ID: 1176143289

View in Genome Browser
Species Human (GRCh38)
Location 20:63554306-63554328
Sequence TCCCCTTGGCTCCCCTGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 401}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176143289_1176143306 28 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143306 20:63554357-63554379 CCTGGTGGTCTCAGGGAAGCGGG 0: 1
1: 0
2: 8
3: 46
4: 384
1176143289_1176143304 27 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143304 20:63554356-63554378 ACCTGGTGGTCTCAGGGAAGCGG 0: 1
1: 0
2: 2
3: 28
4: 299
1176143289_1176143296 -9 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143296 20:63554320-63554342 CCAAGGGGAGTGTGGTGGAGGGG 0: 1
1: 0
2: 3
3: 42
4: 505
1176143289_1176143299 3 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143299 20:63554332-63554354 TGGTGGAGGGGGTAGAGTGCGGG 0: 1
1: 0
2: 4
3: 59
4: 525
1176143289_1176143301 13 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143301 20:63554342-63554364 GGTAGAGTGCGGGCACCTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 150
1176143289_1176143302 20 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143302 20:63554349-63554371 TGCGGGCACCTGGTGGTCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1176143289_1176143303 21 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143303 20:63554350-63554372 GCGGGCACCTGGTGGTCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 125
1176143289_1176143300 10 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143300 20:63554339-63554361 GGGGGTAGAGTGCGGGCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 162
1176143289_1176143298 2 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143298 20:63554331-63554353 GTGGTGGAGGGGGTAGAGTGCGG 0: 1
1: 1
2: 13
3: 136
4: 1205
1176143289_1176143297 -8 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143297 20:63554321-63554343 CAAGGGGAGTGTGGTGGAGGGGG 0: 1
1: 0
2: 4
3: 63
4: 760
1176143289_1176143294 -10 Left 1176143289 20:63554306-63554328 CCGGGCCAGGGGAGCCAAGGGGA 0: 1
1: 1
2: 2
3: 36
4: 401
Right 1176143294 20:63554319-63554341 GCCAAGGGGAGTGTGGTGGAGGG 0: 1
1: 0
2: 1
3: 49
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176143289 Original CRISPR TCCCCTTGGCTCCCCTGGCC CGG (reversed) Exonic
900096935 1:943626-943648 TCCTCTTGGCTCTGCTGGGCTGG + Intronic
900146995 1:1162750-1162772 TCCCCTGGGCTCCCATAGGCCGG - Intergenic
900495545 1:2974391-2974413 GTCCCTTGGCTCTCCTGGCCAGG - Intergenic
900527371 1:3135819-3135841 TCCCCGTGGCTCCCTGGGCCGGG + Intronic
900606598 1:3526325-3526347 TGCCCATGTCTGCCCTGGCCTGG - Intronic
901022715 1:6263115-6263137 GCCCCTTGGCCCCCCGGGGCTGG - Intergenic
901244617 1:7719886-7719908 AGCCCTTGGCTGCCCTGGCAGGG - Intronic
901719462 1:11184872-11184894 TCACCTGGGCTCCCCGGGCACGG + Intronic
902702190 1:18179962-18179984 TCGCCTTAGCTCTCCTGGCCTGG + Intronic
902976051 1:20089499-20089521 TCCACCTACCTCCCCTGGCCAGG + Intronic
903378311 1:22880124-22880146 CCTCCTGGGCACCCCTGGCCAGG - Intronic
904094694 1:27967573-27967595 ACCCCTTAGCTCCCCTATCCTGG + Exonic
904264323 1:29309778-29309800 GCCCCTGGGCTCCTCAGGCCTGG + Intronic
904287424 1:29461441-29461463 TCCTTCTGGCTGCCCTGGCCCGG + Intergenic
904768301 1:32867378-32867400 TCCCCTGAGCTTCCCAGGCCTGG + Intronic
905037855 1:34929437-34929459 TCCCCGCGGCTTACCTGGCCCGG + Exonic
905486548 1:38301277-38301299 TCCCCTCTGCTGCCCCGGCCAGG + Intergenic
906477716 1:46181042-46181064 TCCCCTGGGCCCACCTGGGCTGG - Intronic
907268637 1:53277493-53277515 TCCACCTGAGTCCCCTGGCCTGG + Intronic
907414895 1:54307372-54307394 TCTCCCTGTCTCCCCTAGCCCGG + Intronic
909603101 1:77481102-77481124 TCTCCTCTGCTCACCTGGCCAGG - Intronic
910041057 1:82851985-82852007 TCCCTGTGGCTCTCCTGGGCTGG + Intergenic
910141917 1:84035446-84035468 TCACCTTGGCTCTCATGGGCTGG + Intergenic
911498856 1:98661776-98661798 CCCCGTTGGCGCCCCCGGCCGGG - Exonic
912455292 1:109792743-109792765 TCCAGTTGGCTCTCCTGGGCTGG - Intergenic
912489397 1:110053592-110053614 TCCCCATGGATTCACTGGCCAGG - Intronic
912721075 1:112020696-112020718 TCTCCTGGGCTCCACTGGACCGG + Intergenic
915267114 1:154726841-154726863 TCCCCCGGGCTCCCCTGGCACGG - Intronic
