ID: 1176139590

View in Genome Browser
Species Human (GRCh38)
Location 20:63539142-63539164
Sequence TCTCCCATGCAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176139582_1176139590 -9 Left 1176139582 20:63539128-63539150 CCCCTCCCCTAGGTTCTCCCATG No data
Right 1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG No data
1176139583_1176139590 -10 Left 1176139583 20:63539129-63539151 CCCTCCCCTAGGTTCTCCCATGC No data
Right 1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG No data
1176139579_1176139590 1 Left 1176139579 20:63539118-63539140 CCAGAACCAGCCCCTCCCCTAGG No data
Right 1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG No data
1176139581_1176139590 -5 Left 1176139581 20:63539124-63539146 CCAGCCCCTCCCCTAGGTTCTCC No data
Right 1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG No data
1176139578_1176139590 8 Left 1176139578 20:63539111-63539133 CCAGGTACCAGAACCAGCCCCTC No data
Right 1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG No data
1176139577_1176139590 9 Left 1176139577 20:63539110-63539132 CCCAGGTACCAGAACCAGCCCCT No data
Right 1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG No data
1176139576_1176139590 19 Left 1176139576 20:63539100-63539122 CCTCAGTGGGCCCAGGTACCAGA No data
Right 1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176139590 Original CRISPR TCTCCCATGCAGATGGAGCT GGG Intergenic
No off target data available for this crispr