ID: 1176141974

View in Genome Browser
Species Human (GRCh38)
Location 20:63548807-63548829
Sequence TGGACACTGGTCACGCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176141974_1176141985 25 Left 1176141974 20:63548807-63548829 CCAATAGGCGTGACCAGTGTCCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1176141985 20:63548855-63548877 CCTGCCCTGGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 21
4: 225
1176141974_1176141979 12 Left 1176141974 20:63548807-63548829 CCAATAGGCGTGACCAGTGTCCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1176141979 20:63548842-63548864 CCCCTCGCACCTGCCTGCCCTGG 0: 1
1: 1
2: 9
3: 55
4: 748
1176141974_1176141983 24 Left 1176141974 20:63548807-63548829 CCAATAGGCGTGACCAGTGTCCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1176141983 20:63548854-63548876 GCCTGCCCTGGAGTCACAGATGG 0: 1
1: 0
2: 1
3: 31
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176141974 Original CRISPR TGGACACTGGTCACGCCTAT TGG (reversed) Intronic
900847088 1:5112638-5112660 GGGCCACTGGTCACTCATATTGG - Intergenic
902869905 1:19307798-19307820 TGGAGACTGGAGACTCCTATGGG + Intronic
904938769 1:34150412-34150434 TGTACAGTGGTTAAGCCTATGGG + Intronic
912431685 1:109631428-109631450 TGGACACTGGAGAAGCCCATAGG - Exonic
920423123 1:205849633-205849655 TGGACGGTGGTCACGCCAAGAGG + Intronic
922456145 1:225775205-225775227 TGGACACTGGTGACTCCAAAAGG + Intergenic
1067932905 10:50581266-50581288 TGGACACTGGCCACACCAGTCGG + Intronic
1074882922 10:117672495-117672517 GGGACACTCGTCACTCCTCTTGG + Intergenic
1077162048 11:1118197-1118219 TGGTCTCTGGTCCCGCCTCTGGG + Intergenic
1077916902 11:6617287-6617309 TGGACTTTGGTAACACCTATGGG - Exonic
1106256336 13:28025673-28025695 TGGATACTGGTCACACACATCGG + Intronic
1115643018 14:35347438-35347460 TGACCTCTGGTCACGCCTGTGGG - Intergenic
1119615617 14:76096873-76096895 TGGACACTGGCCAGGCCAAAGGG + Intergenic
1128876410 15:71205000-71205022 TGACCACTGGACACCCCTATGGG - Intronic
1129854606 15:78814321-78814343 TGGACACTGGTCAGGCGCAGTGG + Intronic
1130010672 15:80151316-80151338 TGATCACTGGTCACGCCTGGTGG + Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1152516316 17:80826783-80826805 TGGCCACTGGGCACACCTGTGGG + Intronic
1155684873 18:28536368-28536390 TAGACACTGGTGACTACTATAGG + Intergenic
1162007740 19:7790643-7790665 TGGGCACTGGGCACGGCTCTGGG - Intergenic
925011885 2:492238-492260 TGGAAACTGGTCACTCATATGGG - Intergenic
932338160 2:70942839-70942861 AGGGCACTGGTCAGGACTATGGG + Intronic
932832934 2:75008271-75008293 TGGACCCAGGTAACGCATATAGG - Intergenic
933001396 2:76928445-76928467 TGGATAGTGGTCAGGCCCATAGG - Intronic
936432473 2:112476551-112476573 TGGCCACTGCCCAGGCCTATGGG + Intergenic
945206237 2:207335256-207335278 TGGACCCTGCTCATGCCTTTGGG - Intergenic
1176141974 20:63548807-63548829 TGGACACTGGTCACGCCTATTGG - Intronic
1178311040 21:31530351-31530373 TGGACAGTGTTCAGGCCTCTTGG - Intronic
1179396908 21:41048781-41048803 TGGCCACTGGTAAGGCCCATAGG + Intergenic
1183178780 22:36244549-36244571 TGGACACTGGGAATGCCTACAGG + Intergenic
1184228802 22:43146743-43146765 TGGACACTGGGAACTCCTAGAGG + Intergenic
1185234077 22:49701111-49701133 AGGACACTGGTCACCCCTCTGGG - Intergenic
949716352 3:6936046-6936068 TGGACACTGGAGAGGCCTCTGGG - Intronic
950457380 3:13100755-13100777 TGGACACTGGTCTGGGCCATGGG + Intergenic
955980549 3:64521770-64521792 TGGACACTGGTAACTCCAAAAGG + Intronic
959982577 3:112532622-112532644 TGGTCAATGGTCACATCTATGGG + Exonic
960826663 3:121793392-121793414 TGCCCACTGGTCACACTTATGGG - Intronic
987891144 5:23880410-23880432 TAGACACTGGACACTCCTAAGGG + Intergenic
989586137 5:43075109-43075131 TGGTCACTGGCCTTGCCTATTGG - Intronic
990184706 5:53200840-53200862 TGGTCACTGATCTCGCCTACTGG + Intergenic
999310001 5:150545748-150545770 TGGAGGCTGGTTACGCCTAGAGG + Intronic
1005163520 6:22893136-22893158 TGGGCAATGGTCAAGACTATTGG + Intergenic
1017063735 6:150509458-150509480 TGGGCCATGGTCACTCCTATTGG + Intergenic
1029020948 7:97364376-97364398 TGGCCACAGGTCATGGCTATGGG - Intergenic
1029382071 7:100221004-100221026 TGGACACAGCTCACCCCCATGGG + Exonic
1035746293 8:1963910-1963932 TGGACTCTGGGCAAGCCTGTGGG - Intergenic
1038499773 8:28033851-28033873 AGGACAGTGGTCACGCCTCTAGG + Intronic
1039017698 8:33170728-33170750 TGGACACTGGTCAGTCTTTTAGG - Intergenic
1048760097 8:137784566-137784588 TGGAAACAAGTCAGGCCTATGGG - Intergenic
1049922425 9:377885-377907 TGGACTCTGGTCATGCCTCCAGG - Intronic
1192996742 X:76520432-76520454 TGGTCACTGCTCCCGCCTAGGGG + Intergenic
1197560913 X:128020635-128020657 TGGACCATGGTCACTCATATTGG - Intergenic
1197819423 X:130529944-130529966 TGGGCAGTGGCCTCGCCTATTGG + Intergenic