915304749 1:154970792-154970814 TCCCCTTAGCTCCCCGCCCCTGG - Intronic
915367318 1:155323498-155323520 TGCTCCTGGCTCCTCTGGCCGGG + Intronic
915585149 1:156840368-156840390 TCCCCTCAGCTCCACTGACCAGG - Exonic
915970145 1:160349205-160349227 TTCCCTTGGCTGCCCTGGTCTGG + Intronic
918236164 1:182582664-182582686 TCACTTTGCCTCTCCTGGCCTGG - Intronic
919920595 1:202164526-202164548 TCCCCTGCTCTCCCATGGCCTGG + Intergenic
921065129 1:211617116-211617138 TCCCCCAGGCTCCCCTGAGCTGG - Intergenic
922563586 1:226586883-226586905 TGTCCTGGGCTCCCCTGCCCTGG + Intronic
924386014 1:243498398-243498420 TCCACCTGGCTCCACGGGCCTGG + Intronic
1062815245 10:494698-494720 TCCCCTTGGTTCCCCTGACATGG - Intronic
1063158009 10:3397748-3397770 TCCCCTGGGCTCCCCTGAGCAGG + Intergenic
1063520244 10:6734697-6734719 ACCCCTGCCCTCCCCTGGCCAGG - Intergenic
1064129964 10:12700775-12700797 TCCCCTCTGCTCCCATGTCCAGG + Intronic
1065343032 10:24723821-24723843 TCCCCTCGCCTCGCCGGGCCGGG + Intergenic
1066087297 10:31983429-31983451 GCACCTTGGCACCCCAGGCCTGG + Intergenic
1068894665 10:62186153-62186175 ATGCCTTGGCTCCCCTGCCCTGG + Intronic
1069571836 10:69498875-69498897 CCCGCTAAGCTCCCCTGGCCTGG - Intronic
1069593573 10:69656386-69656408 TCCCCTCCGCTCCCCTACCCAGG - Intergenic
1070959092 10:80486401-80486423 TCACCTCTGCTCCCCTGCCCGGG - Intronic
1073118569 10:101107664-101107686 TCCCCTGGGTTGGCCTGGCCTGG + Intronic
1073479980 10:103780230-103780252 TCCGCTTGGCTTCCCTTTCCAGG - Intronic
1073488032 10:103834029-103834051 TCCCATTGCTTCCTCTGGCCTGG - Intronic
1074844942 10:117389462-117389484 TCCCTCTCCCTCCCCTGGCCTGG + Intergenic
1074977890 10:118595837-118595859 TCCTCTTCGCTGCTCTGGCCAGG - Intergenic
1075705326 10:124497159-124497181 TATTCTGGGCTCCCCTGGCCGGG + Intronic
1075799620 10:125145329-125145351 TCCCCAAGGCACCCCTGGCCAGG - Intronic
1076424427 10:130357414-130357436 TCCCTTTGGCTCCCCCAGCATGG + Intergenic
1076554447 10:131312285-131312307 CCCCCGCGGGTCCCCTGGCCCGG + Intergenic
1076884332 10:133254742-133254764 TCCCCTGGGATTGCCTGGCCAGG + Intergenic
1076902667 10:133347627-133347649 GCCTCTTGGTTCCCCTGGCCTGG + Intronic
1076902810 10:133348066-133348088 TCCCCGTGGGTCCCCTCTCCAGG - Intronic
1077047255 11:552073-552095 TCCCTTTTCCTCCCCAGGCCAGG + Exonic
1077094445 11:793352-793374 TCTGCTTTGCTCCCCTGGTCAGG + Intronic
1077156300 11:1093230-1093252 CTGCCCTGGCTCCCCTGGCCTGG + Intergenic
1077158025 11:1100035-1100057 GCCGCTTGGTTCCTCTGGCCTGG + Intergenic
1077196456 11:1283307-1283329 TGGCCTTGCCTCCCTTGGCCTGG - Intronic
1077287676 11:1775040-1775062 TCCCCTTCACACCCCTGGCTAGG - Intergenic
1077353680 11:2104910-2104932 TCCCCATGGCTGCCCTCACCTGG - Intergenic
1077394892 11:2315925-2315947 ACACGTTGGCTCCCCTGGGCCGG - Intronic
1077437448 11:2549702-2549724 GGCCCTGGGCTCCCCAGGCCTGG + Intronic
1078169315 11:8916673-8916695 CCCACATGCCTCCCCTGGCCTGG + Intronic
1079035272 11:17014668-17014690 TCCCCTTTGCCCCCGAGGCCGGG + Intergenic
1081849607 11:46265859-46265881 TTCCCTTGGGTCCCCTCCCCTGG - Intergenic
1082838319 11:57667964-57667986 TCCCATTGGCTCCCTAGTCCGGG - Exonic
1083156739 11:60828042-60828064 CTCCCTCGGCTCCCCTGTCCAGG - Intergenic
1083952597 11:65965228-65965250 TTCCCTTGCCTGCCCTGGCCAGG - Intronic
1084196023 11:67523935-67523957 TGCACTTGGCTCCCCCTGCCTGG + Intergenic
1084209551 11:67614715-67614737 TCCTCTGGGCTGCCCTGGCAAGG + Intergenic
1084429125 11:69101644-69101666 TCCCCCTGCCTTCCCAGGCCTGG - Intergenic
1084660769 11:70545066-70545088 GGCCCTTGCCTGCCCTGGCCTGG - Intronic
1084787409 11:71451045-71451067 TCCCCTTCTCTGCCCAGGCCTGG + Intronic
1085043061 11:73338150-73338172 TCCCCCTGCCTTCCCTGGTCAGG - Intronic
1085172842 11:74463509-74463531 GCTCCTTGGCTTCCCTGTCCAGG + Intronic
1087138160 11:94740647-94740669 ACCCCGCGGCTCCCCCGGCCGGG - Intronic
1087345820 11:96969504-96969526 TCCCCTTCAATACCCTGGCCTGG - Intergenic
1088833769 11:113560068-113560090 CTGCCTTAGCTCCCCTGGCCTGG + Intergenic
1088901260 11:114119421-114119443 TCCCCTTTGCTGACCTGGACTGG + Intronic
1089202271 11:116731673-116731695 GTCCCTCCGCTCCCCTGGCCAGG - Intergenic
1089357975 11:117867911-117867933 TGCCCTTGGCTACACTGCCCGGG - Intronic
