ID: 1176143289

View in Genome Browser
Species Human (GRCh38)
Location 20:63554306-63554328
Sequence TCCCCTTGGCTCCCCTGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 401}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176143289_1176143300 10 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143300 20:63554339-63554361 GGGGGTAGAGTGCGGGCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 162
1176143289_1176143302 20 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143302 20:63554349-63554371 TGCGGGCACCTGGTGGTCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1176143289_1176143301 13 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143301 20:63554342-63554364 GGTAGAGTGCGGGCACCTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 150
1176143289_1176143297 -8 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143297 20:63554321-63554343 CAAGGGGAGTGTGGTGGAGGGGG 0: 1
1: 0
2: 4
3: 63
4: 760
1176143289_1176143304 27 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143304 20:63554356-63554378 ACCTGGTGGTCTCAGGGAAGCGG 0: 1
1: 0
2: 2
3: 28
4: 299
1176143289_1176143296 -9 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143296 20:63554320-63554342 CCAAGGGGAGTGTGGTGGAGGGG 0: 1
1: 0
2: 3
3: 42
4: 505
1176143289_1176143306 28 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143306 20:63554357-63554379 CCTGGTGGTCTCAGGGAAGCGGG 0: 1
1: 0
2: 8
3: 46
4: 384
1176143289_1176143294 -10 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143294 20:63554319-63554341 GCCAAGGGGAGTGTGGTGGAGGG 0: 1
1: 0
2: 1
3: 49
4: 393
1176143289_1176143303 21 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143303 20:63554350-63554372 GCGGGCACCTGGTGGTCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 125
1176143289_1176143298 2 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143298 20:63554331-63554353 GTGGTGGAGGGGGTAGAGTGCGG 0: 1
1: 1
2: 13
3: 136
4: 1205
1176143289_1176143299 3 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143299 20:63554332-63554354 TGGTGGAGGGGGTAGAGTGCGGG 0: 1
1: 0
2: 4
3: 59
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176143289 Original CRISPR TCCCCTTGGCTCCCCTGGCC CGG (reversed) Exonic