ID: 1176140782

View in Genome Browser
Species Human (GRCh38)
Location 20:63544166-63544188
Sequence GGTCAGTGGCCCTTGACCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176140782_1176140796 12 Left 1176140782 20:63544166-63544188 CCCAAGGTCAAGGGCCACTGACC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140782_1176140791 -3 Left 1176140782 20:63544166-63544188 CCCAAGGTCAAGGGCCACTGACC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1176140791 20:63544186-63544208 ACCTGGTGGGGGACAGAGGCAGG 0: 1
1: 0
2: 4
3: 66
4: 609
1176140782_1176140795 2 Left 1176140782 20:63544166-63544188 CCCAAGGTCAAGGGCCACTGACC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1176140795 20:63544191-63544213 GTGGGGGACAGAGGCAGGAGGGG 0: 1
1: 2
2: 14
3: 187
4: 1311
1176140782_1176140793 0 Left 1176140782 20:63544166-63544188 CCCAAGGTCAAGGGCCACTGACC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1176140793 20:63544189-63544211 TGGTGGGGGACAGAGGCAGGAGG 0: 1
1: 1
2: 22
3: 209
4: 2159
1176140782_1176140794 1 Left 1176140782 20:63544166-63544188 CCCAAGGTCAAGGGCCACTGACC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1176140794 20:63544190-63544212 GGTGGGGGACAGAGGCAGGAGGG 0: 1
1: 0
2: 17
3: 167
4: 1575
1176140782_1176140790 -7 Left 1176140782 20:63544166-63544188 CCCAAGGTCAAGGGCCACTGACC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1176140790 20:63544182-63544204 ACTGACCTGGTGGGGGACAGAGG 0: 1
1: 0
2: 0
3: 35
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176140782 Original CRISPR GGTCAGTGGCCCTTGACCTT GGG (reversed) Intronic