1089559211 11:119335214-119335236 CCCTCCTGGCTTCCCTGGCCTGG + Exonic
1089567291 11:119378474-119378496 TCCTCTTGCCTCCCCTGGCAGGG + Intronic
1090803561 11:130189042-130189064 CCTCCTTGGCTCTCCAGGCCAGG - Intronic
1091086746 11:132728185-132728207 GCACCCTGTCTCCCCTGGCCAGG + Intronic
1092902060 12:13069158-13069180 TGCTCTTGGCACCCCTGACCTGG - Intronic
1094493418 12:30975405-30975427 TCCCCTTGAAGCCCCAGGCCAGG + Intronic
1096536458 12:52278164-52278186 TCCCCCTCCCTCCCCTAGCCTGG - Intronic
1096696565 12:53352728-53352750 TTCCCTTGGGTCCACTGCCCTGG + Intergenic
1096975780 12:55698612-55698634 TCCTGCTGGCTCCTCTGGCCAGG - Intronic
1102068172 12:109996126-109996148 TCCCCTCTGCTTTCCTGGCCCGG - Intronic
1102378989 12:112447263-112447285 TCCCCTTTGCTTCCCTGCCCAGG + Intronic
1103532248 12:121610574-121610596 TTCCCTTGCCTCCCCCAGCCTGG - Intergenic
1103536388 12:121636547-121636569 TCCACTTGGCTCCACAGCCCGGG - Intronic
1103704306 12:122863018-122863040 TTCCCTTGTCGGCCCTGGCCAGG + Intergenic
1103884245 12:124188981-124189003 TCCCGCAGGCTCCCCTGCCCTGG + Intronic
1107604080 13:42040977-42040999 TCTCCTTTGCTCCCCCCGCCCGG + Intronic
1108502793 13:51083827-51083849 TCCCCTGACCTCACCTGGCCTGG - Intergenic
1109300436 13:60585095-60585117 TAACCTTGGCTGCCCTGTCCAGG + Intergenic
1111779441 13:92702886-92702908 TCTCCTTGGCTCCCCCAACCCGG + Intronic
1112165169 13:96910416-96910438 TCCCCCTGGATCCCCTCACCGGG + Intergenic
1113179493 13:107609167-107609189 ACCCCTTAGCTCCCCTATCCTGG + Intronic
1113183756 13:107662186-107662208 TCCCTTGGTGTCCCCTGGCCTGG + Intronic
1113560107 13:111272137-111272159 TCTCCCTGGCTGCCCTGGCAGGG + Intronic
1118316027 14:64726670-64726692 TCCCCTTGGCACAGCTGGGCGGG - Intronic
1118905177 14:70018538-70018560 TCCCTTTGGCCCCTCTGGCCAGG + Intronic
1119720859 14:76889268-76889290 TTCCTTCGGCTCCCCTGGCGAGG - Intergenic
1119920720 14:78443463-78443485 TCCCCTGGACCCTCCTGGCCTGG - Intronic
1121535934 14:94690708-94690730 TGCCCTTCTCTCCCCTGCCCAGG + Intergenic
1121728502 14:96170306-96170328 TGCACTTTGCTCCCCTTGCCTGG + Intergenic
1122034212 14:98935764-98935786 TCCCTGTGGCTCTCCAGGCCTGG - Intergenic
1122296595 14:100709421-100709443 CCCCCAGGCCTCCCCTGGCCTGG + Intergenic
1122959631 14:105088454-105088476 TCCCCTCGGCCCCGCTGGCTGGG - Intergenic
1123060274 14:105591274-105591296 TGCCCTGAGCTGCCCTGGCCTGG - Intergenic
1123404064 15:20010082-20010104 TCCCCAGGGCTACCCTGACCTGG - Intergenic
1123513403 15:21016728-21016750 TCCCCAGGGCTACCCTGACCTGG - Intergenic
1123716988 15:23040448-23040470 TCCCCCTAGCACCTCTGGCCAGG - Intergenic
1123717276 15:23041385-23041407 TCCCCCTAGCACCTCTGGCCAGG - Intergenic
1123717350 15:23041649-23041671 TCCTCCTGGCACCTCTGGCCAGG - Intergenic
1123717449 15:23041984-23042006 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123717494 15:23042128-23042150 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123717516 15:23042200-23042222 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123717571 15:23042382-23042404 CCCCCCTGGCACCTCTGGCCAGG - Intergenic
1123717838 15:23043274-23043296 TCCCCCTAGCACCTCTGGCCAGG - Intergenic
1123717911 15:23043538-23043560 TCCTCCTGGCACCTCTGGCCAGG - Intergenic
1123718066 15:23044055-23044077 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123718133 15:23044281-23044303 TCCCCCTAGCACCTCTGGCCAGG - Intergenic
1123718219 15:23044578-23044600 TCCCCCTAGCGCCTCTGGCCAGG - Intergenic
1123718239 15:23044650-23044672 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123718293 15:23044833-23044855 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123718309 15:23044904-23044926 TCCTCTGGGCACCTCTGGCCAGG - Intergenic
1123718592 15:23045907-23045929 TCCTCCTGGCACCTCTGGCCAGG - Intergenic
1123718663 15:23046158-23046180 CCCCCCTGGCACCTCTGGCCAGG - Intergenic
1123718802 15:23046640-23046662 TCCTCCTGGCACCTCTGGCCGGG - Intergenic
1123718814 15:23046676-23046698 TCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123718944 15:23047120-23047142 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123719028 15:23047417-23047439 TCCCCCTAGCGCCTCTGGCCAGG - Intergenic
