ID: 1176136915

View in Genome Browser
Species Human (GRCh38)
Location 20:63527360-63527382
Sequence CAGGCCTGTAGTCCCGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176136912_1176136915 -3 Left 1176136912 20:63527340-63527362 CCAGGCTGGGCGCAGCAGCTCAG No data
Right 1176136915 20:63527360-63527382 CAGGCCTGTAGTCCCGAGGCAGG No data
1176136904_1176136915 30 Left 1176136904 20:63527307-63527329 CCCCAGCAACTCTCGTACAGACG No data
Right 1176136915 20:63527360-63527382 CAGGCCTGTAGTCCCGAGGCAGG No data
1176136905_1176136915 29 Left 1176136905 20:63527308-63527330 CCCAGCAACTCTCGTACAGACGG No data
Right 1176136915 20:63527360-63527382 CAGGCCTGTAGTCCCGAGGCAGG No data
1176136911_1176136915 -2 Left 1176136911 20:63527339-63527361 CCCAGGCTGGGCGCAGCAGCTCA No data
Right 1176136915 20:63527360-63527382 CAGGCCTGTAGTCCCGAGGCAGG No data
1176136907_1176136915 28 Left 1176136907 20:63527309-63527331 CCAGCAACTCTCGTACAGACGGC No data
Right 1176136915 20:63527360-63527382 CAGGCCTGTAGTCCCGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176136915 Original CRISPR CAGGCCTGTAGTCCCGAGGC AGG Intergenic