ID: 1176141022

View in Genome Browser
Species Human (GRCh38)
Location 20:63545152-63545174
Sequence TGGGTCTCCCCTGTCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176141012_1176141022 6 Left 1176141012 20:63545123-63545145 CCACACCGGGTGTCGGGAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1176141022 20:63545152-63545174 TGGGTCTCCCCTGTCCAGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170
1176141005_1176141022 21 Left 1176141005 20:63545108-63545130 CCACACACGAGGAGCCCACACCG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1176141022 20:63545152-63545174 TGGGTCTCCCCTGTCCAGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170
1176141010_1176141022 7 Left 1176141010 20:63545122-63545144 CCCACACCGGGTGTCGGGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1176141022 20:63545152-63545174 TGGGTCTCCCCTGTCCAGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170
1176141004_1176141022 22 Left 1176141004 20:63545107-63545129 CCCACACACGAGGAGCCCACACC 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1176141022 20:63545152-63545174 TGGGTCTCCCCTGTCCAGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170
1176141015_1176141022 1 Left 1176141015 20:63545128-63545150 CCGGGTGTCGGGAGAGGGGCCGG 0: 1
1: 0
2: 3
3: 56
4: 474
Right 1176141022 20:63545152-63545174 TGGGTCTCCCCTGTCCAGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176141022 Original CRISPR TGGGTCTCCCCTGTCCAGGT GGG Intronic
900130165 1:1084039-1084061 GGGGTCTGCCCTGTCGTGGTGGG + Intronic
900634840 1:3657929-3657951 CGGGTCTCGCCTCTCCCGGTGGG - Intronic
900958673 1:5905510-5905532 TGGGTCCCCCCTTTCCCGGGAGG - Intronic
901656462 1:10772485-10772507 TGTGTCTGCCCTTTCCAGGATGG - Intronic
903008957 1:20317227-20317249 AGGGTCTCCACTTTCCATGTGGG - Intronic
904478988 1:30782535-30782557 TCCGTCTCCCCTCTCCAGGGCGG - Intergenic
904804613 1:33121933-33121955 GGTGTCTCCCTTTTCCAGGTGGG + Intergenic
905813047 1:40927028-40927050 TGGGTCTCCACTGTGCACCTGGG + Intergenic
907309217 1:53529782-53529804 TGGGCCTACCGTGTCTAGGTGGG + Exonic
907577217 1:55537755-55537777 TGGTTCTACCCTGACCAGGCAGG + Intergenic
910767557 1:90797492-90797514 TATGTCTCCCTTGTCCATGTGGG - Intergenic
911064221 1:93773424-93773446 TGGGACACCCCTGTGCAGGTGGG + Intronic
912419412 1:109532918-109532940 TGACTCTTCCCTGTCCAGGCTGG - Intergenic
912489337 1:110053168-110053190 TGTGTCTCCCCTGCCCACCTGGG + Intronic
915585175 1:156840512-156840534 GGGGTCTCCTCTGGACAGGTAGG - Exonic
919905700 1:202076890-202076912 TGGCTCTCTCCTCTCCAGGAAGG - Intergenic
920562289 1:206947336-206947358 TGGGTCAGCCCTGCACAGGTAGG - Intergenic
922255473 1:223889663-223889685 TTGGTCACCCCTGGCAAGGTGGG + Intergenic
922904514 1:229163761-229163783 TGGGTGTCTGCTCTCCAGGTGGG + Intergenic
1067768646 10:49108199-49108221 TGGGACCACCCTGTCCATGTGGG + Intronic
1069894599 10:71672649-71672671 TTGGCCTCCCCTGCCCACGTTGG - Intronic
1073482906 10:103798160-103798182 TGGTTCCCCCCTGTACAAGTTGG - Intronic
