ID: 1176140796

View in Genome Browser
Species Human (GRCh38)
Location 20:63544201-63544223
Sequence GAGGCAGGAGGGGCCGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 0, 2: 8, 3: 73, 4: 697}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176140783_1176140796 11 Left 1176140783 20:63544167-63544189 CCAAGGTCAAGGGCCACTGACCT 0: 1
1: 0
2: 1
3: 23
4: 192
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140789_1176140796 -2 Left 1176140789 20:63544180-63544202 CCACTGACCTGGTGGGGGACAGA 0: 1
1: 0
2: 3
3: 22
4: 219
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140792_1176140796 -9 Left 1176140792 20:63544187-63544209 CCTGGTGGGGGACAGAGGCAGGA 0: 1
1: 0
2: 5
3: 82
4: 755
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140781_1176140796 13 Left 1176140781 20:63544165-63544187 CCCCAAGGTCAAGGGCCACTGAC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140782_1176140796 12 Left 1176140782 20:63544166-63544188 CCCAAGGTCAAGGGCCACTGACC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140779_1176140796 20 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140780_1176140796 16 Left 1176140780 20:63544162-63544184 CCACCCCAAGGTCAAGGGCCACT 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140775_1176140796 28 Left 1176140775 20:63544150-63544172 CCTAGAGACCAACCACCCCAAGG 0: 1
1: 0
2: 1
3: 13
4: 187
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176140796 Original CRISPR GAGGCAGGAGGGGCCGCCCC AGG Intronic
900013647 1:135340-135362 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900014411 1:138306-138328 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900043717 1:491323-491345 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900044276 1:493508-493530 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900065155 1:726326-726348 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900065684 1:728414-728436 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900148663 1:1168922-1168944 GAGGTGGCAGGAGCCGCCCCCGG + Intergenic
900243350 1:1627023-1627045 GTGGGAGGTGGGGCTGCCCCTGG + Intronic
900344350 1:2204015-2204037 CAGGCTGGAGGGGCTGCCCCAGG - Intronic
900361031 1:2289234-2289256 GAGGCAGGAGGGCCACCTCCGGG - Intronic
900511151 1:3061801-3061823 GAAGCTGGAGGGGCTGCCCGAGG + Intergenic
900527870 1:3137959-3137981 GTGGCTGGAGGGTCCGTCCCTGG + Intronic
900589786 1:3454532-3454554 GACGCAGGCGGCGCCGCCACAGG + Exonic
900662014 1:3789498-3789520 GAGGCGGGCGGGGCCCCACCGGG + Intronic
900677164 1:3894849-3894871 GAGGACGGAGGCGCAGCCCCCGG - Intronic
900715461 1:4141011-4141033 GTGGCAGGAAGGGCAGCCCTTGG - Intergenic
901382563 1:8884313-8884335 GAGGCAGGAGTGCCGGCCCCTGG + Intergenic
901450527 1:9333896-9333918 GAGGCAGGTGGGGCCTGGCCAGG + Intronic
901633652 1:10659786-10659808 GAGGCAGGAGGCTCTGGCCCTGG + Exonic
901781964 1:11600037-11600059 GGGGCAGGAGGGGCTGCCGCCGG + Intergenic
902070077 1:13727035-13727057 GAGGCAGGAGGGGCAGGCAGGGG - Intronic
902117921 1:14137089-14137111 GAGGAAGGAAGGGCCGCTGCTGG + Intergenic
902331933 1:15735081-15735103 GAGGCAGGAGCGTCCTGCCCCGG - Intergenic
902565387 1:17308042-17308064 GAGGTCCGAGGGGCAGCCCCAGG + Intergenic
902936608 1:19769301-19769323 GAGGGGTGAGGGGCTGCCCCCGG - Intronic
902982804 1:20137974-20137996 GGGGCAGGAAGGGAAGCCCCAGG + Intergenic
903140962 1:21338979-21339001 TAAGCAGGAGGAGCAGCCCCTGG - Intronic
903334765 1:22617477-22617499 GAGGCAGGAGAAGAAGCCCCTGG + Intergenic
903849033 1:26295346-26295368 GGGGAAGCAGGCGCCGCCCCTGG - Intronic
904034565 1:27551838-27551860 GAGACAGGACGGGCTGCCCGTGG + Exonic
904279211 1:29406966-29406988 GAGTCAGGAGAGGCCACCTCAGG - Intergenic
904445587 1:30570918-30570940 GAGGCAGCAGGGGAGGTCCCAGG - Intergenic
904567167 1:31434866-31434888 GAGGAAGGAGGGGCAGACCAGGG + Intergenic
904607154 1:31704205-31704227 GAGGCAGGAGGGGCGGGCCTGGG - Exonic
905633319 1:39531129-39531151 GAGGAAGTAGGAGCCACCCCTGG + Intergenic
905791390 1:40791541-40791563 GGCACAGGAGGGGCAGCCCCAGG + Intronic
906107558 1:43304045-43304067 GAGCCAGGGAGGGCAGCCCCAGG - Intronic
907405597 1:54251733-54251755 GAGGGAGGAGGAGCCCCTCCTGG + Intronic
907459138 1:54594770-54594792 GAGGCAGGAAGGGAGGCTCCGGG + Intronic
911047778 1:93642788-93642810 GTGGGTGGAGGGGCTGCCCCAGG + Intronic
912384752 1:109265751-109265773 GAGGCAGGTGGGGCTGCCTGGGG - Exonic
912570496 1:110617736-110617758 GAGTGTGGAGGGGCCGCCACAGG + Intronic
913090051 1:115470461-115470483 GAGGAAGGAGGGGCCGAGCCAGG - Intergenic
913137110 1:115902350-115902372 GAGGCAGGAGCTACCGCCCCCGG - Intergenic
914702873 1:150150130-150150152 GAGGGAGGAGCGGCGGCGCCGGG + Exonic
915070395 1:153261314-153261336 GAAGCAGCCGGAGCCGCCCCCGG - Exonic
915070411 1:153261359-153261381 GAAGCAGCCGGAGCCGCCCCCGG - Exonic
915070437 1:153261458-153261480 GAAGCAGCCGGAGCCGCCCCCGG - Exonic
915490441 1:156247435-156247457 TGGGCAGGCGGAGCCGCCCCAGG + Intronic
915502437 1:156328228-156328250 GAGGTAGGGGGGTCAGCCCCCGG + Intronic
917789782 1:178492186-178492208 GAGGCAGGAGGATCAGCCACCGG + Intergenic
917930675 1:179820639-179820661 GAGGCAGCAGGGCCCCCCACAGG + Intergenic
917931088 1:179823399-179823421 GAGGCAGCAGGGCCCCCCACAGG + Intergenic
918407569 1:184225957-184225979 GAGGCAGGAGGAGCGGGGCCTGG - Intergenic
919639762 1:200036499-200036521 GAGGCAGGGGCGGCGGCACCAGG - Intronic
919769030 1:201145366-201145388 GTTGCAGGAGGGGCTGCCTCAGG + Intronic
920216914 1:204367440-204367462 GAGGCAGGAGACGCAGCCGCGGG - Intronic
920375942 1:205508044-205508066 GAGGTAGGAGGACCCTCCCCTGG + Intronic
920455376 1:206097223-206097245 GAGGCAGGAGGGAGGGACCCTGG - Intronic
921039534 1:211416659-211416681 GAGGCAGCAGCGGCGGCGCCGGG + Intergenic
921089375 1:211829493-211829515 GAGGGAGGAGGAGCCGCACAAGG + Intronic
922100060 1:222472335-222472357 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922100265 1:222473163-222473185 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922100466 1:222473963-222473985 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922141570 1:222893556-222893578 GTGGCAGGGCGGGCAGCCCCAGG + Intronic
922244009 1:223777221-223777243 GAGGAAGGAGAGGCCGCAGCAGG - Intergenic
922262084 1:223951801-223951823 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG + Intronic
922734184 1:227970777-227970799 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
922734980 1:227973913-227973935 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
923475093 1:234324741-234324763 GAGGAGGGAGAGGCTGCCCCAGG - Intergenic
924343258 1:243054000-243054022 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
924343729 1:243055880-243055902 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
924624061 1:245685702-245685724 GAGGCAGGAGAGGCTGCAGCCGG + Exonic
1062854331 10:772243-772265 AATGGAGGAGGGGCTGCCCCGGG + Intergenic
1062902359 10:1156048-1156070 GAGGCAGGAAGGGCCCTCCATGG - Intergenic
1062938086 10:1402692-1402714 GGGGCAGGAGGGGTGGCCCCAGG - Intronic
1062998333 10:1890045-1890067 GAGGCGGGAAGGGCCTCCCGAGG + Intergenic
1063385065 10:5611270-5611292 AAGGCAGGTGGTGCCTCCCCAGG - Intergenic
1063995113 10:11611622-11611644 GCGGCAGGAGGTGTCGCGCCGGG - Intronic
