ID: 1176140792

View in Genome Browser
Species Human (GRCh38)
Location 20:63544187-63544209
Sequence TCCTGCCTCTGTCCCCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 843
Summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 755}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176140792_1176140803 30 Left 1176140792 20:63544187-63544209 CCTGGTGGGGGACAGAGGCAGGA 0: 1
1: 0
2: 5
3: 82
4: 755
Right 1176140803 20:63544240-63544262 GCCCCCGAGGCTGCTCTCGCTGG 0: 1
1: 0
2: 5
3: 64
4: 357
1176140792_1176140802 17 Left 1176140792 20:63544187-63544209 CCTGGTGGGGGACAGAGGCAGGA 0: 1
1: 0
2: 5
3: 82
4: 755
Right 1176140802 20:63544227-63544249 CTGACAGTGAGTAGCCCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1176140792_1176140796 -9 Left 1176140792 20:63544187-63544209 CCTGGTGGGGGACAGAGGCAGGA 0: 1
1: 0
2: 5
3: 82
4: 755
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176140792 Original CRISPR TCCTGCCTCTGTCCCCCACC AGG (reversed) Intronic