1074551653 10:114448803-114448825 AGGGTTTCTCCTGGCCAGGTTGG + Intronic
1076250151 10:128978849-128978871 TGGGGCACCCCTGTCCTGGTGGG - Intergenic
1077014781 11:394689-394711 TGGGGCTGCCCTGTCCAAGCAGG + Intronic
1077340110 11:2022486-2022508 TGGGTCTTCCCAGTCCAGCCAGG + Intergenic
1081560400 11:44209181-44209203 TGGGATTCCCCAGTCTAGGTTGG + Intronic
1081615990 11:44591518-44591540 TGGGTTTCCTTTGTCCAGTTAGG - Intronic
1081686831 11:45048797-45048819 TTGGTCTCCCCTGCCCCGGGAGG + Intergenic
1083260092 11:61518171-61518193 TGGGCCTCTCCTGGCCAGGCCGG + Exonic
1084438052 11:69155565-69155587 TGGTCCCCACCTGTCCAGGTTGG + Intergenic
1089328996 11:117676936-117676958 CCGGCCTCCCCTGTCCCGGTGGG - Intronic
1090967348 11:131610469-131610491 TGGATCTCGCCTGCCCAGCTGGG - Intronic
1202823095 11_KI270721v1_random:77675-77697 TGGGTCTTCCCAGTCCAGCCAGG + Intergenic
1101750930 12:107581752-107581774 GGGCTCTCCTCTGTCAAGGTGGG + Intronic
1109890986 13:68613984-68614006 TGAGTCTCCCCTCTCCAGTAAGG + Intergenic
1111880088 13:93945037-93945059 TAGGTCTCCCCTGTGCCAGTGGG + Intronic
1119255220 14:73189880-73189902 TTGGTCTCCCTTGACCGGGTGGG + Intronic
1119781401 14:77278696-77278718 TCTGTCTCCCAAGTCCAGGTGGG + Intronic
1121168732 14:91835973-91835995 TAGGTCCCCGCTGGCCAGGTGGG - Intronic
1121204443 14:92150455-92150477 TGGGTCTCTGTTGCCCAGGTTGG + Intronic
1122627122 14:103090384-103090406 TGGGCCGCCCCATTCCAGGTTGG + Intergenic
1122996253 14:105266645-105266667 TGGCTCTCTCCTGTCCTGGGAGG - Intronic
1123117548 14:105901491-105901513 TGGGTCTGTCCTGTCTGGGTGGG + Intergenic
1123787877 15:23690625-23690647 TGGCTCTTCCCTGTCCACATAGG + Intergenic
1124950152 15:34310813-34310835 TGTGTGTCCCGTGTCCAGGCTGG + Intronic
1126348894 15:47724285-47724307 TGGGTCTACTCTGTACAAGTGGG + Intronic
1126620214 15:50631021-50631043 TGGGTCTATCTTGTCCAGGCTGG + Intronic
1128659147 15:69485077-69485099 TGGGTGTGCCCTGCCCAGGAAGG + Intergenic
1131461180 15:92618454-92618476 GGGGTCTCCTGGGTCCAGGTGGG + Exonic
1132384121 15:101387806-101387828 TAGCTCTCGCCTGTGCAGGTTGG - Intronic
1133396066 16:5448538-5448560 TGGGTCTCCTCTGTGCAGGCAGG + Intergenic
1136056652 16:27694764-27694786 AGGGTCTCCCTTGTCCAGGCTGG - Intronic
1136372180 16:29843463-29843485 TGGGTCTCTGTTGTCCAGGCTGG - Intronic
1138497257 16:57416148-57416170 TGGTCCTGCCCTGTGCAGGTCGG + Intergenic
1138537168 16:57666330-57666352 TGGGTCTCACCTTCTCAGGTAGG + Intergenic
1139348804 16:66322593-66322615 TGGGTGTCCCCTTCCCAGGCTGG - Intergenic
1140855612 16:78975359-78975381 AGGGTCTGCCCTGTTCATGTAGG - Intronic
1141486733 16:84345101-84345123 AGGGCCTTCCCTGGCCAGGTGGG + Intergenic
1142692857 17:1617285-1617307 TGGTTCTCCTCTGTCCATGTGGG + Intronic
1143014397 17:3883960-3883982 AGGGGTTGCCCTGTCCAGGTGGG - Intronic
1146643824 17:34563146-34563168 TGGCTCACTCCTTTCCAGGTAGG - Intergenic
1147056514 17:37839242-37839264 TGGGTCTCGCTGGTCCAGGTCGG - Intergenic