1064301513 10:14127130-14127152 GAGGCAGGAAAGTCTGCCCCTGG + Intronic
1064662199 10:17617386-17617408 GGGGGAGGAGCGGACGCCCCCGG + Intergenic
1064714933 10:18167029-18167051 GAGGCTGGAGGGCCAGCCCAGGG - Intronic
1066733234 10:38451592-38451614 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1067180239 10:43979816-43979838 GAGGGTGGAGGAGCAGCCCCTGG + Intergenic
1067242448 10:44508139-44508161 GAGGAAGGCAGGGCCGGCCCTGG + Intergenic
1067419513 10:46134063-46134085 GGGGCAGGAAGGGCTGGCCCAGG + Intergenic
1067458530 10:46440666-46440688 GAGCCAGGAGTGTCTGCCCCAGG + Intergenic
1067504865 10:46840660-46840682 GGGGCAGGAAGGGCTGGCCCAGG + Intergenic
1067628669 10:47943970-47943992 GAGCCAGGAGTGTCTGCCCCAGG - Intergenic
1067694276 10:48523944-48523966 GAGGCAGGTGCGGGCGGCCCTGG + Intronic
1069822197 10:71235015-71235037 GGGGGAGGAGGGGCCCCCCTGGG - Intronic
1069902565 10:71714495-71714517 GAGACAGTAGGGGCGGCTCCAGG + Exonic
1071511752 10:86266551-86266573 TGGGCAGGAGGGCCCTCCCCTGG - Intronic
1071519453 10:86320010-86320032 CAGGCACGAGGGGAGGCCCCAGG - Intronic
1072521261 10:96231904-96231926 GGGGCAGGAGGTGCCGTCCTGGG + Intronic
1073068637 10:100779550-100779572 GGGACAGGAGTGACCGCCCCTGG + Exonic
1073217838 10:101846340-101846362 GAGGCAGGAGAGGCTGCCAGAGG + Exonic
1073254357 10:102141392-102141414 GGGGCAGGAGGGGGTGCCCAAGG - Exonic
1075649768 10:124119765-124119787 GGGGCATGAGGGGCTGCCCATGG - Intergenic
1075885390 10:125895925-125895947 GGGGCTCGAGGGACCGCCCCAGG + Intronic
1076158515 10:128222639-128222661 GAGGCAGGCGGGGAGGGCCCCGG + Intergenic
1076337817 10:129720374-129720396 GAGCCAGGAGGGGCCGAGGCTGG - Intronic
1076588084 10:131563623-131563645 GAGGCAGGGGGGACCCTCCCTGG - Intergenic
1076969991 11:127554-127576 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1076970608 11:129983-130005 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1077008145 11:368923-368945 GCGGCAGGAGGGGCCTCAGCTGG - Intergenic
1077013562 11:390507-390529 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077013592 11:390592-390614 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077013622 11:390677-390699 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077013652 11:390762-390784 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077013682 11:390847-390869 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077013712 11:390932-390954 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077014393 11:393385-393407 CAGGGGGGCGGGGCCGCCCCAGG - Intronic
1077102826 11:829745-829767 CAGGGAGGAGGGGCAGCGCCGGG + Intronic
1077137728 11:1009553-1009575 GGGTCTGGAGGGGCGGCCCCGGG + Intronic
1077137747 11:1009603-1009625 GGGTCTGGAGGGGCGGCCCCGGG + Intronic
1077144359 11:1037960-1037982 GGGGCAGGTGGGGCAGCTCCCGG - Intergenic
1077244909 11:1531993-1532015 GAGGCAACAGGAGCCACCCCTGG - Intergenic
1077328004 11:1971949-1971971 CAGGCACGTGGGGCCACCCCAGG + Intronic
1077539711 11:3140773-3140795 TGGACATGAGGGGCCGCCCCAGG - Intronic
1077602085 11:3581071-3581093 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
1079284627 11:19117491-19117513 GAGGCTGGAGGGGCCGGCTCGGG - Intronic
1079969320 11:27017169-27017191 GAGGCAGGAAGGGCAGGCACAGG - Intergenic
1082260225 11:50072480-50072502 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1082786983 11:57322692-57322714 GAGGAAGGAGGAGCCGGCCCAGG + Intronic
1083295707 11:61714400-61714422 GAGGCAGGAGAGCCAGCCGCAGG + Intronic
1083572627 11:63768566-63768588 GCGGCGGCAGGGGCGGCCCCGGG - Exonic
1083644582 11:64165147-64165169 GAGGCAGGACAGGCCAGCCCAGG + Intronic
1083648216 11:64185456-64185478 GAGGCAGGAGGGCCGGGCCGAGG + Exonic
1083672139 11:64305643-64305665 GGCGGAGGAGGGGCCGCCCGCGG + Intronic
1083695786 11:64441353-64441375 GGGGCATGAGGGGCCTCCCCGGG - Intergenic
1083775542 11:64892900-64892922 GAGACAGAGGGGGCCGCCCAAGG + Intergenic
1084129200 11:67119788-67119810 GGGGGAGGCGGGGGCGCCCCGGG + Exonic
1084257988 11:67955626-67955648 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
1084416074 11:69033673-69033695 GAGGTGGGAGGGGAGGCCCCGGG - Intergenic
1084428387 11:69097868-69097890 GAGGCTGGAGGTGCCCTCCCCGG + Intergenic
1084544429 11:69807622-69807644 GAGTCAGGAAAGGCCGCCCCAGG - Intergenic
1084564177 11:69920202-69920224 GAGGAAGGAGGGGTCACCCTAGG - Intergenic
1084586388 11:70065222-70065244 GAGCCGGGTGGGGCTGCCCCAGG + Intergenic
1084668828 11:70593083-70593105 CAGGCAGCAGGGGCAGCCACAGG - Intronic
1084701297 11:70787846-70787868 GAAGCAGGGGTGGCCGGCCCAGG - Intronic
1084943988 11:72629172-72629194 GGAGCAGGTGGGGCCGACCCAGG + Intronic
1086064524 11:82732454-82732476 GGGGGAGGAGGGGGCGCACCGGG - Exonic
1086863005 11:91947415-91947437 GAGTCAGGAGGGGCCACCCCTGG + Intergenic
1087505913 11:99020853-99020875 GAGGGGCGAGGGGCCGCCCCGGG + Intergenic
1088991806 11:114960500-114960522 GAGGCAGGAGTGGCCTCCCAAGG + Intergenic
1089533837 11:119149179-119149201 GAGGCAGGAGGGCCGGCCCTCGG - Exonic
1089613968 11:119684929-119684951 GAGGCAGGAGGGGGCAGCCTGGG - Intronic
1089619472 11:119714133-119714155 GAGGCAGGAGCGGCAGCCTCTGG + Intronic
1090954342 11:131501264-131501286 AAGGCAGGAGGGGCAGCCTGGGG + Intronic
1091176386 11:133562095-133562117 GACACAGGAGGGGCCGCTGCTGG - Intergenic
1091300068 11:134502038-134502060 GAGGCAGGAGGTGGGGCTCCGGG + Intergenic
1202810983 11_KI270721v1_random:27129-27151 CAGGCACGTGGGGCCACCCCAGG + Intergenic
1091629186 12:2146524-2146546 GCCACAGGAGGGGCAGCCCCGGG + Intronic
1091750089 12:3016943-3016965 GAGGCAGGAGGGGCCACAGGAGG + Intronic
1092123732 12:6061644-6061666 GAGGCAGGAGGAGGCTCTCCAGG + Intronic
1092197042 12:6555842-6555864 GCGGCAGGCGGGGCCGGGCCCGG + Exonic
1092428227 12:8390423-8390445 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
1092429313 12:8396576-8396598 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
1092727581 12:11500262-11500284 GAGACAGGAAGGGCTGCCCTGGG + Intronic
1092954882 12:13540794-13540816 GAGGAAGGAGAGCCGGCCCCAGG + Exonic
1094041515 12:26125123-26125145 GGGGGAGGAGGGGCCGGGCCGGG + Exonic
1095672422 12:44876392-44876414 GAGGAGGGAGGGGCCGCCGAGGG + Intronic
1096654072 12:53077676-53077698 CAGGCAGGAAGGGCAGCCACAGG + Intronic
1097191965 12:57223794-57223816 GAGGCAGGAGCGGCCGGGCCAGG - Intronic
1100391460 12:94148949-94148971 GGGGCTGGGGGGGCCGCCCCCGG - Exonic
1100712702 12:97275235-97275257 GAGACAGGAGGGGCCACACTTGG + Intergenic
1101872429 12:108577135-108577157 GGGGCAGGATGGGAGGCCCCTGG - Intergenic
1102043785 12:109817197-109817219 GAGGCAGGAGGGGCATCTGCAGG + Intronic
1102466998 12:113135768-113135790 GGGGCGGGAGGGGCGGCCCAGGG + Intronic
1103571344 12:121847036-121847058 GATCCAGGTGAGGCCGCCCCTGG - Exonic
1103946717 12:124531352-124531374 ACGGCAGGAGGGGCATCCCCCGG + Intronic
1104849432 12:131864268-131864290 GATGGAGGAGGAGCCACCCCTGG - Intergenic
1104981688 12:132575835-132575857 GGACCAGGAGGGGCCGGCCCAGG + Intronic
1104982708 12:132581435-132581457 GAGGCAGGATGGGCGGCACCTGG - Exonic
1106079311 13:26487479-26487501 GAGGAAGCAGGGGCCGTCCACGG - Intergenic
1109780881 13:67108024-67108046 GTGGCAGGACGGGCAGCTCCAGG - Intronic
