ID: 1176143885

View in Genome Browser
Species Human (GRCh38)
Location 20:63557006-63557028
Sequence GGGGATGGTGGGAGGCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176143885_1176143897 19 Left 1176143885 20:63557006-63557028 CCGTGATGCCTCCCACCATCCCC No data
Right 1176143897 20:63557048-63557070 ATCAGCACGCCCGCCCGAGGAGG No data
1176143885_1176143896 16 Left 1176143885 20:63557006-63557028 CCGTGATGCCTCCCACCATCCCC No data
Right 1176143896 20:63557045-63557067 CTCATCAGCACGCCCGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176143885 Original CRISPR GGGGATGGTGGGAGGCATCA CGG (reversed) Intergenic
No off target data available for this crispr