ID: 1176143690

View in Genome Browser
Species Human (GRCh38)
Location 20:63556048-63556070
Sequence CTGTTGGAACAGCTCGACCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176143687_1176143690 -7 Left 1176143687 20:63556032-63556054 CCTGCTGCTCGGGGACCTGTTGG 0: 1
1: 0
2: 0
3: 20
4: 189
Right 1176143690 20:63556048-63556070 CTGTTGGAACAGCTCGACCATGG 0: 1
1: 0
2: 0
3: 4
4: 81
1176143686_1176143690 -1 Left 1176143686 20:63556026-63556048 CCAGCTCCTGCTGCTCGGGGACC 0: 1
1: 1
2: 3
3: 37
4: 343
Right 1176143690 20:63556048-63556070 CTGTTGGAACAGCTCGACCATGG 0: 1
1: 0
2: 0
3: 4
4: 81
1176143682_1176143690 6 Left 1176143682 20:63556019-63556041 CCAAGATCCAGCTCCTGCTGCTC 0: 1
1: 0
2: 0
3: 57
4: 498
Right 1176143690 20:63556048-63556070 CTGTTGGAACAGCTCGACCATGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176143690 Original CRISPR CTGTTGGAACAGCTCGACCA TGG Exonic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
905390283 1:37631981-37632003 CTCATGGAACAGATCTACCAGGG - Intronic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
913339159 1:117740422-117740444 CTTTTGGAACAGAATGACCAGGG - Intergenic
922171267 1:223157557-223157579 CTGTTGGAACAGCACATGCAAGG - Intergenic
1063320496 10:5047304-5047326 CTGGTGTTACAGCTTGACCAAGG + Intronic
1067728197 10:48789543-48789565 CAGGTGGAACAGCGCTACCAAGG - Intronic
1068235811 10:54231448-54231470 CTCATGGAACACCTCTACCAGGG + Intronic
1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG + Intergenic
1079523227 11:21353803-21353825 ATGTTTGAAGAGCTCAACCAAGG - Intronic
1080591280 11:33724873-33724895 TTGATGGAACAGCCCGACCTTGG - Intronic
1084355075 11:68632999-68633021 CTGGTGCAACAGCGCCACCAGGG - Intergenic
1085826520 11:79853446-79853468 CTGAGGGAACAGCACGAGCAGGG - Intergenic
1091860151 12:3774122-3774144 CAGTTGGAACAGCTCTGCAATGG + Intergenic
1093228930 12:16519126-16519148 ATGTTGGAAGGGCTCGTCCATGG - Intronic
1103825557 12:123735371-123735393 CTGTATGCACAGCCCGACCAAGG + Intronic
1104860524 12:131921113-131921135 GTGCTGGAACATCTCGTCCAGGG - Exonic
1105260018 13:18772288-18772310 CTCTTGGAAAACCTCTACCAGGG + Intergenic
1105262694 13:18791610-18791632 CTCTTGGAAAACCTCTACCAGGG + Intergenic
1105630930 13:22166834-22166856 CTCTTAGAACAGCTCAAACAAGG + Intergenic
1109953049 13:69527624-69527646 CTGTTGAAACAGCTGGACACAGG + Intergenic
1111349788 13:87013092-87013114 ATGTTGGAACAGTTCCATCATGG - Intergenic
1115073808 14:29361043-29361065 GTGTTGTAACAGCTAGACCAGGG + Intergenic
1130838556 15:87675449-87675471 CTGCTGGGACAGCTTGACTAGGG + Intergenic
1136274371 16:29169793-29169815 CTGTTGGCCCAGATCGACCCTGG - Intergenic
1136746714 16:32597373-32597395 CTGGTGGAGCAGCTGGCCCATGG - Intergenic
1141404200 16:83777339-83777361 CTGGAGGAGCAGCTCCACCACGG + Intronic
1142078652 16:88135439-88135461 CTGTTGGCCCAGATCGACCCTGG - Intergenic
1203048843 16_KI270728v1_random:856577-856599 CTGGTGGAGCAGCTGGCCCATGG - Intergenic
1146163257 17:30571054-30571076 CAGGTGGAAGAGCTCCACCAGGG + Intergenic
1146634130 17:34491634-34491656 GTGTTGGGAAACCTCGACCATGG + Intergenic
1147323782 17:39660767-39660789 CTTTTGGAACAGGTCGCCCCAGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1154426005 18:14272513-14272535 CTCTTGGAAAACCTCTACCAGGG - Intergenic
1154428743 18:14292097-14292119 CTCTTGGAAAACCTCTACCAGGG - Intergenic
1154431020 18:14308442-14308464 CTCTTGGAAAACCTCTACCAGGG - Intergenic