1109944980 13:69421023-69421045 GGGGCAGGAGGGGCCTTCCTGGG + Intergenic
1110195274 13:72781688-72781710 GGCGCACGAGGGGCCGGCCCTGG - Exonic
1112041505 13:95552665-95552687 GAGGCGGGAGGCGGAGCCCCGGG + Intronic
1113164581 13:107424414-107424436 CAGGCAGGAGCCACCGCCCCTGG + Intronic
1113454511 13:110438562-110438584 TTGGCTGGAGGGGCCGCCCCTGG + Intronic
1113784784 13:112996758-112996780 GAGAGAGGAGGGGCGGCACCAGG - Intronic
1113800855 13:113085656-113085678 GTGGCAGGAGGGAGCTCCCCGGG + Intronic
1113800873 13:113085713-113085735 GTGGCAGGAGGGAGCTCCCCGGG + Intronic
1113800891 13:113085770-113085792 GTGGCAGGAGGGAGCTCCCCGGG + Intronic
1113800910 13:113085827-113085849 GTGGCAGGAGGGAGCTCCCCGGG + Intronic
1113800929 13:113085884-113085906 GTGGCAGGAGGGAGCTCCCCGGG + Intronic
1113850381 13:113414372-113414394 GAGGAAGGGGGGGCGGCTCCAGG - Intergenic
1113894571 13:113755388-113755410 GAGGCAGGTGGGGCCTGCTCAGG + Intergenic
1116435027 14:44887068-44887090 CAGGCGGCAGGGGCCGGCCCAGG - Intergenic
1116748562 14:48852316-48852338 CAGGCATGAGCGGCCGACCCTGG - Intergenic
1116846410 14:49868307-49868329 GAGGGAGGCGGGGCCGCCGGCGG + Intergenic
1116945300 14:50830755-50830777 GCGGGAGGAGGGGCCGGTCCCGG - Intronic
1119213329 14:72849398-72849420 GAGGCAGCCGGGGCAGCCCAGGG - Intronic
1121671468 14:95713898-95713920 GAGGCAGCAGGGGCAGCCCCTGG - Intronic
1121751661 14:96363073-96363095 AGGGATGGAGGGGCCGCCCCAGG - Exonic
1122113660 14:99517415-99517437 GAGGCAAGAGGGGCAGTCCAGGG + Intronic
1122208231 14:100159168-100159190 GAGGGCGCAGGGGCGGCCCCGGG - Intronic
1122523449 14:102363092-102363114 GAGTCCGGAGGGGCTGCCGCGGG + Exonic
1122541470 14:102499948-102499970 GTGGCAGCAGAGGCAGCCCCAGG + Exonic
1122602977 14:102930412-102930434 GAGGCACGAGGCGGCGGCCCCGG + Exonic
1122784081 14:104155906-104155928 GAGGCTGGAGGGGCTGCAGCAGG - Intronic
1122824476 14:104362914-104362936 GAGGCACGGGGTGCCGACCCAGG - Intergenic
1122836615 14:104433853-104433875 GAGGTAGCAGGGGCCACCTCAGG - Intergenic
1123068331 14:105629106-105629128 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1123072340 14:105647911-105647933 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1123092350 14:105747430-105747452 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1123097926 14:105775131-105775153 GAGGGAGGAGGAGAGGCCCCAGG - Intergenic
1124369740 15:29097358-29097380 GAGGGAGGAGGGCCAGCCCCCGG - Intronic
1124475166 15:30026828-30026850 GAGGCAGGAAGAGCCCCCGCAGG + Intergenic
1124907723 15:33886873-33886895 GTGGCAAGAAGGGCCTCCCCAGG - Intronic
1124960750 15:34392112-34392134 GAAGCAGGAGGGGGCACACCAGG + Intronic
1124977379 15:34538333-34538355 GAAGCAGGAGGGGGCACACCAGG + Intronic
1127454175 15:59142674-59142696 GTGTGAGCAGGGGCCGCCCCTGG - Intronic
1128087328 15:64895051-64895073 GAGGTTAGAGGAGCCGCCCCAGG + Intronic
1128982619 15:72198032-72198054 GGGACAGGAGGTGCCGCGCCAGG - Intergenic
1129119684 15:73388458-73388480 GAAGAGGGAGGGGCCTCCCCTGG + Intergenic
1129199493 15:73990429-73990451 GAGGCAGGAGGGCCAGCTCTGGG + Exonic
1129264483 15:74386571-74386593 GGAGAAGGAGGGGCCTCCCCAGG + Intergenic
1129363945 15:75043053-75043075 CAGGCAGGAGGGGCCACCCAAGG - Intronic
1129389865 15:75215092-75215114 GATACAGGAGGGGCCTGCCCTGG - Intergenic
1129494932 15:75970496-75970518 TAGGCAGCAGGGACCGTCCCAGG + Intronic
1129518409 15:76170841-76170863 GGGTCAGGAGGGGCCACCCGGGG + Intronic
1129661393 15:77554858-77554880 GAGGGAGGAGGGGCTGCTGCTGG + Intergenic
1129712188 15:77826053-77826075 GGGGCTGGAGGGGACCCCCCAGG + Intergenic
1129786652 15:78314297-78314319 GAGGAAGGAGGGGGAGCCTCAGG + Intergenic
1132244783 15:100286025-100286047 GAGCTATGATGGGCCGCCCCTGG - Intronic
1132311237 15:100859456-100859478 GAGACAGGAGGAGAAGCCCCAGG - Intergenic
1132385884 15:101399543-101399565 GAGGCAAGAAGGGACGCCCCTGG - Intronic
1132696467 16:1204322-1204344 CAGGCTGGATGGGCCGCCTCTGG + Exonic
1132915207 16:2340384-2340406 GCGGCAGGAGGGGCGGGCGCGGG + Intronic
1132937374 16:2488008-2488030 GGGGCAGGAGGGGCCCCAGCGGG - Intronic
1132978413 16:2721567-2721589 GAGGCGGGCTGGGCAGCCCCTGG + Intergenic
1133041933 16:3065442-3065464 GAGGAATGAGGGTCCGTCCCTGG - Exonic
1133113749 16:3564546-3564568 GAGGCAGGAAGAGCCGGTCCAGG + Exonic
1133270798 16:4610024-4610046 GAGGCAGTGGGGGCCCCTCCAGG - Intronic
1133320210 16:4909075-4909097 GAGGCAGGAGGTGGAGGCCCAGG + Intronic
1133369996 16:5239930-5239952 GAGGCAGGGATGGCCGGCCCAGG + Intergenic
1134077633 16:11303200-11303222 GAGGCAGGAGGAAAGGCCCCAGG - Intronic
1135969738 16:27063613-27063635 GAGGCAGGAGGTTGGGCCCCAGG - Intergenic
1135976122 16:27109872-27109894 GAAGGAGGGGCGGCCGCCCCCGG - Intergenic
1136008774 16:27348819-27348841 AAGGCAGGAGTGGCTTCCCCAGG + Intronic
1136011625 16:27367264-27367286 AGGGCAGGAGGGGACGCCCCTGG + Intergenic
1136464209 16:30430631-30430653 GAGGCTGGAGAGGCCGGCACAGG - Intergenic
1136608491 16:31352438-31352460 GAGGCAGGAGAGGAGGACCCTGG - Intergenic
1137711654 16:50571098-50571120 GGGGAAGGAGGGGCTGCCCATGG + Intronic
1138029656 16:53550390-53550412 GAGGCAGGACTGACAGCCCCGGG - Intergenic
1138030566 16:53556434-53556456 CAGTGAGGAGGGGGCGCCCCAGG - Intergenic
1139290088 16:65849923-65849945 GTGGCAGGAGGGTCCTCCCAAGG + Intergenic
1139402984 16:66696771-66696793 GAGGCGGGAGCGGGCGCGCCGGG + Intergenic
1139428188 16:66895983-66896005 GAGGCTGGAGAGGCCACCCTGGG - Intergenic
1139599603 16:67978677-67978699 GAGGCAGGAGTGGCAGGCCTAGG - Intronic
1140368331 16:74398410-74398432 GAGGCAGGAGACACAGCCCCCGG + Intergenic
1141648645 16:85380559-85380581 GAGGGATGAGAGGCCTCCCCCGG - Intergenic
1141698974 16:85633797-85633819 CAGGGAGCAGGGGCAGCCCCGGG - Intronic
1141839778 16:86567204-86567226 GGAGCGGGAGGGGCGGCCCCGGG - Intergenic
1141995419 16:87634097-87634119 GAGGCAGGAGGGACAGGCACGGG + Intronic
1142078002 16:88131641-88131663 GAGGCAGGCTGGGGCGCTCCTGG + Intergenic
1142235381 16:88920050-88920072 GAGGCAGGAACGCCCACCCCAGG - Intronic
1142278622 16:89136540-89136562 GTGGCAGGAGGGGCTGGCCAGGG - Intronic
1142356379 16:89603836-89603858 GAGGCTGGAGGGGAAGCCCTGGG + Intergenic
1142356472 16:89604097-89604119 GAGGCTGGAGGGGAAGCCCTGGG + Intergenic
1142449640 16:90167499-90167521 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1142450688 16:90171578-90171600 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1142456877 17:62113-62135 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1142509799 17:386164-386186 GGGGGAAGCGGGGCCGCCCCGGG - Intronic
1142592034 17:1010484-1010506 GAAGCAGAAGGGGCTGCCCATGG + Intronic
1142695880 17:1633381-1633403 GAGATAGAAGGGGCTGCCCCTGG + Intergenic
1142760937 17:2041640-2041662 GAGGGAGGAGAGACCGCGCCTGG + Intronic
1142824769 17:2502391-2502413 GAGGCATGAGGCACCGCACCCGG - Intronic
1142953591 17:3504834-3504856 CAGGCAGGAGCCGCCGCACCAGG + Intronic
1143165176 17:4893957-4893979 GAGGAAGGTGGGGCCCCTCCAGG - Intronic
1143596119 17:7915381-7915403 AAGGCAGGAGGGAACGCCCTGGG - Intergenic
1143683362 17:8494148-8494170 GACGCAGGAGGGGAGGCCTCGGG - Intronic
1143754160 17:9054368-9054390 GAGGCAGGTCGGGCCGACCTGGG - Intronic
1144733076 17:17539968-17539990 GGAGCAGGAGGGCCCACCCCAGG + Intronic
1144955622 17:19017545-19017567 GAGGCTGGAGGAGCCGTCACAGG + Intronic