1123719158 15:23047863-23047885 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123719319 15:23048422-23048444 TCCCCCTAGCACCTCTGGCCAGG - Intergenic
1123719531 15:23049139-23049161 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123719592 15:23049360-23049382 TCCCACTGGCACCTCTGGCCAGG - Intergenic
1123719626 15:23049468-23049490 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123719637 15:23049504-23049526 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123719657 15:23049576-23049598 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123719691 15:23049688-23049710 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123719738 15:23049867-23049889 TCCTCCTGGCACCTCTGGCCAGG - Intergenic
1123719844 15:23050226-23050248 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123719855 15:23050262-23050284 TCCCCCCGGCACCTCTGGCCAGG - Intergenic
1123887027 15:24736215-24736237 TCCCTTTGGGTCCCCTGTCTTGG - Intergenic
1124192337 15:27591246-27591268 TGCACTGGGCTGCCCTGGCCTGG + Intergenic
1124372202 15:29110311-29110333 TCCCCTGGGCTGCCCCTGCCTGG + Intronic
1124603170 15:31151446-31151468 TCCCCTTGTCTCTCATAGCCTGG + Intronic
1127310385 15:57746958-57746980 TCACCTTAGCTCTCCAGGCCAGG - Intronic
1127477597 15:59349141-59349163 TCCCCTTTTTTCCCCTTGCCTGG - Intronic
1127530719 15:59840868-59840890 CTCCCCTGGCTCCTCTGGCCCGG - Intergenic
1128091482 15:64922046-64922068 TCCCCTCGGCTCCCCTGGCCTGG + Intronic
1129360422 15:75020755-75020777 CCCACTTGGCTACTCTGGCCTGG + Exonic
1129391605 15:75223693-75223715 TATCCTTGGCTCCCCTTTCCAGG + Intergenic
1129394704 15:75237532-75237554 TCCACTTGGCTCCCTGGGGCAGG + Intergenic
1131121881 15:89827973-89827995 TGCCCTGGGCTCCCCTGCCCTGG - Intergenic
1131979159 15:97979094-97979116 ACCCATTGCCTCCCCTGGGCTGG + Intergenic
1132625884 16:891263-891285 TCCCCAGGACTCACCTGGCCAGG - Intronic
1132659733 16:1055964-1055986 TGACCTTGGGTCCCATGGCCGGG - Intergenic
1132661267 16:1062530-1062552 TCCCCTCGGCTCCCACGGCCGGG - Intergenic
1133027100 16:2993244-2993266 TCCCCTTCTCTTCCCAGGCCTGG + Intergenic
1133339477 16:5027353-5027375 TCCCCTTGGCTGGCATGGGCCGG - Exonic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1136513510 16:30753794-30753816 TCCTCCGGGTTCCCCTGGCCTGG - Intronic
1137675783 16:50303271-50303293 TCCACGTGGCTCCCGTGGCTAGG + Intronic
1138349627 16:56339594-56339616 GCCCCAGGGCTCTCCTGGCCTGG - Intronic
1138534712 16:57653729-57653751 TTCCCTTGGCTCCCAGGTCCTGG + Intronic
1141138277 16:81480854-81480876 TCCCCTTGGCCCTCCTGGTGGGG + Intronic
1141686433 16:85572748-85572770 ACCCCTTGGCTCCCCTTTCCCGG - Intergenic
1142119618 16:88379508-88379530 TTCCCGTCCCTCCCCTGGCCTGG - Intergenic
1142200569 16:88759377-88759399 TCCCTGTAGCTGCCCTGGCCTGG - Intronic
1142220740 16:88853785-88853807 TCCCCAGGGCTGCCCTGCCCTGG - Intronic
1142251586 16:88994298-88994320 CCCCCTGGGCTTCGCTGGCCTGG - Intergenic
1142866417 17:2794281-2794303 TCCCCTTGGCTGGCCAGGCCTGG + Intronic
1143509260 17:7386544-7386566 TCCTCTTGTCTCCACAGGCCGGG + Exonic
1144698320 17:17320822-17320844 TCTCCTGGGCTCCCCTATCCTGG - Intronic
1144763053 17:17718133-17718155 TCCCCCTGCTTCCCCTGGTCGGG + Intronic
1145268637 17:21392589-21392611 GCCACCTGGCTCCCTTGGCCTGG + Intronic
1145302787 17:21652858-21652880 TCCCAGGAGCTCCCCTGGCCTGG - Intergenic
1145347517 17:22050332-22050354 TCCCAGGAGCTCCCCTGGCCTGG + Intergenic
1145754477 17:27380742-27380764 TCCCCCTGGCTCCCCACGTCAGG - Intergenic
1145974525 17:28976566-28976588 TCCCCATGGCTCCTCAGGCTTGG - Intronic
1146271855 17:31489927-31489949 TCCAGCTGGCTCACCTGGCCTGG - Intronic
1146281703 17:31549408-31549430 TCCCCTTGCAGCCCCTGGCAAGG - Intergenic
1148470550 17:47890333-47890355 TGCCCCTGGTTCCCCTGTCCAGG - Intergenic
1148678222 17:49457387-49457409 AGCCCTTGGCTCCCCAGGGCGGG - Intronic
1148821640 17:50363494-50363516 TCCCATTCTCTCCCCTGTCCAGG + Intergenic
1149496431 17:57121111-57121133 TGCTCTTGGCCCCTCTGGCCAGG + Exonic
1150294173 17:63998898-63998920 TCCCCCTGACACCCCTGTCCCGG - Intronic
1151671816 17:75575046-75575068 TCCCCTGGGCTGCCCTTCCCGGG + Exonic
1151724599 17:75876881-75876903 CCCCCTTCTCTCCCCTGGCAAGG - Intronic