1147767182 17:42844946-42844968 GGGGCTCCCCCTGTCCAGGTGGG - Exonic
1147927023 17:43952617-43952639 TGGGGCGCCTCTGTCCAAGTCGG + Intergenic
1148441754 17:47715106-47715128 TGGCTCATCCCTCTCCAGGTTGG + Intergenic
1148753927 17:49962732-49962754 TGACTCTCACCTGTCCAGGCTGG - Intergenic
1149475686 17:56959312-56959334 TGGGTTTCCCATGCCCAGGCTGG - Intronic
1150192548 17:63258712-63258734 TGGGTCTCTCCTTTCAGGGTAGG + Intronic
1150821875 17:68441677-68441699 TGGGTCCGCCCTGTCCATGCGGG - Intronic
1151398459 17:73840440-73840462 GGGGTCTCACGTGCCCAGGTGGG - Intergenic
1151895190 17:76975242-76975264 TGTGGCTCCCCTCTGCAGGTAGG - Intergenic
1152135235 17:78499740-78499762 AGGGTCTCCCCTCCCCAGCTTGG - Intronic
1152274893 17:79350378-79350400 TGGGTCTCCCTTCTCCTGGGGGG + Intronic
1152344604 17:79743326-79743348 CTGGTCTCCTCTGGCCAGGTGGG - Intergenic
1152426586 17:80221427-80221449 TGGGTCTCCCCTCCCCAGGGGGG - Intronic
1153561588 18:6376541-6376563 GGGGTCTCCCCAGCCCAGGCTGG - Intronic
1154358272 18:13639307-13639329 TGTGTCTCCCTTGTCTAGGTTGG - Intronic
1158093300 18:53740843-53740865 GGGGTCTCCCCTTTCCAGCAAGG - Intergenic
1158505124 18:58040846-58040868 GGGGTCTCCCTTGCCCAGGCTGG - Intergenic
1159883374 18:73881121-73881143 TGGAACTCCCCTGCCCAGGATGG - Intergenic
1160025508 18:75212017-75212039 TGGGCCTCCCCTCCCCAGCTTGG - Intronic
1160750561 19:732166-732188 GGGGTCTCTGCTGTCCAGGCTGG + Intronic
1162349222 19:10138650-10138672 TGGGTCTGGCCAGTCCAGTTGGG - Intronic
1162391561 19:10393235-10393257 TGGGGCTCCCCGGCCCAGGCGGG - Intronic
1162519845 19:11173375-11173397 TGGGTCTCCCCTGTTAATTTTGG + Intronic
1162936839 19:13985757-13985779 TGGGTCTCGGCTGTCCAGGCAGG + Intronic
1163350430 19:16773408-16773430 TGGGACTCCCCTGTGCTAGTTGG + Intronic
1163627303 19:18397527-18397549 TGCGGCCCCCGTGTCCAGGTGGG - Exonic
1164210737 19:23095314-23095336 TGCGTGTGCCCTGTCCATGTGGG + Intronic
1167280974 19:48568386-48568408 TGGGTCTTCCCTGACCACCTTGG - Intronic
1168294990 19:55373919-55373941 TGGGTCTGCCCAGGCCAGGGTGG + Intergenic
1168452648 19:56477948-56477970 TGGTTCTGCTCTGTCCGGGTCGG + Intronic
1168670662 19:58238780-58238802 TGGGTCTTTCCTTTCCATGTAGG + Intronic
926670457 2:15572747-15572769 TTGGTCTCCCCTGTCCGAGGTGG - Intergenic
927197513 2:20558640-20558662 TGTGTCTTCTCTGTCCATGTGGG - Intergenic
927670764 2:25067054-25067076 TGTGTCTCCACTGTCCAGTGTGG + Intronic
928011855 2:27616639-27616661 TGGGCCTGCCCTGTTTAGGTGGG + Intronic
929775586 2:44929109-44929131 CGCGCCTCCCCTGTCCAGCTGGG + Intergenic
930026208 2:47030578-47030600 TGGGACTCCCCTCTTCAGGGAGG - Intronic
931170894 2:59802758-59802780 TGGGTCTCCTCACACCAGGTAGG + Intergenic
936966871 2:118135495-118135517 TATGTCTACCCTGTCCAGGATGG + Intergenic
937223094 2:120353305-120353327 TGGGTGTCCCCTCTCCAGCAGGG + Intergenic
938806795 2:134813595-134813617 TGGGACTCCCCTGCCCTAGTGGG + Intergenic
944010792 2:194972726-194972748 TGGGTCTTCCCTGTAGAGATGGG - Intergenic
944081742 2:195796051-195796073 TGGGACTTCCCTGTTCTGGTTGG - Intronic