1145222337 17:21099650-21099672 GAAGCAGGAGCTGCCTCCCCAGG + Intergenic
1145255072 17:21317961-21317983 GAGGCAGGGGTGGGCGCCCGGGG - Intergenic
1146793173 17:35764376-35764398 CAGGGAGGAGGGGCTGCCCCAGG + Intronic
1146847818 17:36195600-36195622 GAGTCAGGAAGGGCTGCCCCAGG - Intronic
1147355707 17:39894641-39894663 CAGGCAGGAGCCGCCGCGCCTGG + Intergenic
1147900272 17:43779024-43779046 GAGCCCGGCGGGCCCGCCCCAGG - Intergenic
1148431800 17:47649437-47649459 GGGGCACGATGGGACGCCCCCGG - Intergenic
1148910588 17:50940335-50940357 GAGGGAAGAGGGGGAGCCCCCGG - Intergenic
1149271875 17:54988494-54988516 CAGGCATGAGGCACCGCCCCTGG - Intronic
1150129163 17:62657646-62657668 GAGGCTGGAGGGGCCCTCTCTGG + Intronic
1150255567 17:63741687-63741709 GAGCCAGGAGGGACTGGCCCCGG + Intronic
1151802334 17:76385567-76385589 AAGGCAGGAGCCGCCGCCACGGG + Exonic
1151803470 17:76391244-76391266 GAGGATGGAGGGCCAGCCCCAGG - Exonic
1152246136 17:79185470-79185492 GAGGCAGCAAGGGCCACTCCAGG - Intronic
1152275405 17:79353792-79353814 GAGGCACGAGGGGCCCCCACTGG + Intronic
1152428951 17:80236814-80236836 GAGGCAGGAGACGCCCCCACCGG - Intronic
1152566251 17:81101722-81101744 CCGGCAGGAGGGGCCTCTCCAGG - Intronic
1152596336 17:81239477-81239499 GGGGCAGGAGGAGCCGCGCGGGG + Intronic
1152613950 17:81329484-81329506 GAGGGAGGAGGGTCCGGGCCAGG + Intronic
1152621551 17:81367380-81367402 GAGGTGGGCGGGGCCTCCCCAGG - Intergenic
1152748744 17:82052850-82052872 GAGGCAGGAGGACCAGCCCCCGG - Intronic
1152867954 17:82735517-82735539 GCGGCGGGAGGGGCGGCCTCAGG - Intergenic
1153314784 18:3711079-3711101 GAGCCAGGAGGGGCCGCCCTGGG + Intronic
1153515425 18:5896278-5896300 GGAGCAGGAGGGGCTGCCCAAGG - Intergenic
1153560129 18:6363282-6363304 GAGCCATCAGGGGCTGCCCCTGG - Intronic
1153766920 18:8383889-8383911 GAGGCACTAGGTGCCACCCCAGG - Intronic
1155282297 18:24251729-24251751 AAGGCAGCAGGGGCCGATCCTGG + Intronic
1156585300 18:38425272-38425294 GAGGCAGGAATGACAGCCCCAGG - Intergenic
1157338270 18:46756842-46756864 TCGGCGGGAGGGGCCGCCTCCGG - Exonic
1157493418 18:48139182-48139204 GAGGCAGGAGGGGGAGTCACTGG + Intronic
1157517033 18:48318403-48318425 AAGGCAGAAGGGGCCTCTCCAGG - Intronic
1157519540 18:48336095-48336117 GAGGCAGGAGGGGTGGGTCCAGG - Intronic
1157816011 18:50729853-50729875 GAGGGCGGAGGGGCCGCTCCAGG + Exonic
1158532744 18:58278348-58278370 GAGGCAGGAGGGGCAGGGCCTGG - Intronic
1160048315 18:75408022-75408044 GTGGCAGCAGTGGCCGCACCAGG + Exonic
1160371325 18:78374034-78374056 GAGGCAGCAGGGGCTGCACTTGG + Intergenic
1160569555 18:79807607-79807629 GAGGGAGGAAGGGCTGGCCCAGG - Intergenic
1160571148 18:79818411-79818433 GAGGAGGGAGGGGCCGCCCTGGG - Intergenic
1160613967 18:80109728-80109750 GTGGGAGCGGGGGCCGCCCCGGG + Intronic
1160646789 19:197472-197494 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1160669062 19:348081-348103 GAGGCTGGAGAGGGTGCCCCTGG + Intergenic
1160694819 19:478362-478384 GAGGCAGGTGGGGCCGAGTCCGG - Intergenic
1160763791 19:798188-798210 GGGGCCGGAGGGGCCTCTCCAGG + Intronic
1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG + Intronic
1160839254 19:1138234-1138256 GAGGCACCAGGGGCTGCCCTGGG + Intronic
1160919922 19:1514476-1514498 CAGGCATGAGGCGCCGCGCCCGG - Intergenic
1160991999 19:1863827-1863849 GAGGCCGGAGTGGGCGCGCCGGG - Intergenic
1161003892 19:1924909-1924931 GAGGCAGGGAGGGTGGCCCCAGG - Exonic
1161069559 19:2253347-2253369 GAGGCAGGAGGGGTTGCACAAGG + Intronic
1161201843 19:3019475-3019497 GAGGCAGGATGGGCCGGGGCGGG + Intronic
1161215774 19:3094503-3094525 GAGGCGGGGCGGGCCGGCCCGGG + Exonic
1161238630 19:3209919-3209941 GAGGCAGGAAGGACCCGCCCTGG - Intergenic
1161357150 19:3825470-3825492 GAGGCAGGAAGGGCCTCCACGGG + Intronic
1161364181 19:3868789-3868811 GAAGCAGGCGGGGCGGCCTCAGG - Intronic
1161487893 19:4545615-4545637 TAGGCAGGAGCTGCCGCGCCTGG + Intronic
1161666174 19:5578345-5578367 GCGGCAGGAGGGGCCCAACCGGG + Intergenic
1161775603 19:6260522-6260544 GAGGCAGGTGGGGCAGGGCCTGG - Intronic
1162030255 19:7914237-7914259 GAGGCAGGAGAGACTCCCCCAGG - Exonic
1162124945 19:8494377-8494399 GAAGCAGAAGGGGCCCCACCAGG + Intronic
1162268983 19:9598727-9598749 GAAGAACCAGGGGCCGCCCCTGG + Intergenic
1162733747 19:12734399-12734421 GCGGCAGGAGGAGCCGCCCCCGG - Exonic
1162914212 19:13865557-13865579 GAGGCCGGGGCGCCCGCCCCGGG - Intronic
1162937157 19:13986955-13986977 GGGGCAGCAGGGGCCCCTCCAGG - Intronic
1162995742 19:14333823-14333845 GAGGCTGGAGGGGAAGACCCAGG + Intergenic
1163000562 19:14363983-14364005 GAGGCAGGAGGGGCCACGAGCGG - Intergenic
1163032449 19:14553448-14553470 GAGGCTGGTGCAGCCGCCCCCGG + Intronic
1163106427 19:15125479-15125501 GAGGCACGAGGTCACGCCCCCGG + Intronic
1163304099 19:16466623-16466645 CAGGCAGGAGGCACCGCGCCTGG - Intronic
1163427116 19:17245809-17245831 CAGGCAGGAGCGGCCGCAGCGGG - Exonic
1163441321 19:17323890-17323912 GAGGCGAGAGGGGCCGTTCCGGG + Intronic
1163554174 19:17983208-17983230 GAGGCAGGAGGGGCTCCGCCAGG + Intronic
1163604540 19:18266822-18266844 GTGGCAGGAAGGCCAGCCCCCGG + Exonic
1164137499 19:22427816-22427838 GAGGCCGAAGGTGCCGCCCCTGG + Intronic
1164594450 19:29524706-29524728 GAGGCAAGAAGGGCTGGCCCCGG + Intergenic
1164952162 19:32345793-32345815 GCGGGCGGAGGGGCGGCCCCGGG - Intronic
1165058730 19:33194748-33194770 GGGGCAGGAGGCGGCGCCCGCGG + Exonic
1165069815 19:33248797-33248819 GAGCCAGGAGGGACCAACCCAGG + Intergenic
1165072259 19:33262146-33262168 GAGGCTGGATGGGCCCTCCCTGG - Intergenic
1165767416 19:38360013-38360035 GAGGCTGGAGGGGATCCCCCAGG + Intronic
1165833885 19:38743291-38743313 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1165833910 19:38743363-38743385 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1165833936 19:38743435-38743457 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1165833975 19:38743544-38743566 GAGGGAGGAGGGGCTGGACCTGG - Intronic
1165834049 19:38743762-38743784 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1166098151 19:40554469-40554491 GAGGCGGCAGCGGCGGCCCCCGG - Intronic
1166316301 19:41991895-41991917 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1166779131 19:45331192-45331214 TAGGCAGGAGTGACCGCGCCCGG + Intergenic
1166918289 19:46211158-46211180 GAGGCTGGAGGAGAGGCCCCAGG - Intergenic
1167248744 19:48390069-48390091 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1167248756 19:48390104-48390126 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1167326302 19:48828129-48828151 CAGGCATGAGGTGCCGCGCCCGG + Intronic
1167432216 19:49461417-49461439 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167432268 19:49461562-49461584 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167432640 19:49463004-49463026 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167432735 19:49463259-49463281 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167432830 19:49463514-49463536 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167435506 19:49476343-49476365 GAGGGAGGAGGGGCTGGGCCGGG - Intronic
1167539338 19:50075282-50075304 GAGGGAGGAGGGGCTGGGCCTGG + Intergenic
1167630371 19:50622576-50622598 GAGGGAGGAGGGGCTGCGCCTGG - Intronic