1152008870 17:77698407-77698429 TCCCCCTGACTCCCCCAGCCAGG - Intergenic
1152073135 17:78143940-78143962 TGCTCTGGGCTGCCCTGGCCAGG - Intergenic
1152208613 17:78990833-78990855 TCCCCTGGTCTCTTCTGGCCTGG - Intergenic
1152431036 17:80248445-80248467 TCCCCTTAGCACCCCTCTCCCGG + Intronic
1152854371 17:82655804-82655826 TCCCCGTGGCTGCCGTGCCCAGG + Exonic
1155172441 18:23276792-23276814 TTCCCCTGCCTCCCCTTGCCAGG + Intronic
1156492258 18:37503180-37503202 TCCCCTGGCCTCCCCTGGGATGG + Intronic
1156971398 18:43161788-43161810 TTACCTTGGCTCCCCTGCCTGGG - Intergenic
1157706735 18:49813683-49813705 TCCCCTGGGCTCCCTCGGGCTGG - Exonic
1158503183 18:58022035-58022057 TCCCCATGGCTCCCCGACCCAGG - Intergenic
1158535166 18:58301959-58301981 TCCCCTTGTTGCCCCTGCCCCGG + Intronic
1159289896 18:66403595-66403617 TCCCATTGACTCCTCTGACCAGG - Intergenic
1160444164 18:78914285-78914307 TCCACCTGGCTTCCCTGTCCCGG + Intergenic
1160498371 18:79388291-79388313 CCCACTGGCCTCCCCTGGCCTGG - Intergenic
1160515736 18:79478349-79478371 TCCCCTTGGCTGCCTTGGTGTGG - Intronic
1160839480 19:1139324-1139346 TCCCCATCCCTCCCCTGCCCCGG - Intronic
1160897946 19:1411544-1411566 TCGCCTTGGCTCCAATGGTCTGG + Intronic
1160984946 19:1834148-1834170 GACTCTTGGCTCCCCTGGGCTGG - Intronic
1161545737 19:4878793-4878815 TCCCGTTGGCCCACCTGGCGTGG + Intergenic
1161737567 19:6001022-6001044 AAGCCTTGGCTCCCCTGCCCTGG + Intronic
1161943935 19:7422636-7422658 TCACCTGGGCTCCTCTGGACTGG + Intronic
1162042474 19:7979115-7979137 TCCCCGAGGCTCCCTGGGCCTGG - Intronic
1163499062 19:17664718-17664740 GTTCCTTGGCTTCCCTGGCCAGG - Intronic
1163724231 19:18913447-18913469 TCCCAGGGTCTCCCCTGGCCAGG - Intronic
1163848943 19:19652793-19652815 TCCCCTTGGCTCCCAGCGCATGG - Intronic
1164692536 19:30222191-30222213 TGCCCCTGCCTCGCCTGGCCAGG - Intergenic
1165190455 19:34058688-34058710 TCCCTTTGGCTCCTCCGGTCTGG + Intergenic
1165299821 19:34961600-34961622 GCCCCCTAGCTCCCCTGGCCTGG + Intronic
1165361211 19:35338074-35338096 CCCCCGTGGCTCCCCTCTCCGGG - Intronic
1165821398 19:38678634-38678656 TCGCCCTGGGTCCCATGGCCCGG - Intronic
1166624975 19:44343452-44343474 ACCACTTGGCTCTCCTGGCAGGG + Intronic
1166669856 19:44703393-44703415 TCCCCTTCGCTCGGCTGGGCAGG - Exonic
1167002833 19:46756076-46756098 ACCTCTCGGCGCCCCTGGCCCGG + Exonic
1167189430 19:47974215-47974237 TTCCCTTGGCTCCCATGGATTGG + Intronic
1167299706 19:48671634-48671656 TCCCCTTCCCTCCCCTCCCCAGG - Intronic
1167621625 19:50563997-50564019 TTCCCTTGGTTTCCCTTGCCGGG - Intronic
1168169337 19:54575599-54575621 CCACCTGGGCTCCCCTGGCAGGG - Intronic
1168172119 19:54595982-54596004 CCACCTGGGCTCCCCTGGCAGGG - Intronic
1168182563 19:54672134-54672156 CCACCTAGGCTCCCCTGGCAGGG - Intronic
925871736 2:8277776-8277798 TCCTCTGTGCTCCCGTGGCCTGG - Intergenic
926122999 2:10254974-10254996 TACCCTGGGGTGCCCTGGCCGGG + Intergenic
926171824 2:10557615-10557637 TCCCTTAGGCTGCCCTTGCCAGG + Intergenic
927171639 2:20375319-20375341 CCCCCGTGGCTCCCCTGCCTGGG + Intergenic
927177284 2:20419655-20419677 CCCCCGTGGCTCCCCTGCCTGGG + Intergenic
927249385 2:20984059-20984081 GCCCCTCTGCTTCCCTGGCCAGG + Intergenic
927544409 2:23940318-23940340 TCCCCTTCCCACCACTGGCCCGG - Intronic
927651088 2:24914131-24914153 CCCATTTCGCTCCCCTGGCCTGG - Intronic
929454670 2:42057386-42057408 TCCCACTGGCTCACCTGTCCAGG - Exonic
929511376 2:42568494-42568516 TCCCCGGGCCTCCCCCGGCCCGG + Intronic
930036612 2:47089486-47089508 GCCCCTTGACTCCCCTGGGTGGG + Intronic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932421592 2:71604498-71604520 TCTCATGGGCTCCCATGGCCAGG - Intronic
932517498 2:72368058-72368080 TTCCCTTAGCTGCCCTGGCTGGG - Intronic
932723214 2:74154310-74154332 TCCCCTTGGCTCCCTAGCCTTGG + Exonic
936075647 2:109399986-109400008 TCCCTCTGGCTGCCCTGGACAGG + Intronic
936447475 2:112607275-112607297 TCCCCTTGCCTCCCCTTCCCTGG + Intergenic
937059907 2:118973568-118973590 TCCCCATGGCTTGCCTTGCCTGG + Intronic
937220820 2:120342554-120342576 CACCCTTGGCTCCCGTGGGCTGG + Intergenic
937239142 2:120449223-120449245 TGCCCTGAGCTCCCCTGGGCAGG - Intergenic
937302610 2:120852417-120852439 TCCCCCTGGCACCCCTGGTGGGG - Intronic
937365321 2:121257163-121257185 TCACCTTGGCTCCTCTGGGCTGG - Intronic