946212810 2:218161158-218161180 AGGGACTCCCTTGTCCAGGATGG - Intergenic
946321405 2:218956646-218956668 TGGGGCCCACCTGCCCAGGTTGG + Intergenic
947704204 2:232261234-232261256 TGGGCTTCCTCTGTCCAGGATGG + Intronic
1168971868 20:1936872-1936894 TGGCTCTCCCCTCTCCTGGCAGG - Intronic
1170644313 20:18183176-18183198 AGGGTCGCTCCTGTGCAGGTGGG - Exonic
1171484531 20:25477426-25477448 TATGTCTGCCCTGTCCAGTTGGG - Intronic
1171771401 20:29325578-29325600 TGGTTCTGCCCTTTCCAGGCGGG + Intergenic
1171905110 20:30893913-30893935 TGGTTCTGCCCTTTCTAGGTGGG - Intergenic
1172867380 20:38110635-38110657 TCTGTCTCTCCTGTCCAAGTGGG - Intronic
1173197895 20:40931083-40931105 TGGATCTCCCCTGTCTGGGGGGG - Intergenic
1175477327 20:59286170-59286192 TGGGACTCCACTGTGGAGGTGGG - Intergenic
1175962332 20:62643270-62643292 TTGGGCTCCCCTGACCAGGGAGG + Exonic
1176141022 20:63545152-63545174 TGGGTCTCCCCTGTCCAGGTGGG + Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1179182228 21:39055114-39055136 TTGGTCTGCCCTCTCTAGGTGGG + Intergenic
1180181719 21:46121167-46121189 TGGGTCTCCCCTATCCATGTGGG + Intronic
1180844092 22:18972112-18972134 TGGGTCTTCCCTGACCAGACAGG - Intergenic
1181057378 22:20266599-20266621 TGGGTCTTCCCTGCCCAGACAGG + Intronic
1181167661 22:20992196-20992218 TGTGTCTCCCCTCTTCAGGTTGG + Exonic
1181924776 22:26349172-26349194 TGGGTCTCCACTGTCTTGGATGG - Intronic
1182559397 22:31147945-31147967 TGGGGCTTCATTGTCCAGGTAGG - Intergenic
1185172667 22:49302867-49302889 TGGGTCTTCCCTGTGCCGGACGG - Intergenic
957038724 3:75319376-75319398 TGGGTCTACACTTTCCAGGCAGG - Intergenic
960049610 3:113227397-113227419 TGGGGCTTCCCTATCCAGGAAGG - Intronic
962071356 3:132036466-132036488 TCCGTCTCCCCTTTCCTGGTAGG - Intronic
968291396 3:197542376-197542398 AGGGTCTCCTCTGCCCAGGAGGG + Intronic
968981865 4:3854611-3854633 TGGCTCTCGCCTGCCCAGATTGG + Intergenic
969098241 4:4750393-4750415 TGGGTCACACCTGACCAGGAGGG - Intergenic
969343609 4:6557822-6557844 TGGGTCTCCAGTGCCCAGGTGGG - Intronic
969346829 4:6575331-6575353 TGGGTCTACACTGTGCAGGTAGG + Exonic
969394013 4:6909373-6909395 TGGGGCTCCCCTGCCCCGGCCGG - Intronic
969457743 4:7309812-7309834 TGGGTATCTCCTCTCCCGGTGGG - Intronic
969517886 4:7658701-7658723 TGGATTTCCCCTGTCCACCTGGG + Intronic
970049875 4:11901686-11901708 TGGGTCTCCCCATTACGGGTGGG - Intergenic
971168198 4:24205666-24205688 TGGATCCCTCCTGTTCAGGTTGG - Intergenic
974054833 4:56975046-56975068 TGGGTCTCTGTTGTCCAGGCTGG + Intronic
985296318 4:188440494-188440516 TGTGTCTCTCGTGTCCAGTTAGG - Intergenic
985671882 5:1210955-1210977 TGGGTCTGTCCTGCCCATGTGGG + Intronic
985959862 5:3293323-3293345 TGGTCCTCACCTGTTCAGGTTGG + Intergenic
993728520 5:91395775-91395797 TGGGCCTCCCCAGTGTAGGTGGG - Intergenic
995241006 5:109885270-109885292 TGGTTCTTGCCTGTCCCGGTCGG + Intergenic
999257557 5:150218010-150218032 GGGGCCTCCCCTGCCCTGGTCGG - Intronic
1000194996 5:158948530-158948552 TGGCTCTCCCCTTTCAAGCTGGG - Intronic
