ID: 1176136913

View in Genome Browser
Species Human (GRCh38)
Location 20:63527341-63527363
Sequence CAGGCTGGGCGCAGCAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176136904_1176136913 11 Left 1176136904 20:63527307-63527329 CCCCAGCAACTCTCGTACAGACG No data
Right 1176136913 20:63527341-63527363 CAGGCTGGGCGCAGCAGCTCAGG No data
1176136907_1176136913 9 Left 1176136907 20:63527309-63527331 CCAGCAACTCTCGTACAGACGGC No data
Right 1176136913 20:63527341-63527363 CAGGCTGGGCGCAGCAGCTCAGG No data
1176136905_1176136913 10 Left 1176136905 20:63527308-63527330 CCCAGCAACTCTCGTACAGACGG No data
Right 1176136913 20:63527341-63527363 CAGGCTGGGCGCAGCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176136913 Original CRISPR CAGGCTGGGCGCAGCAGCTC AGG Intergenic