1167663864 19:50812014-50812036 CAGGCAGGGAGGGCCGTCCCAGG + Intergenic
1167663872 19:50812033-50812055 CAGGCAGGGAGGGCCGTCCCAGG + Intergenic
1167676495 19:50889667-50889689 GAGGTAGGAGGGGCCCCAGCTGG - Intergenic
1167705138 19:51077586-51077608 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167705166 19:51077659-51077681 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167705596 19:51079333-51079355 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG + Exonic
1167799412 19:51730472-51730494 GAGGAAGGAGGGGCTGGACCTGG + Intergenic
1168063868 19:53908683-53908705 GAAGCGGGAGGGGGCGTCCCGGG - Intergenic
1168077697 19:53990419-53990441 GAGGGAGGAGGGGCTGGGCCTGG - Intergenic
1168077935 19:53991041-53991063 GAGGGAGGAGGGGCTGGGCCTGG - Intergenic
1168266204 19:55225146-55225168 GAGGGAGGAGGGGCTGGGCCTGG - Intergenic
1168266215 19:55225181-55225203 GAGGGAGGAGGGGCTGGGCCTGG - Intergenic
1168269390 19:55241417-55241439 GAAGCAGGAAGGGCAGCCCTTGG - Intronic
1168277570 19:55285954-55285976 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1168281203 19:55306310-55306332 GAAGACGGAGGGGCCGCCACTGG - Exonic
1168294861 19:55373488-55373510 GAGGGAGGAGGGGCTGGGCCTGG - Intergenic
1168295918 19:55377304-55377326 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1168295944 19:55377373-55377395 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1168310105 19:55455880-55455902 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1168310118 19:55455915-55455937 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1168325633 19:55537183-55537205 GGGGCAGAAGGGGCGGGCCCAGG - Intergenic
1168422351 19:56212884-56212906 GAGCCATGAGGGGCAGTCCCTGG - Intergenic
926130722 2:10302186-10302208 GAGCCAGGAGGCGCCGACCCTGG + Intergenic
926251069 2:11155696-11155718 GAGGCAGCCCCGGCCGCCCCGGG - Intronic
927519621 2:23690950-23690972 GTGGCAGGAGGGCCCGCCCCGGG + Intronic
927694572 2:25231177-25231199 GGGGGAGGAGGGGCTGCCTCAGG - Exonic
927711296 2:25328007-25328029 GAGGCAGGTGGACCCGCTCCAGG - Intronic
927855888 2:26527796-26527818 GGGGCAGGAGGGGCTGGGCCTGG - Intronic
927872715 2:26633785-26633807 GAGGCAGGAGGGGCTGCCTGCGG + Intronic
928369695 2:30732049-30732071 GGGGCAGGAGGTCCCTCCCCAGG - Intronic
929168141 2:38904348-38904370 GAGGCTGGAGGGGCAGGCCAGGG + Intronic
929532876 2:42763466-42763488 GAGGCAGGAGGGGCCGGAGAAGG + Exonic
929792115 2:45031076-45031098 GAGTGAGGAAGGGCCGCCCTTGG + Intergenic
930284059 2:49405874-49405896 CAGGCAGGAGACACCGCCCCTGG + Intergenic
930444745 2:51455969-51455991 GAGGCAGGGGGGGTCGCCTGAGG + Intergenic
933833040 2:86225801-86225823 AAGGCAAGAGGGGCCGTGCCTGG - Intronic
934502978 2:94873681-94873703 GAGCCAGCAGGGGCTGCCCCAGG + Intronic
934738166 2:96700476-96700498 GAGACTGGAGGGGCCACTCCTGG + Intergenic
935681171 2:105638463-105638485 GTGGCTGGAGGGGCCCCTCCAGG + Intergenic
936146200 2:109981948-109981970 GAGAGAGGAGGGGCTGGCCCAGG - Intergenic
936198491 2:110389531-110389553 GAGAGAGGAGGGGCTGGCCCAGG + Intergenic
936375927 2:111941614-111941636 GAGACTGGAGGGGCTGTCCCTGG - Intronic
937241507 2:120465288-120465310 GAGGCAGTGGGGGCAGCGCCTGG - Intergenic
937262363 2:120594734-120594756 GAGGGTGGAGGGGCAGCCCGGGG + Intergenic
937916384 2:127101127-127101149 GAGGCAGGAGGGGCTGCTAAAGG - Intronic
937999220 2:127719426-127719448 AAGTCAGCAGGGGCCGCCCCAGG - Exonic
938071343 2:128310081-128310103 AAGGTAGGAGGGGCTGCCCAGGG + Intronic
938289492 2:130141858-130141880 CAGGCAGGAGGGGCCTCCCCGGG - Intronic
938383035 2:130847273-130847295 GAGGAAGCAGGAGACGCCCCTGG - Intronic
938467038 2:131531080-131531102 CAGGCAGGAGGGGCCTCCCCGGG + Intronic
941394263 2:164955378-164955400 GAGGGAGCAGGGGGCGCCCGTGG - Exonic
942276799 2:174328879-174328901 GAGGCAGCTGGGCCCGCTCCGGG + Intergenic
942584926 2:177465610-177465632 GTGGCAGGACGGGCAGCTCCAGG + Intronic
942681398 2:178480779-178480801 GGGCCGGGAGGGGCTGCCCCAGG + Exonic
943085862 2:183310317-183310339 GAGGCAGCAGGTGCGGCCACAGG + Intergenic
943333760 2:186589974-186589996 GAAGGAGGAGGAGCCGGCCCGGG - Intergenic
943426891 2:187749224-187749246 GAAGCAGGATGGGCAGCTCCAGG + Intergenic
944329424 2:198447786-198447808 GAAGCAGGAGAAGCCGCCCCTGG - Intronic
946334753 2:219029354-219029376 GAGGGAGGAGGGGCTCCCCTGGG - Intronic
946416817 2:219543930-219543952 GAGGCAGGGGACTCCGCCCCCGG - Exonic
946453273 2:219799456-219799478 GAGGCTGGAGGGGCTCCCCCTGG + Intergenic
946865505 2:224038814-224038836 GGGCAAGGCGGGGCCGCCCCGGG - Intronic
947518807 2:230828678-230828700 GAGCCAGGCGGCGGCGCCCCAGG + Intergenic
948540747 2:238690080-238690102 GGGGCAGGTGTGGCCACCCCAGG + Intergenic
948759799 2:240183562-240183584 GAGGTGGGACGGGCAGCCCCGGG - Intergenic
948889801 2:240901997-240902019 CAGGCAGGAGGTCCCTCCCCAGG + Intergenic
948912725 2:241012415-241012437 CAGGCCGGAGGGGCTGCCCTGGG - Intronic
948922753 2:241073430-241073452 CAGGCAGGAGGGACCACCCACGG + Intronic
949000469 2:241610246-241610268 GAGGCTGGAGGGGGCCGCCCGGG - Intronic
949036121 2:241816490-241816512 GAGGCTGGAGGGGACTCCCGGGG - Exonic
1168854176 20:997281-997303 GAGGGAGGTGGGGCCCCCCGTGG + Intronic
1169141594 20:3229991-3230013 GAGGGTGACGGGGCCGCCCCAGG - Intronic
1169278620 20:4249329-4249351 GAAGGAGGAGGGGGCGACCCGGG + Intergenic
1170925915 20:20723628-20723650 CAGGCATGAGGGACCGCGCCCGG - Intergenic
1170998692 20:21391790-21391812 GAGGAAGGAGGGTGCGCCCGAGG - Intergenic
1171430026 20:25077256-25077278 GAGTCAGGAGGGCTGGCCCCGGG - Intronic
1172267097 20:33625810-33625832 GAGGCAGGAGGGGCTGGGCGTGG + Intronic
1172388439 20:34549845-34549867 GAGGCAGGAGGGACTGACTCTGG - Intronic
1172389651 20:34558474-34558496 GAGGGCGGTGGGGCCGCCCTAGG - Intronic
1172447844 20:35002500-35002522 CAGGCAGGAGCGGCTGCCTCAGG + Exonic
1172587820 20:36097040-36097062 GAGGCAGGAGGAGGCTCCTCAGG + Intronic
1172775545 20:37404626-37404648 GAGACAGCAGGGGCCACCCAAGG - Exonic
1172788632 20:37487094-37487116 GAGGCAGGAGCAGCAGCCACTGG - Intergenic
1174454202 20:50638149-50638171 GAGCCAGGAGGGGACACCCAAGG + Intronic
1174472636 20:50771896-50771918 GAGCCAGGAGGGGACACCCAAGG - Intergenic
1174603395 20:51742790-51742812 GAGGCATGAGCCGCCGCACCTGG + Intronic
1175737500 20:61397300-61397322 GAGGCAGGAAGGGCAGCTGCAGG + Intronic
1175786498 20:61715420-61715442 GAAGCAGGAGGGCCCACACCAGG - Intronic
1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG + Intergenic
1175947029 20:62563730-62563752 CAGGCAGGCAGGGCAGCCCCAGG + Intronic
1175981206 20:62739532-62739554 GGGGTGTGAGGGGCCGCCCCCGG + Intronic
1176103813 20:63376450-63376472 GAGGAGGGAGGGGCATCCCCGGG - Intronic
1176120772 20:63453590-63453612 GAGGCAGGAGGGGCGCCGCGGGG + Intronic
1176120921 20:63454271-63454293 GTGGCAGGAGGGGCAGCGGCGGG - Intronic
1176122753 20:63461571-63461593 GGGGGAGGAGGGCCGGCCCCCGG - Intronic
1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG + Intronic
1176182212 20:63755351-63755373 GAGGCCGGAGGGACCCTCCCCGG - Intronic
1176192316 20:63817865-63817887 GAGGCAGGAGGACCCTCCCCTGG + Intronic
1176222371 20:63975746-63975768 GAGGCAGGAGGTGCTGCAGCAGG - Exonic
1176278713 20:64288754-64288776 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1178797125 21:35755384-35755406 GAGGCAGGAGAGGCCGGCAAGGG + Intronic
