ID: 1176140780

View in Genome Browser
Species Human (GRCh38)
Location 20:63544162-63544184
Sequence AGTGGCCCTTGACCTTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 180}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176140780_1176140796 16 Left 1176140780 20:63544162-63544184 CCACCCCAAGGTCAAGGGCCACT 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140780_1176140795 6 Left 1176140780 20:63544162-63544184 CCACCCCAAGGTCAAGGGCCACT 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1176140795 20:63544191-63544213 GTGGGGGACAGAGGCAGGAGGGG 0: 1
1: 2
2: 14
3: 187
4: 1311
1176140780_1176140791 1 Left 1176140780 20:63544162-63544184 CCACCCCAAGGTCAAGGGCCACT 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1176140791 20:63544186-63544208 ACCTGGTGGGGGACAGAGGCAGG 0: 1
1: 0
2: 4
3: 66
4: 609
1176140780_1176140794 5 Left 1176140780 20:63544162-63544184 CCACCCCAAGGTCAAGGGCCACT 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1176140794 20:63544190-63544212 GGTGGGGGACAGAGGCAGGAGGG 0: 1
1: 0
2: 17
3: 167
4: 1575
1176140780_1176140788 -10 Left 1176140780 20:63544162-63544184 CCACCCCAAGGTCAAGGGCCACT 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1176140788 20:63544175-63544197 AAGGGCCACTGACCTGGTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 218
1176140780_1176140790 -3 Left 1176140780 20:63544162-63544184 CCACCCCAAGGTCAAGGGCCACT 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1176140790 20:63544182-63544204 ACTGACCTGGTGGGGGACAGAGG 0: 1
1: 0
2: 0
3: 35
4: 289
1176140780_1176140793 4 Left 1176140780 20:63544162-63544184 CCACCCCAAGGTCAAGGGCCACT 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1176140793 20:63544189-63544211 TGGTGGGGGACAGAGGCAGGAGG 0: 1
1: 1
2: 22
3: 209
4: 2159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176140780 Original CRISPR AGTGGCCCTTGACCTTGGGG TGG (reversed) Intronic