1154432360 18:14317967-14317989 CTCTTGGAAAACCTCTACCATGG - Intergenic
1157731997 18:50011904-50011926 CTCTGGGAACAGCTCGTGCAGGG - Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1163314957 19:16535503-16535525 CTGCTGGATGAGCTCGTCCATGG + Exonic
1163473911 19:17513947-17513969 CTCTTGCCACAGCTTGACCATGG - Intronic
927641533 2:24848688-24848710 CTGTAGGAAAAGCTGGACTATGG - Intronic
929632509 2:43478928-43478950 CTTTAGGAACATCTCAACCAGGG + Intronic
930719860 2:54628536-54628558 CTGCTGGAACAGCCACACCAGGG - Intronic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
935693851 2:105753674-105753696 CTGTTGGAATAGCTTGCACAAGG + Intronic
940894659 2:159069252-159069274 CTGATGGAACAGCAGGAACAAGG - Intronic
941748918 2:169115222-169115244 CTGTTGGAAGAACTGGAACAAGG + Intergenic
945259160 2:207828328-207828350 CTGGTAGGACAGCTCGAACATGG + Exonic
1173325556 20:42030017-42030039 CTGTTGGAAGAGCTCCACACTGG - Intergenic
1174371983 20:50096772-50096794 CTGTTGGAAGAACTCGAAGAAGG - Exonic
1176143690 20:63556048-63556070 CTGTTGGAACAGCTCGACCATGG + Exonic
1176844253 21:13864572-13864594 CTCATGGAAAAGCTCTACCAGGG - Intergenic
1176845175 21:13871259-13871281 CTCTTGGAAAACCTCTACCAGGG - Intergenic
1176846022 21:13877326-13877348 CTCTTGGAAAACCTCTACCAGGG + Intergenic
1178276869 21:31246841-31246863 CTCTTGGTACAGTTTGACCATGG + Intronic
952651880 3:35737253-35737275 CTGTTGGGACTGCCCCACCATGG - Exonic
962866606 3:139452538-139452560 CTGTTGGAATAGCTCTGCCCAGG + Intergenic
963405182 3:144854209-144854231 CTGGTGGTACCGCTTGACCAAGG + Intergenic
963548638 3:146693961-146693983 ATGTTGGAACACTTCCACCATGG - Intergenic
966057923 3:175718598-175718620 CTGTTGGAAAAACTCGAAGAAGG - Intronic
967936121 3:194729120-194729142 GTGGTGGAACAGCTTGCCCAAGG + Intergenic
968404750 4:330198-330220 CTGATGCTACAGCTAGACCATGG + Intergenic
968559160 4:1268065-1268087 CTGATGCTACAGCTAGACCATGG + Intergenic
996573921 5:124961866-124961888 CTGTTATAACAGCCCAACCAAGG + Intergenic
999227907 5:150042514-150042536 CAGAGGGAACAGCTCGAACAGGG + Intronic
999888658 5:155952510-155952532 CTTTTGGACCAGCAAGACCAAGG - Intronic
1010922743 6:81704171-81704193 CTGTTGGAACAACTTGACTTAGG + Intronic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1019501180 7:1365460-1365482 CGGTTGGGACAGGTGGACCAGGG - Intergenic
1020272810 7:6607258-6607280 CTGGTGGTACAGCACAACCACGG - Intronic
1022528783 7:31054155-31054177 CAGTTGGAAGAGCTGGCCCAGGG - Intronic
1028754100 7:94415249-94415271 CTCTTGGACCAGCAGGACCAGGG - Exonic
1028968427 7:96828475-96828497 CTGTTGGAATAGCTTTTCCATGG + Intergenic
1029419156 7:100463462-100463484 CTGTTGGCCCAGCTCCACCTCGG + Exonic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1035245984 7:157562158-157562180 CTCTGGGGACAGCTCGCCCAGGG + Intronic
1040538107 8:48327162-48327184 TTGTAGGAAGAGCTGGACCAGGG + Intergenic
1044141086 8:88653883-88653905 CAGTTGGAACAGGTAGACTAAGG - Intergenic
1050998899 9:12256265-12256287 TTTTTGGAACAGCTCTGCCAAGG + Intergenic
1053424574 9:38002713-38002735 CTGTTGGAAAAGCTTGAACTTGG - Intronic
1059443867 9:114326176-114326198 CTGTGGAACCAGCTCAACCAGGG - Intronic
1059445073 9:114332953-114332975 CTGTGGAACCAGCTCAACCAGGG - Intronic
1060859069 9:126939029-126939051 CTGTAGGTACAGCTCAGCCAAGG - Intronic
1199372221 X:147063701-147063723 CTTTTTGAACAGCTCTTCCAAGG + Intergenic
1201649482 Y:16269861-16269883 CTGGTGGTACCGCTAGACCAAGG - Intergenic