1178829079 21:36040122-36040144 GAGGCAGGTCGGGGAGCCCCCGG - Intronic
1179189064 21:39107987-39108009 GATGAAGGTGGGGCCGCCCACGG + Intergenic
1179304441 21:40141707-40141729 GAGGCAGGTGTGGGCCCCCCAGG + Intronic
1179464390 21:41562153-41562175 GAGGCTGGAGGAGCCGGGCCAGG - Intergenic
1179708029 21:43193813-43193835 GAACCAGGAGGGGCCTCGCCAGG - Intergenic
1179821290 21:43938889-43938911 GGGGAAGGAGGGGCTCCCCCAGG + Intronic
1179959247 21:44759040-44759062 CAGTGAGGAGGGGCTGCCCCAGG - Intergenic
1179998073 21:44983064-44983086 CAGGCTGGAGGGGCCGCCGGGGG - Intergenic
1180094636 21:45550238-45550260 CAGGCAGGAGGCGCCTCCCCAGG - Intergenic
1180220550 21:46355622-46355644 GAGGCGGGAGGGGCCCACCTTGG - Exonic
1180483369 22:15775344-15775366 CAGGCTGGAGAGGCCCCCCCAGG - Intergenic
1180785976 22:18548087-18548109 CATGCAGGAGGGACAGCCCCAGG + Intergenic
1180839837 22:18954172-18954194 GAGGCAGGTGGGACCTCCCCCGG + Intergenic
1181023361 22:20114654-20114676 TAGCCAGGAGGGCCTGCCCCTGG - Exonic
1181062058 22:20286307-20286329 GAGGCAGGTGGGACCTCCCCCGG - Intergenic
1181131259 22:20733812-20733834 CATGCAGGAGGGACAGCCCCAGG + Exonic
1181242899 22:21487641-21487663 CATGCAGGAGGGACAGCCCCAGG + Intergenic
1181959234 22:26610985-26611007 CAGGGTGGAGGGGCAGCCCCAGG - Intronic
1182422305 22:30254451-30254473 CAGGCAGGAGGGGCTGCCTGGGG - Intergenic
1182880178 22:33726338-33726360 GAGTCAGGAGGGGAAGGCCCAGG - Intronic
1183332432 22:37228736-37228758 ATGGCAGGAGGGGCAGCCCCTGG + Intronic
1183545436 22:38452795-38452817 GAGTGAGGAGGGGAGGCCCCAGG - Intronic
1183574232 22:38676970-38676992 GAGGCATGAGGCACCGCGCCAGG - Intergenic
1183616890 22:38950978-38951000 GAGGCAAGAGGGGCTCACCCTGG - Intergenic
1183618649 22:38960056-38960078 GAGGCAGGAGAGGCTGACCAGGG + Intronic
1183639553 22:39084700-39084722 GAGGCAGGAGAGGCCGACCAGGG + Intronic
1183708174 22:39487716-39487738 GATGCTGGAGAGGCCGCCCCCGG + Exonic
1183928913 22:41225077-41225099 GAGGCTGGAGAGCCGGCCCCTGG - Intronic
1184037198 22:41924089-41924111 TAGGCAGGAGGCGCCGGGCCTGG - Intergenic
1184265238 22:43342958-43342980 GAGTCCGGCGGGGCCGCACCAGG - Intronic
1184311057 22:43643135-43643157 GAGCTACCAGGGGCCGCCCCAGG + Intronic
1184317364 22:43706284-43706306 GAGGCAGGAGAAGCAGCCACAGG - Intronic
1184479743 22:44739314-44739336 GGGGCAGGAGGGGAGGCCCCTGG + Intronic
1184645494 22:45892591-45892613 GAGGCAGGAGGGGACCTGCCAGG - Intergenic
1184660482 22:45963381-45963403 GAGGCAGAGGAGGCTGCCCCTGG - Intronic
1184677886 22:46053621-46053643 GAGGCAGGGGAGGCCCCCGCAGG + Intronic
1184739044 22:46416509-46416531 GAGACAGCAGGGGCTGCCCACGG + Intronic
1184837569 22:47032923-47032945 GAGGAAGGAGGGGCCACACAGGG - Intronic
1185068603 22:48644293-48644315 GGGGCAGCAGGGGCCTCCCCTGG - Intronic
1185102070 22:48845907-48845929 CAGGCAGGTGGGGCAGCCACAGG + Intronic
1185184880 22:49393072-49393094 GAGGCAGGAGTGTCTTCCCCTGG + Intergenic
1185293679 22:50041847-50041869 GAGGCGGGCAGGGCTGCCCCTGG - Intronic
1185399664 22:50609263-50609285 CAGGCAGGATGGGCAGCCCTGGG - Intronic
950129313 3:10531111-10531133 GTTGCAGGAGGGGCAGCCTCTGG + Intronic
950153800 3:10707890-10707912 GAGGCAGGGGCGGCCGGGCCCGG - Intronic
950170649 3:10837071-10837093 GTGGCAGGAGGGGCTGGCCCTGG + Intronic
950435379 3:12976258-12976280 GGGGCAGCAGTGGCCGCCCCAGG + Intronic
950438223 3:12993245-12993267 ATGGCAGGAGGGGCTGCCCAAGG + Intronic
950683659 3:14602207-14602229 GAGGAAGGAGGACCCGCGCCTGG - Intergenic
951217721 3:20040484-20040506 GAGGCTGGCGGGGCCGGGCCGGG + Exonic
952764809 3:36944814-36944836 GCGGCCGGAGGGTCCGCACCAGG + Exonic
953391477 3:42536300-42536322 GGGGCGGGAGGGGCCGCCTTGGG - Exonic
953416665 3:42724432-42724454 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
953916361 3:46923387-46923409 CAGGGTGGAGGGGCCACCCCAGG + Intronic
957072933 3:75580135-75580157 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
960684803 3:120285427-120285449 GCCGGAGGCGGGGCCGCCCCAGG - Intergenic
961349880 3:126293030-126293052 GAGGCATGAGCCACCGCCCCTGG - Intergenic
961365244 3:126395321-126395343 CAGTCAGGAGGGGCTGCCTCTGG - Intronic
961649637 3:128410937-128410959 AAGGGAGGAGGGGCAGCCCAGGG + Intergenic
961873231 3:130002942-130002964 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
962134751 3:132722183-132722205 GCGGCAGCAGGGGCCGGGCCCGG - Exonic
962853961 3:139328090-139328112 GAGGCAGGAAGCCCAGCCCCAGG - Intronic
963068018 3:141279248-141279270 GAGGCAGCAGGGGCCACCGTGGG - Intronic
963253364 3:143121115-143121137 GAGGCAGCTGGGGGCGCCCAGGG + Exonic
963870400 3:150409098-150409120 AAGGAAGGAGGAGCCGCCGCGGG + Exonic
964720374 3:159763818-159763840 GTGGGAGGAGGGGCCGGCCAGGG + Intronic
964751666 3:160059351-160059373 GAGGCATGAGGGGCCAGGCCAGG + Intergenic
966380078 3:179336066-179336088 CAGGCATGAGGCACCGCCCCAGG + Intergenic
968222643 3:196949714-196949736 AGGGCAGGAGGGGCTTCCCCGGG + Intronic
968370892 3:198222050-198222072 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
968431355 4:561037-561059 AAGGCAGGAGGGGCCCTCCTGGG + Intergenic
968438709 4:610492-610514 GAGCCAGGAGGGACCACCCCAGG + Intergenic
968473561 4:792510-792532 GCGGCAGGAGGCGCTGCGCCAGG - Exonic
968556875 4:1249964-1249986 GAGTCTGCAGGGGCAGCCCCTGG - Intergenic
968562209 4:1290041-1290063 GGGCCGCGAGGGGCCGCCCCGGG + Intronic
968674839 4:1871690-1871712 GAGGCCTGAGGGGCCGGCTCAGG + Intronic
968977511 4:3829803-3829825 TAGGCAGGCAGGGCCACCCCGGG + Intergenic
969373041 4:6746394-6746416 AAGGCAGGAGGGGGCTTCCCAGG - Intergenic
969388351 4:6871999-6872021 GAGGCAGGAGGGTCGCCGCCAGG + Intronic
969458284 4:7313533-7313555 GAGGAAGGAGGGGCTGAGCCCGG + Intronic
969495572 4:7524310-7524332 GAGGCAGGAGGATCCTCCCCTGG + Intronic
969599558 4:8167959-8167981 GAGGAAGGAGGGGCTGCCCTGGG - Intergenic
969617105 4:8260080-8260102 GAGGCAGGAGGATCCTCCCCCGG - Intergenic
969631953 4:8343986-8344008 GAGGCAGGAGGGTCCAGCCTGGG - Intergenic
969722241 4:8898516-8898538 GAGGCAGGAGGAGCCAAACCCGG + Intergenic
969737417 4:9000884-9000906 GAGGCAGGGATGGCCGGCCCAGG + Intergenic
969791758 4:9497952-9497974 GGAGGAGGAGGCGCCGCCCCCGG + Intergenic
973867030 4:55124882-55124904 CAGGCAGGAGGTGCCTCCGCAGG - Intronic
974377317 4:61095277-61095299 GAAGAACGAGGGGCTGCCCCAGG - Intergenic
976178032 4:82373923-82373945 GAGGCGAGAGCGGCCGCCGCTGG - Exonic
977554078 4:98471051-98471073 GGGGCAGGAGCGGCAGCACCAGG + Exonic
978189501 4:105895735-105895757 GAAGGAGGAGAGGGCGCCCCGGG - Intronic
979259346 4:118633677-118633699 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
979259574 4:118634538-118634560 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
979328800 4:119406086-119406108 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
979329004 4:119406886-119406908 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
979683225 4:123483897-123483919 CAGGCATGAGCCGCCGCCCCCGG + Intergenic
980007499 4:127559031-127559053 GGGGCAGTAGGGGCCTTCCCAGG - Intergenic
980075142 4:128287215-128287237 GGGGCGGGATGGGCCGTCCCAGG + Intronic
982069587 4:151683523-151683545 GAGGCAGCAGCGGCAGCCCTGGG - Intronic