937892455 2:126948941-126948963 TGCCCCTGGCTCCCCTGCTCTGG + Intergenic
937984157 2:127631063-127631085 CCCTCCTGACTCCCCTGGCCTGG - Intronic
938118902 2:128620220-128620242 TCCCCTTCCTTCCCCTGTCCTGG + Intergenic
938257149 2:129868340-129868362 CCCCCTTGGCTCACCCGACCAGG + Intergenic
945643265 2:212458242-212458264 TCCCCTTGGCTGCCTTTGCATGG - Intronic
946870188 2:224077855-224077877 TCTTCTTTGCTCCCCTGGACTGG - Intergenic
947302535 2:228704515-228704537 TCACCTAGGTTCCCATGGCCAGG - Intergenic
947528528 2:230894064-230894086 TCCCCAGGCCTCCCCAGGCCAGG + Intergenic
947765280 2:232633785-232633807 TCCCCTCGGCGCCCCAGCCCCGG + Exonic
948321573 2:237073931-237073953 TGTCCCTGGCTCTCCTGGCCCGG + Intergenic
948432635 2:237929844-237929866 TCCCCTTCCTTCCCCAGGCCAGG + Intergenic
948593197 2:239064128-239064150 CCGCCCTGGCTTCCCTGGCCTGG + Intronic
1169044422 20:2524646-2524668 CCCCCTGGGCTCCCCCGGCGGGG - Intronic
1169262704 20:4149510-4149532 TCCCCTTGGGGCCCCGGGCAGGG + Intronic
1171141705 20:22749270-22749292 TCTCTTGGGCTCCCCTGGACTGG + Intergenic
1171348701 20:24486287-24486309 TCCACCTGGCTCCCCAGCCCAGG - Intronic
1172296023 20:33811696-33811718 CCCCCCAGGCTCCCCGGGCCCGG + Intronic
1172481108 20:35271847-35271869 TCCCCATGCCCACCCTGGCCCGG - Intronic
1172835564 20:37870866-37870888 TCCCCTTAGATCCTCTGCCCTGG + Intronic
1172855531 20:37999248-37999270 TTCCCTTGGCTCATCAGGCCTGG - Exonic
1173251419 20:41366066-41366088 CTCCCTTCTCTCCCCTGGCCCGG - Intronic
1174196245 20:48774790-48774812 GCCCCTCCGCTGCCCTGGCCAGG + Intronic
1175211176 20:57356932-57356954 AACCCCTGGCTCCCCTCGCCAGG - Intronic
1176143289 20:63554306-63554328 TCCCCTTGGCTCCCCTGGCCCGG - Exonic
1176222663 20:63977422-63977444 TGCCCTTGACTGCCCTGACCAGG - Intronic
1176239138 20:64067893-64067915 GGCCCCTGGCTCCCCTGGCTGGG + Intronic
1179597685 21:42453810-42453832 TCCACTTAGTGCCCCTGGCCTGG - Intergenic
1179942913 21:44651107-44651129 TCCCTGTGGCTCCCCCAGCCTGG - Intronic
1179954026 21:44727915-44727937 ACCCCTGGGCTCCCAGGGCCTGG + Intergenic
1180004640 21:45014660-45014682 CTCTCTCGGCTCCCCTGGCCCGG - Intergenic
1180080236 21:45483324-45483346 TGTCCTTGGCGGCCCTGGCCTGG + Intronic
1181040211 22:20188495-20188517 GGCCCTTGGGTCCCCTGCCCAGG + Intergenic
1181433107 22:22894821-22894843 CCCACTTGGCTCTCCTGGCAAGG - Intronic
1181677141 22:24462742-24462764 TGCCCTTGGCTCCTCAGGACTGG - Intergenic
1182145922 22:27996628-27996650 TCCCCATGGCCCCCATGGCAAGG - Intronic
1182302259 22:29343546-29343568 TCCCATTGGCTGCCCAGGCAGGG - Intronic
1182828414 22:33285046-33285068 GCCACTTGGCACACCTGGCCGGG + Intronic
1183040097 22:35171526-35171548 TGCCCTTGACTGCCCTGTCCTGG - Intergenic
1183355911 22:37359351-37359373 TTCCCCTGGCCTCCCTGGCCAGG + Intergenic
1183787038 22:40035546-40035568 TCACCATGGATCCCCAGGCCGGG - Exonic
1184228254 22:43143125-43143147 ACCACCTGGCTGCCCTGGCCCGG + Exonic
1184234386 22:43175175-43175197 TCCCCTTGGCTGCCCAAACCTGG - Intronic
1184298586 22:43541801-43541823 TCCCCCTCCCTCCCCTGGCCTGG + Intronic
1184418643 22:44366569-44366591 TCCCCTTGGCTGCCCTGGTGGGG + Intergenic
1184890306 22:47375154-47375176 TACCCTTGACTGCCGTGGCCTGG - Intergenic
1184973973 22:48047797-48047819 TCTCCATGGCTCCGCTGGGCTGG + Intergenic
1185179976 22:49353803-49353825 TCCCCTTGCCTTTCCAGGCCTGG + Intergenic
1185418339 22:50721635-50721657 TCCTCTGAGCTGCCCTGGCCTGG - Intergenic
949944396 3:9178697-9178719 TCCCAATGCCTCCCATGGCCTGG + Intronic
950117975 3:10463718-10463740 TCCTCTGGGCTACTCTGGCCAGG + Intronic
950465094 3:13148908-13148930 TAGCCTTGGCTCCCCTGGAAAGG - Intergenic
952959590 3:38581037-38581059 TCCCCGGGGGTGCCCTGGCCTGG + Exonic
952965294 3:38617353-38617375 GGCCCTTGGCTGGCCTGGCCTGG - Intronic
953282917 3:41575952-41575974 TCCCTTTGGCTCCACTGCCAGGG - Intronic
954378314 3:50206168-50206190 TCCCCTGGCCTCCCCCTGCCTGG - Intronic
954799541 3:53179202-53179224 TCCTCCTGGATCCCCAGGCCCGG - Intronic
955042771 3:55333187-55333209 TCCCCTTTGCCCCACTGTCCAGG + Intergenic
955350593 3:58190408-58190430 TCCCTTTGGGTCACCTGGCCTGG - Intergenic
955419386 3:58721572-58721594 TCCCCTGGGCTCTCCTACCCTGG - Intronic
