ID: 1176140779

View in Genome Browser
Species Human (GRCh38)
Location 20:63544158-63544180
Sequence GCCCTTGACCTTGGGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 191}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176140779_1176140785 -9 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140785 20:63544172-63544194 GTCAAGGGCCACTGACCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 149
1176140779_1176140795 10 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140795 20:63544191-63544213 GTGGGGGACAGAGGCAGGAGGGG 0: 1
1: 2
2: 14
3: 187
4: 1311
1176140779_1176140791 5 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140791 20:63544186-63544208 ACCTGGTGGGGGACAGAGGCAGG 0: 1
1: 0
2: 4
3: 66
4: 609
1176140779_1176140793 8 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140793 20:63544189-63544211 TGGTGGGGGACAGAGGCAGGAGG 0: 1
1: 1
2: 22
3: 209
4: 2159
1176140779_1176140796 20 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140779_1176140787 -7 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140787 20:63544174-63544196 CAAGGGCCACTGACCTGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 156
1176140779_1176140788 -6 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140788 20:63544175-63544197 AAGGGCCACTGACCTGGTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1176140779_1176140794 9 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140794 20:63544190-63544212 GGTGGGGGACAGAGGCAGGAGGG 0: 1
1: 0
2: 17
3: 167
4: 1575
1176140779_1176140790 1 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140790 20:63544182-63544204 ACTGACCTGGTGGGGGACAGAGG 0: 1
1: 0
2: 0
3: 35
4: 289
1176140779_1176140786 -8 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140786 20:63544173-63544195 TCAAGGGCCACTGACCTGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176140779 Original CRISPR GCCCTTGACCTTGGGGTGGT TGG (reversed) Intronic