sequence GACGGCTTTCGTGCCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176136903_1176136909 24 Left 1176136903 20:63527279-63527301 CCACTTGATACAGACTTCAGAGA No data
Right 1176136909 20:63527326-63527348 GACGGCTTTCGTGCCCAGGCTGG No data
1176136905_1176136909 -5 Left 1176136905 20:63527308-63527330 CCCAGCAACTCTCGTACAGACGG No data
Right 1176136909 20:63527326-63527348 GACGGCTTTCGTGCCCAGGCTGG No data
1176136901_1176136909 26 Left 1176136901 20:63527277-63527299 CCCCACTTGATACAGACTTCAGA No data
Right 1176136909 20:63527326-63527348 GACGGCTTTCGTGCCCAGGCTGG No data
1176136904_1176136909 -4 Left 1176136904 20:63527307-63527329 CCCCAGCAACTCTCGTACAGACG No data
Right 1176136909 20:63527326-63527348 GACGGCTTTCGTGCCCAGGCTGG No data
1176136907_1176136909 -6 Left 1176136907 20:63527309-63527331 CCAGCAACTCTCGTACAGACGGC No data
Right 1176136909 20:63527326-63527348 GACGGCTTTCGTGCCCAGGCTGG No data
1176136902_1176136909 25 Left 1176136902 20:63527278-63527300 CCCACTTGATACAGACTTCAGAG No data
Right 1176136909 20:63527326-63527348 GACGGCTTTCGTGCCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176136909 Original CRISPR GACGGCTTTCGTGCCCAGGC TGG Intergenic