ID: 1176140796

View in Genome Browser
Species Human (GRCh38)
Location 20:63544201-63544223
Sequence GAGGCAGGAGGGGCCGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 0, 2: 8, 3: 73, 4: 697}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176140775_1176140796 28 Left 1176140775 20:63544150-63544172 CCTAGAGACCAACCACCCCAAGG 0: 1
1: 0
2: 1
3: 13
4: 187
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140783_1176140796 11 Left 1176140783 20:63544167-63544189 CCAAGGTCAAGGGCCACTGACCT 0: 1
1: 0
2: 1
3: 23
4: 192
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140781_1176140796 13 Left 1176140781 20:63544165-63544187 CCCCAAGGTCAAGGGCCACTGAC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140779_1176140796 20 Left 1176140779 20:63544158-63544180 CCAACCACCCCAAGGTCAAGGGC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140780_1176140796 16 Left 1176140780 20:63544162-63544184 CCACCCCAAGGTCAAGGGCCACT 0: 1
1: 0
2: 2
3: 8
4: 180
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140782_1176140796 12 Left 1176140782 20:63544166-63544188 CCCAAGGTCAAGGGCCACTGACC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140789_1176140796 -2 Left 1176140789 20:63544180-63544202 CCACTGACCTGGTGGGGGACAGA 0: 1
1: 0
2: 3
3: 22
4: 219
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697
1176140792_1176140796 -9 Left 1176140792 20:63544187-63544209 CCTGGTGGGGGACAGAGGCAGGA 0: 1
1: 0
2: 5
3: 82
4: 755
Right 1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG 0: 1
1: 0
2: 8
3: 73
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176140796 Original CRISPR GAGGCAGGAGGGGCCGCCCC AGG Intronic