982460891 4:155667604-155667626 GACGCCCGAGGGGCCGGCCCAGG + Intronic
984698950 4:182806455-182806477 GATGCAGGAGGGGGCGTCCCAGG - Intergenic
984752035 4:183287167-183287189 CAGGCAGCAGTGGGCGCCCCTGG + Intronic
984850065 4:184144989-184145011 GAGGAAGGAAGGGCAGGCCCAGG + Intronic
985475777 5:78284-78306 GAGGCAGGAGGCCCCTCCCCGGG + Intergenic
985537520 5:473427-473449 GGGGCGGGAGGGGCGTCCCCGGG + Intronic
985651276 5:1108902-1108924 GAGGGAGGCAGGACCGCCCCTGG + Intronic
985651888 5:1111410-1111432 GGGGCAGGACGGGCCGGCCCGGG + Intronic
985655659 5:1130301-1130323 GAGACAGGAGGTGCCTGCCCAGG - Intergenic
985733530 5:1564539-1564561 TGGGGAGGAGGGGCCGCTCCTGG + Intergenic
986133077 5:4948664-4948686 GAGGCATGAGTGGGCACCCCAGG + Intergenic
986321150 5:6633486-6633508 GGGGCAGGAGGGGCGGCTACCGG - Exonic
987050763 5:14144775-14144797 GCGGGAGGAGGCGCCGCCGCTGG - Intronic
988528591 5:32008010-32008032 CAGGCATGAGGGACCGCGCCCGG - Intronic
991462784 5:66877065-66877087 GAGGCAGGAGGGGAGGGCCTAGG + Intronic
992743311 5:79795301-79795323 AAGACAGGAGGGGCTGCCACAGG - Intronic
993044624 5:82853459-82853481 GAGGCAGGAGGGGACTCCTGGGG - Intergenic
993236059 5:85311731-85311753 GTGGCAGGACGGGCAGCTCCAGG - Intergenic
994185176 5:96807999-96808021 GCGGCAGGCGGGGAAGCCCCTGG + Exonic
997470921 5:134116203-134116225 AAGGAAGGAGGGGCCGCCCTGGG + Intronic
998496131 5:142590990-142591012 GAGGCAGCAGTGGGCGCCCATGG + Intergenic
999754377 5:154653530-154653552 GGGGCAGGACCGGCAGCCCCAGG - Intergenic
999998165 5:157112248-157112270 CAGGCAGGAGCCGCCGCACCTGG + Intronic
1002729567 5:181325421-181325443 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1002730126 5:181327606-181327628 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1002754406 6:146493-146515 GAGGCAGGAGGAGCTGGGCCCGG + Intergenic
1002782004 6:374133-374155 GAGGGATGAGGGGCCGCCAAGGG + Intergenic
1002800119 6:514668-514690 GAGGCCAAAGGGGTCGCCCCTGG + Intronic
1002869946 6:1157577-1157599 GAGGAACCAGGGGCAGCCCCTGG + Intergenic
1003921494 6:10837872-10837894 GTGGAAGGAGGGGGCGTCCCCGG + Intronic
1004198772 6:13529179-13529201 CAGGCTGGGAGGGCCGCCCCAGG - Intergenic
1004834180 6:19512443-19512465 GAGGCAGGAGAGGCAGGCACAGG - Intergenic
1005453057 6:25992578-25992600 GCGGCGTGAGGGGCGGCCCCAGG - Intergenic
1005930577 6:30481284-30481306 GCGGCAGGAGGGGGCGCACGGGG - Intergenic
1006360347 6:33584027-33584049 GAGCCAGCAGGGGACGCCTCTGG + Intergenic
1007418049 6:41703447-41703469 GACGGAGGAGGAGCAGCCCCAGG - Intronic
1007462889 6:42030870-42030892 AAGGCTGGAGGGGAGGCCCCTGG + Intronic
1007999249 6:46341519-46341541 CAGGCAGGAGCCACCGCCCCCGG - Intronic
1008382751 6:50852361-50852383 GAGGCAGGAGAGGGGGCCACAGG + Intergenic
1008555213 6:52666896-52666918 GAGGCAGGAGGGGAGGCACATGG - Intergenic
1011090625 6:83594442-83594464 GATGCTGCAGGGGCCTCCCCAGG + Exonic
1013314398 6:108927209-108927231 GAGGAAGGAGTGGCTGCCCCTGG + Intronic
1015864111 6:137710614-137710636 GAGGAAGGAAGGGCAGCGCCAGG + Intergenic
1017684198 6:156895534-156895556 AAGGCAGGAGGGGACACCCCAGG - Intronic
1018376564 6:163218732-163218754 GAGGGAGGAGGAGCCAGCCCAGG - Intronic
1018389572 6:163331877-163331899 GAAACAGGCGGGGCCGACCCAGG + Intergenic
1018929716 6:168233076-168233098 GGGGAAGCAGGGGCAGCCCCGGG - Intergenic
1019310886 7:360047-360069 GCTGCAGGAGGGGCATCCCCAGG + Intergenic
1019319939 7:411018-411040 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019319964 7:411090-411112 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019319977 7:411126-411148 GGGGCAGGAGAGGCTGCCCCGGG - Intergenic
1019320026 7:411270-411292 GGGGCTGGAGAGGCTGCCCCTGG - Intergenic
1019320050 7:411342-411364 GGGGCTGGAGAGGCTGCCCCTGG - Intergenic
1019320074 7:411414-411436 GGGGCTGGAGAGGCTGCCCCTGG - Intergenic
1019320086 7:411450-411472 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320123 7:411558-411580 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320134 7:411594-411616 GGGGCAGGAGAGGCTGCGCCGGG - Intergenic
1019320148 7:411630-411652 GGGGCAGGAGAGGCTGCCCCGGG - Intergenic
1019320160 7:411666-411688 GGGGCAGGAGAGGCTGCGCCGGG - Intergenic
1019320174 7:411702-411724 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320188 7:411738-411760 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320217 7:411815-411837 GGGGCAGGAGAGGCTGCCCCGGG - Intergenic
1019320231 7:411851-411873 GGGGCAGGAGAGGCTGCCCCAGG - Intergenic
1019320247 7:411892-411914 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320260 7:411928-411950 GCGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019324087 7:429540-429562 GGTGCAGGAGGGGAGGCCCCAGG - Intergenic
1019351687 7:557029-557051 GGGGTGGGAGGGGCCGCACCTGG - Intronic
1019519161 7:1452899-1452921 GAGGCTGGAGGGCCGGCCCTGGG - Intronic
1019733569 7:2639879-2639901 GTGGCAGGAGAAGCAGCCCCCGG - Intronic
1020309120 7:6855578-6855600 GGAGGAGGAGGCGCCGCCCCCGG - Intergenic
1021927502 7:25547495-25547517 GAGGAGAGAGGAGCCGCCCCTGG - Intergenic
1022098372 7:27154895-27154917 GAGGAATGAGGGGCCGATCCGGG - Exonic
1022466090 7:30654004-30654026 GAGGGAGGAGGAGGCGCACCAGG - Intronic
1023067177 7:36389714-36389736 GAAGGAGGCGGGGCCGCCCCTGG + Intronic
1023400791 7:39792208-39792230 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1023401299 7:39794164-39794186 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1023498975 7:40828222-40828244 GAGTCAAGTGGGGCTGCCCCAGG + Intronic
1024074256 7:45810723-45810745 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1024075285 7:45814806-45814828 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1024095955 7:45983040-45983062 GATGCAGGAACGGCAGCCCCTGG - Intergenic
1024453846 7:49580313-49580335 AGGGCATCAGGGGCCGCCCCGGG - Intergenic
1024526025 7:50350074-50350096 TAGGGAGGTGGGGCAGCCCCGGG + Intronic
1024648314 7:51386517-51386539 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1024648845 7:51388590-51388612 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1025053156 7:55744805-55744827 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1025129123 7:56366669-56366691 GAGGCAGGAGAGGCTGGGCCTGG + Intergenic
1025177510 7:56809558-56809580 GAGGCAGGAGGAGCTGGACCTGG + Intergenic
1025694254 7:63766695-63766717 GAGGCAGGAGGAGCTGGACCTGG - Intergenic
1026391917 7:69911158-69911180 GCGGCAGGGTGGGCAGCCCCAGG + Intronic
1027055367 7:75046056-75046078 GAGGCGGCAGGCGCCGACCCCGG + Intronic
1029075004 7:97928235-97928257 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
1029123292 7:98282009-98282031 GAGGCGGGTGGGGCCCGCCCGGG + Intronic
1029455212 7:100666722-100666744 GAGGCATGAGCCGCCGCGCCTGG - Intergenic
1029473454 7:100768744-100768766 CAGGCAGGAGGGGCTGGGCCTGG + Intronic
1029506199 7:100965466-100965488 GCGCCAGGAAGGGCCGCCCTGGG - Intronic
1029666615 7:101999096-101999118 GCAGCAGGAGGGGCCACCTCTGG + Intronic
1032013555 7:128361612-128361634 GAGCCAGGAGGCGGCGCCGCTGG - Exonic
1032051288 7:128652542-128652564 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1032496966 7:132369789-132369811 CAGGCAGGAGGCACCGCGCCCGG - Intronic
1033050771 7:138002097-138002119 GAGGGAGGTGGGGCCGCAGCTGG - Intergenic