955427004 3:58801705-58801727 TCCCGCTGGCTCAGCTGGCCTGG - Intronic
955625454 3:60913758-60913780 TGCCCTTGGCTGACCTGGCTGGG + Intronic
961049371 3:123733815-123733837 ACATCTTGGCTCCCCAGGCCAGG + Exonic
961057370 3:123800322-123800344 ACCCCTTGGCACATCTGGCCTGG + Intronic
961355999 3:126340382-126340404 GCCCCTTGGCTCCACAGGACTGG - Intergenic
963907197 3:150782546-150782568 TTCCCTGGGTTCCCATGGCCTGG - Intergenic
967808047 3:193732365-193732387 TCAACTTGGCTCCACTGGCCTGG - Intergenic
968642894 4:1723193-1723215 TGCCCATGGCTCCCCCTGCCAGG + Intronic
968904010 4:3443466-3443488 TCCCCTTGGCCCTTCTGGCCTGG - Intronic
969280286 4:6166328-6166350 GCCCCTGGGCTCCCCTCCCCAGG + Intronic
969402307 4:6963551-6963573 CCCCCTTGGCCTCCCGGGCCCGG + Intronic
969564222 4:7968122-7968144 TCCCCTCGCCTCGCCTGGGCGGG + Intronic
969633196 4:8350519-8350541 TCCCCTCTGTTCCCCTGACCAGG - Intergenic
971347154 4:25821982-25822004 TCCCCTGGACTCACCTGGGCGGG + Exonic
973636891 4:52869212-52869234 TCCTCTTCCCTCCCCTGGCCAGG + Intergenic
975196246 4:71527508-71527530 TCCCCCTGGCTCCTCTTCCCTGG - Intronic
977429063 4:96908677-96908699 TCCCCTTAGATGCTCTGGCCGGG + Intergenic
982058087 4:151573685-151573707 TCACAGTGGCTCCCCCGGCCTGG - Intronic
986369045 5:7062246-7062268 TCCCCTTGTCACACCTGGTCTGG - Intergenic
986572686 5:9181615-9181637 TCCCCTTGGCTTCTCAGCCCAGG + Intronic
988074546 5:26336159-26336181 TCCCCTTGGCTTCCAGGGCATGG + Intergenic
988781031 5:34521962-34521984 TCACCTTGGCTCCCTTGCCTTGG - Intergenic
988957778 5:36336263-36336285 TCCTCTTGGCCCCCCAGCCCGGG + Intergenic
990525584 5:56623861-56623883 TCCCCTTGTCTACCGTGCCCTGG - Intergenic
991547141 5:67795333-67795355 TCTCCTTGACTGCCCTAGCCAGG + Intergenic
991668281 5:69021976-69021998 TCCCCTTCGCTTCCCTTGACAGG - Intergenic
998604603 5:143621058-143621080 TCCCCTTGGCTCCCTTGACAGGG + Intergenic
999431739 5:151530968-151530990 TCCCCATGGCTCCCCTGGAATGG - Intronic
999450343 5:151673071-151673093 TGCCCTTGGCTGCCTGGGCCTGG - Intronic
1001424752 5:171615907-171615929 TTCCCTGAGCTCCGCTGGCCTGG - Intergenic
1001539276 5:172526109-172526131 TCCTCTTATCTGCCCTGGCCTGG - Intergenic
1001679235 5:173544193-173544215 TCCCTTTGCCTCCCCTCCCCTGG + Intergenic
1002105072 5:176876005-176876027 TGCTCTTCGCTCCCCAGGCCGGG + Intronic
1002211949 5:177604563-177604585 TCCCCTCGGCACCCCTGCCCGGG + Intronic
1002424247 5:179166291-179166313 CCTGTTTGGCTCCCCTGGCCCGG + Intronic
1002616919 5:180461720-180461742 GCTCCTGGGCTCCCCAGGCCAGG + Intergenic
1002637160 5:180614174-180614196 TCCCTCTGTCTCCCCAGGCCCGG - Exonic
1002875338 6:1204746-1204768 TCCCCTTGGAGACCCTGGGCAGG - Intergenic
1003006043 6:2382493-2382515 TCCCCGCCGCTCCCCTGTCCTGG + Intergenic
1005778419 6:29162238-29162260 CCCTCATGGCTCCCCTGGCTCGG + Intergenic
1005958776 6:30682349-30682371 TCCCCTGGGCTCCAGTGGCAGGG + Intronic
1005994235 6:30921964-30921986 TCCCCTTTTCTGCCCTGGGCTGG + Exonic
1006017309 6:31092237-31092259 TCCCCTTGGCTCCCTTTGATTGG + Intergenic
1006077799 6:31545563-31545585 TCCCCTGGGAGCCCATGGCCTGG + Exonic
1006650248 6:35545281-35545303 TACCCTTGGTTCCCTTGGGCTGG - Intergenic
1007272841 6:40651221-40651243 TCCTCTGGCCTCCCCTGGGCTGG - Intergenic
1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG + Intergenic
1014222866 6:118815869-118815891 TCCACTTTGCTCCTTTGGCCTGG + Exonic
1015606364 6:134959060-134959082 ACTCCCTGGCTCCCTTGGCCAGG - Intergenic
1019358568 7:593579-593601 TCCTCTGGGCGCACCTGGCCCGG - Intronic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1019713481 7:2527891-2527913 TCCCTTTGCCTCCCCAGGACAGG + Exonic
1019734489 7:2644096-2644118 TCCCCTGGGCTCCCATGGCCTGG - Intronic
1020040541 7:4997644-4997666 ACCCCTTAGCTCCCCTATCCTGG + Intronic
1022789630 7:33673933-33673955 AGCCCTTGGTTCACCTGGCCTGG - Intergenic
1022843958 7:34191515-34191537 ACTCATTGGCTCCCTTGGCCAGG + Intergenic
1023411471 7:39892921-39892943 TCCCCTGGGTTTACCTGGCCAGG + Intergenic
1023722731 7:43112919-43112941 TTACCTTGGCAGCCCTGGCCTGG - Exonic
1023851578 7:44153131-44153153 CACCCTTGGCTCCTCTGGTCCGG - Intronic
1024055669 7:45658630-45658652 CCCCGTTGGCTCCCAAGGCCGGG + Intronic
1025731929 7:64115026-64115048 GCCCCCTGGCTGCCCTGGGCTGG + Intronic