1002584271 5:180232071-180232093 TGGGTCTGCCCTGACCCCGTGGG - Intergenic
1002778219 6:346828-346850 TGGGTCCCCTCTGTCCTGGCAGG - Intronic
1003017706 6:2481335-2481357 TGGAGCTCCCCTAACCAGGTGGG - Intergenic
1007011171 6:38418915-38418937 AGGGTCTCACTTGTCCAGGCTGG - Intronic
1007761701 6:44137128-44137150 TGGGTGGCCCCTGGCCATGTGGG + Intronic
1010722861 6:79303550-79303572 TGGGTCTCAGCTGAGCAGGTTGG + Intergenic
1011810804 6:91130109-91130131 TGCGTCTCTCCTGCCCAGTTTGG - Intergenic
1018969823 6:168519334-168519356 TGGCTCCACCCTTTCCAGGTTGG + Intronic
1019273759 7:165052-165074 GGGGGCTCCCATGTCCAGGCCGG + Intergenic
1023415153 7:39925245-39925267 TAGGTCTCCTCTCTCCAGGAAGG - Intergenic
1023998668 7:45177291-45177313 TGGCTGTCCCCTCTCCAGGTGGG + Exonic
1030187849 7:106780728-106780750 TGGCCCTCCCCTGGCCATGTTGG - Intergenic
1034068686 7:148161580-148161602 TGGCTGTCCCCTGTCTAGGTGGG - Intronic
1034684563 7:152958885-152958907 TGGGTGGCCCCTCCCCAGGTCGG - Intergenic
1034725473 7:153331603-153331625 TGGCTCTCCCCAATGCAGGTGGG + Intergenic
1037589845 8:20303545-20303567 AGGGTCTCCCCTCTGCAGGGTGG - Intronic
1037832578 8:22198225-22198247 TGGGGCTCCCCTGAACCGGTGGG + Intronic
1038617780 8:29111221-29111243 TAGGTCTCCCGTCTCCTGGTAGG + Intronic
1042837822 8:73093262-73093284 CGGGGCTGCCCTGCCCAGGTGGG + Exonic
1042852011 8:73226040-73226062 TTGATCTCCCCTGCCAAGGTGGG + Intergenic
1044399424 8:91753266-91753288 TGGGTCTCCCCAGACCCAGTGGG + Intergenic
1045217008 8:100158427-100158449 TGGGGCTCCCCAGTCCCGGCAGG + Exonic
1046038584 8:108874736-108874758 TGGGTCTGCCCTTGACAGGTGGG + Intergenic
1049385788 8:142342314-142342336 TAGGTCTGCCCCGTCCAGGTGGG + Intronic
1049763743 8:144343332-144343354 TGGGCCTCCACTGTGCAGGCAGG - Intergenic
1050366694 9:4879584-4879606 AGGGCCTGTCCTGTCCAGGTTGG + Intronic
1053120232 9:35540722-35540744 TGGGTCTACCCAGGACAGGTAGG + Intronic
1053382190 9:37658159-37658181 TGGGACACCGCTGTGCAGGTGGG + Intronic
1054995164 9:71379227-71379249 TGGATCTACACTGTCCAAGTAGG + Intronic
1056366657 9:85911584-85911606 TGAGACTCTCCTGCCCAGGTTGG - Intergenic
1059435811 9:114275656-114275678 TGGGTCTCCCCTGTCCCCCTGGG - Exonic
1060017051 9:120095912-120095934 TGGCTCTCCCCTGTGCAGGTGGG - Intergenic
1060442369 9:123653952-123653974 TGGCTCTCCCCTTTCTAGCTGGG - Intronic
1060812721 9:126619062-126619084 TTGGGCTCGCCTGTCCAGGTAGG + Intronic
1060848193 9:126853872-126853894 TGGGCCTCCCTTGTGCAGCTGGG + Intergenic
1061477703 9:130880050-130880072 TGGGTTTCATCTGTCCAGGTTGG + Exonic
1061889001 9:133607916-133607938 TGGTTCTCACCTGCTCAGGTGGG + Intergenic
1203365095 Un_KI270442v1:249360-249382 TGGTTCTTCCCTTTCTAGGTGGG + Intergenic
1186853380 X:13602198-13602220 TGGGTCTCTTTTGTCCAGCTGGG + Intronic
1192439957 X:71167039-71167061 TGGCTCTGCTCTGTCCAGCTGGG + Exonic
1197963709 X:132033626-132033648 TGGGTCACCACTGTCCAAGCTGG - Intergenic
1200063722 X:153495096-153495118 GGCGCCTCCCCTCTCCAGGTAGG + Exonic