1033246534 7:139721096-139721118 GGGGCAGCAGGGGCCACACCAGG - Intronic
1034279949 7:149846297-149846319 GAGGGAGCATGGGCAGCCCCAGG + Intronic
1034322870 7:150201231-150201253 GTGGCAGGTGGGGCAGCACCTGG - Intergenic
1034395515 7:150821403-150821425 GAGGGAGGAGAGGCCACTCCTGG - Intergenic
1034416073 7:150964875-150964897 GATGCAGCAGGAGCCGCTCCTGG + Intronic
1034424468 7:151007313-151007335 GAGGCAGGAGGAGGCATCCCAGG - Intronic
1034770315 7:153767892-153767914 GTGGCAGGTGGGGCAGCACCTGG + Intergenic
1034943118 7:155244825-155244847 GAGTCAGGATGGCCCACCCCTGG - Intergenic
1034951031 7:155297467-155297489 GAGCCGGGAGGGGCGGCGCCGGG + Intergenic
1034957426 7:155343761-155343783 GTTGCAGGAGGGGCTGCCACAGG - Intergenic
1035102980 7:156416532-156416554 CAGGCAGAAGGGGCAGTCCCTGG - Intergenic
1035185278 7:157121417-157121439 GAGGCAGGTGGGCCCACCTCAGG + Intergenic
1035221457 7:157408818-157408840 GAGGAGGATGGGGCCGCCCCTGG + Intronic
1035267809 7:157701570-157701592 GTGACAGGAGGAGACGCCCCTGG - Intronic
1035457109 7:159015858-159015880 TGCGGAGGAGGGGCCGCCCCCGG + Intergenic
1035560880 8:602619-602641 GAGGCTGGAGGGGCACCCGCAGG + Intergenic
1035663334 8:1363382-1363404 GAGGCAGGAGAGGCAGCCGCAGG - Intergenic
1036242517 8:7092145-7092167 GAGGCAGGGATGGCCGGCCCAGG + Intergenic
1036258276 8:7221866-7221888 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
1036310328 8:7680462-7680484 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
1036359210 8:8065641-8065663 GAGGCAGGGATGGCCGGCCCAGG + Intergenic
1036645372 8:10608966-10608988 GAGGCAGCAGAGGTGGCCCCTGG - Exonic
1036830214 8:12014984-12015006 GAGGCAGGGATGGCCGGCCCAGG - Exonic
1036891748 8:12601311-12601333 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
1036899297 8:12659283-12659305 GAGGCAGGGATGGCCGGCCCAGG - Intergenic
1037882264 8:22579060-22579082 GCGGCGGCAGGGGCGGCCCCGGG + Exonic
1037902722 8:22697025-22697047 GTGGCAGGAGGGGACAACCCTGG + Intergenic
1037951801 8:23023373-23023395 GATGCAGAAGTGGCCGCCCTGGG - Intronic
1037959457 8:23084913-23084935 GATGCAGAAGTGGCCGCCCTGGG - Intronic
1039590380 8:38741434-38741456 CAGGCAGGAGCCGCCGCGCCTGG + Intronic
1039822049 8:41142952-41142974 AAGGCAGGAGATGTCGCCCCTGG + Intergenic
1040545638 8:48396511-48396533 AAGGCAGGGGTGGCCGTCCCCGG - Intergenic
1041106101 8:54445598-54445620 GAGCCAGAAGGGGCAGCCTCTGG - Intergenic
1042141339 8:65681395-65681417 CAGGCAGGAGCCGCCGCACCTGG + Intronic
1044533843 8:93337745-93337767 GAGCCAGGTGGGGCTGCCTCTGG - Intergenic
1046674765 8:117095047-117095069 GGGGCAGGTGGGGCCTTCCCAGG + Intronic
1048484057 8:134831687-134831709 GAGGCAGGTGGGCCCCTCCCCGG - Intergenic
1048968237 8:139629254-139629276 GATGCATGCGGGGGCGCCCCTGG + Intronic
1049174994 8:141186805-141186827 CAGGCAGGAGGGGCCGCTGGGGG - Intronic
1049180453 8:141219477-141219499 TGGTCAGGAGGGGCTGCCCCTGG + Intronic
1049180790 8:141220991-141221013 GCGGCAGGAGGAGAGGCCCCGGG - Intronic
1049199549 8:141333317-141333339 GAGGCTGGAGGGGCTGGGCCTGG + Intergenic
1049412489 8:142479484-142479506 CAGGTAGGAGGGGCCTCACCGGG - Exonic
1049413601 8:142484811-142484833 GAGGCAGAAGGGCCTGGCCCAGG - Intronic
1049473157 8:142785190-142785212 AAGGCATGAGGGGCCTTCCCTGG + Exonic
1049645841 8:143735251-143735273 CAGGCAGGAGGAGCCTCCCAGGG + Intergenic
1049688806 8:143949910-143949932 GAGAGGGGAGGGGGCGCCCCGGG + Intronic
1049710928 8:144062991-144063013 GAGGCAGGTGGGGCAGCCAAGGG - Intronic
1049780351 8:144425952-144425974 GGGTCTGGAGGGGCTGCCCCAGG + Intronic
1050325016 9:4490376-4490398 GAGGGAGGAGCGGCAGGCCCGGG - Intergenic
1050498398 9:6268212-6268234 GTGGCAGGAGGGGCCCGGCCAGG + Intergenic
1051503515 9:17803635-17803657 GAGGCAGCAGGGGCTGACCTTGG + Intergenic
1053277489 9:36794426-36794448 GAGGCAGGAGGGGCCTGAACAGG - Intergenic
1054766204 9:69044648-69044670 GAGCGAGGAGGGGGCGCCCTGGG - Intronic
1056557511 9:87702025-87702047 GAGGCAGGAGGGAGTGTCCCTGG + Intronic
1056569127 9:87800538-87800560 GAGGCAGGAGGGAGTGTCCCTGG - Intergenic
1057229175 9:93308549-93308571 CAGGCAGGCTGGGCTGCCCCTGG + Exonic
1057259628 9:93576551-93576573 CTGGCTGGAGGGGCCGCGCCGGG - Exonic
1060496724 9:124124872-124124894 GAGGCAGGAGGAGCCATCCAAGG + Intergenic
1060656152 9:125374146-125374168 GAGGCAGGAGGGGGCACCTGGGG - Intergenic
1061208444 9:129177397-129177419 GCGGCCGGAGGGGCGGCCCCTGG + Exonic
1061258028 9:129464085-129464107 GAGGCTGCAGGCGCTGCCCCCGG - Intergenic
1061327036 9:129870153-129870175 CAGGCAGGAGAGGCAGCCCTGGG - Intronic
1061400290 9:130364820-130364842 GTGGAAGGACGGGCGGCCCCTGG + Intronic
1061542181 9:131283287-131283309 GAGGAGGGAGGGTCCGCCGCGGG - Intergenic
1061916906 9:133760099-133760121 GAGGAGGGTGGGGCCGGCCCTGG + Intergenic
1061955869 9:133961040-133961062 GAGGGAGCAGGGGCCTCCACTGG + Intronic
1061961649 9:133991917-133991939 GCGGCTGGAGGGTGCGCCCCGGG - Intronic
1062082235 9:134630186-134630208 AAGGCAGGAGGGTGCTCCCCTGG - Intergenic
1062167237 9:135113933-135113955 GAGGCAGGAGGGTCCTCCCCTGG - Intronic
1062205882 9:135336835-135336857 GAGGCTGGAGGGGCTTCCACAGG - Intergenic
1062287817 9:135780915-135780937 GAGGCCGGAGGAGCCGCGCCAGG - Intronic
1062290834 9:135793659-135793681 GCTGCTGGAGGGGCCGGCCCTGG + Intergenic
1062357859 9:136173532-136173554 GAGGCAGGAAGGATCCCCCCTGG + Intergenic
1062432729 9:136533174-136533196 GAAGTAGGAGGGGCCACCCAGGG + Intronic
1062450805 9:136614928-136614950 GAGGAGGGGGGGGCCGCTCCTGG + Intergenic
1062461789 9:136665467-136665489 GAGCCAGGAGAGGCCGCCCAGGG - Intronic
1062569613 9:137179103-137179125 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
1062732750 9:138118904-138118926 GAGGCAGGAGCAGGCACCCCGGG + Intronic
1062754541 9:138280120-138280142 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1203563872 Un_KI270744v1:77554-77576 GAGCCGGCAGGGGCTGCCCCAGG + Intergenic
1203577538 Un_KI270745v1:20690-20712 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1203578443 Un_KI270745v1:24280-24302 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1185446646 X:261359-261381 GGGGCAGGAGGTGCCGGCCTTGG - Intergenic
1187915503 X:24149673-24149695 GAGGGAGGAGGGGCCGAGCTCGG - Intronic
1190449945 X:50568937-50568959 GAGGCAGAAGGTGCTTCCCCAGG - Intergenic
1190730342 X:53221743-53221765 GAGGCAGGGGAGGAAGCCCCAGG + Intronic
1190738032 X:53268560-53268582 GAGGAAGCAGGGGCCTCGCCTGG - Intronic
1194268034 X:91779138-91779160 CAGCGGGGAGGGGCCGCCCCCGG + Intergenic
1195065398 X:101234529-101234551 GAGGCAGGAGGGGCTGAGCCAGG - Intronic
1196683589 X:118492960-118492982 GAGGCAGGAGAGGCCGAGCGCGG - Intergenic
1197609634 X:128623628-128623650 GAGGCAGGGTGGGCCTTCCCAGG + Intergenic
1199444858 X:147910624-147910646 GAGGCAGGATGACCTGCCCCAGG - Intergenic
1200135802 X:153874012-153874034 GAGGGAGGAGGGGGCTCCCTGGG + Intronic
1200585237 Y:5000059-5000081 CAGCGGGGAGGGGCCGCCCCCGG + Intergenic
1201077938 Y:10200628-10200650 GAGGCAGGAGGGAGCCCCCGAGG - Intergenic
1201292313 Y:12432969-12432991 GAGGCAGTAAGGGCTGCCCAGGG - Intergenic
1202381081 Y:24276906-24276928 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1202489704 Y:25393220-25393242 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic