ID: 1176138833

View in Genome Browser
Species Human (GRCh38)
Location 20:63536382-63536404
Sequence GAGGCTGTAAAGAGGCCGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176138833_1176138843 4 Left 1176138833 20:63536382-63536404 CCCGACGGCCTCTTTACAGCCTC No data
Right 1176138843 20:63536409-63536431 GCTTGTTGCTTGGGTCCCCCGGG No data
1176138833_1176138842 3 Left 1176138833 20:63536382-63536404 CCCGACGGCCTCTTTACAGCCTC No data
Right 1176138842 20:63536408-63536430 TGCTTGTTGCTTGGGTCCCCCGG No data
1176138833_1176138837 -5 Left 1176138833 20:63536382-63536404 CCCGACGGCCTCTTTACAGCCTC No data
Right 1176138837 20:63536400-63536422 GCCTCCCCTGCTTGTTGCTTGGG No data
1176138833_1176138836 -6 Left 1176138833 20:63536382-63536404 CCCGACGGCCTCTTTACAGCCTC No data
Right 1176138836 20:63536399-63536421 AGCCTCCCCTGCTTGTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176138833 Original CRISPR GAGGCTGTAAAGAGGCCGTC GGG (reversed) Intronic