1029591688 7:101511276-101511298 TCTCCCTGCCTCCCTTGGCCTGG + Intronic
1030524948 7:110641405-110641427 TCCTCTTGGCTCCAGTTGCCTGG - Intergenic
1031593534 7:123621888-123621910 TACTCTGGGCTCCACTGGCCAGG - Intronic
1032074325 7:128829455-128829477 TCCCCCTGGCTGCTCTGGCTGGG + Intergenic
1032209410 7:129899500-129899522 TCCCCATGGGTCACCTAGCCAGG - Intronic
1032683581 7:134209494-134209516 TCCCCGGGGCTCCCCTGGCCTGG - Intronic
1033877668 7:145842505-145842527 TCCCCTTGGCTACCATAGCTGGG + Intergenic
1034875237 7:154719706-154719728 TTCCCCTGCCTCCCTTGGCCTGG + Intronic
1035315822 7:157997251-157997273 GCCCCTGGGCCCGCCTGGCCTGG + Intronic
1035406843 7:158604258-158604280 TCCCCTGGGCTCCTCTGGGTGGG - Intergenic
1039490364 8:37942980-37943002 TCCCCTTGGCTCTACTGTCCTGG + Intergenic
1039659110 8:39444387-39444409 TGTCCTTGGCTCACCTGGCCTGG + Intergenic
1040303828 8:46201910-46201932 TCCCCTGGGCTGTCCTGGGCTGG + Intergenic
1040313244 8:46247646-46247668 ACCCCTGGGCTCCCCTGGGCAGG + Intergenic
1040314135 8:46252018-46252040 CCCCCTGGGCTCCCCTGGGCAGG + Intergenic
1042422647 8:68609881-68609903 TCCACCTGGCTCCACTTGCCTGG - Intronic
1045483861 8:102614642-102614664 TCCCCTTGACTCCCCACCCCCGG - Intergenic
1048335102 8:133496803-133496825 CCCCCTTGGGTGCCGTGGCCTGG - Intronic
1049053671 8:140218553-140218575 TCTGCTTGTCTCTCCTGGCCAGG - Intronic
1049213816 8:141398720-141398742 TCCCCTGGGCAGCCCAGGCCTGG - Intronic
1049258111 8:141624672-141624694 GAACCTTGGCTCCCCTGGCAGGG + Intergenic
1049407796 8:142459376-142459398 TGGCCTCGGCTCCCCTGGGCTGG - Intronic
1049692832 8:143970070-143970092 TCCCCTACTCTCCCCTGTCCTGG + Intronic
1049744224 8:144256399-144256421 TCCCCCTGCCCCCCTTGGCCAGG + Intronic
1053811657 9:41858999-41859021 TCATCTTGGCTTTCCTGGCCAGG + Intergenic
1054618937 9:67328440-67328462 TCATCTTGGCTTTCCTGGCCAGG - Intergenic
1054878395 9:70120462-70120484 TCCCCTTGCCTTCCCTGGAGAGG + Intronic
1055760384 9:79600733-79600755 TGCCCATGGCTCCCCAAGCCTGG + Intronic
1056170371 9:83979801-83979823 TCACCTTGGGTCTCCCGGCCCGG - Intronic
1056389495 9:86127500-86127522 GGCCCTTGGGTCTCCTGGCCTGG + Intergenic
1056846760 9:90045005-90045027 GGCCCTTGTCTCCACTGGCCCGG - Intergenic
1057694947 9:97316573-97316595 TCACCTGGGCACCCCTGGCATGG - Intronic
1058165269 9:101611952-101611974 TCCTCTTGGCTTCCCTGCACAGG - Intronic
1059977874 9:119737148-119737170 TCCACTTGTCTCCCATGGCAAGG + Intergenic
1060000201 9:119951759-119951781 TCCCATTGCCTCCCCTGTTCAGG + Intergenic
1060277277 9:122191750-122191772 TTCCCTGGGCTCGCCTGCCCTGG + Intronic
1060455617 9:123792723-123792745 CCCCCTTGGATCCCCTGCCAGGG - Intronic
1060665869 9:125431851-125431873 TGCCCATGGCTCCTGTGGCCCGG + Intergenic
1060759414 9:126235177-126235199 GCCCCTTGCCTGCCCTGGTCAGG + Intergenic
1061159700 9:128886178-128886200 TACCCTTTGCTCCCCAGGCTGGG - Intronic
1061233509 9:129328598-129328620 TCACCTGGGAGCCCCTGGCCAGG - Intergenic
1061348233 9:130043308-130043330 TCCCCCGGGCTCCCCCGGCCGGG + Intergenic
1061486947 9:130924835-130924857 ACGCCTCGTCTCCCCTGGCCTGG + Intronic
1061520150 9:131113000-131113022 TCACCATGGTGCCCCTGGCCTGG - Intronic
1061676294 9:132217827-132217849 TCCCCTGGGCCCCACTGGCCTGG - Intronic
1061924412 9:133798930-133798952 TGCCCTGGGCTTCCCGGGCCAGG - Intronic
1062481669 9:136755230-136755252 GCCCCTGGGCTCACCAGGCCGGG + Exonic
1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG + Intronic
1062634111 9:137480964-137480986 GCGCCTTGGCTCCGCTGCCCTGG - Exonic
1187175051 X:16888695-16888717 TCGCCTTGCCTCCCCTGCCTCGG - Intergenic
1190221881 X:48517101-48517123 TCCCCTGGGCTCCCCCGTGCAGG + Intronic
1192144532 X:68672723-68672745 GCCCCTTGGCTGCCCTGCCATGG - Intronic
1192204674 X:69088155-69088177 TCCCCCTAGCCTCCCTGGCCTGG - Intergenic
1192707352 X:73540817-73540839 TCCTCATGGCTTCCCTTGCCTGG - Intergenic
1192738977 X:73875115-73875137 TCTCCTTAGCTGCACTGGCCAGG - Intergenic
1195747920 X:108137272-108137294 TCCCCTAAGCTCCCCTGCCCTGG - Intronic
1199205904 X:145147840-145147862 TCTCCTTGGCTCCTCAGGCAAGG + Intergenic
1200093515 X:153646947-153646969 TCCCCCTGCCTCCCGAGGCCAGG + Intronic
1201075118 Y:10181065-10181087 GCCCCTTGCCTCGCCTCGCCTGG - Intergenic