ID: 1176140789

View in Genome Browser
Species Human (GRCh38)
Location 20:63544180-63544202
Sequence TCTGTCCCCCACCAGGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176140789_1176140802 24 Left 1176140789 20:63544180-63544202 CCACTGACCTGGTGGGGGACAGA 0: 1
1: 0
2: 3
3: 22
4: 219
Right 1176140802 20:63544227-63544249 CTGACAGTGAGTAGCCCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1176140789_1176140796 -2 Left 1176140789 20:63544180-63544202 CCACTGACCTGGTGGGGGACAGA 0: 1
1: 0
2: 3
3: 22
4: 219
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176140789 Original CRISPR TCTGTCCCCCACCAGGTCAG TGG (reversed) Intronic