ID: 1176144828

View in Genome Browser
Species Human (GRCh38)
Location 20:63560952-63560974
Sequence CTCTGGGTCTAGGGGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176144828_1176144844 19 Left 1176144828 20:63560952-63560974 CCCTGACACCCCTAGACCCAGAG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1176144844 20:63560994-63561016 CACCCGCGTCTGCACACACAGGG 0: 1
1: 0
2: 0
3: 18
4: 161
1176144828_1176144847 28 Left 1176144828 20:63560952-63560974 CCCTGACACCCCTAGACCCAGAG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1176144847 20:63561003-63561025 CTGCACACACAGGGCACCCCAGG 0: 1
1: 0
2: 4
3: 37
4: 295
1176144828_1176144843 18 Left 1176144828 20:63560952-63560974 CCCTGACACCCCTAGACCCAGAG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1176144843 20:63560993-63561015 ACACCCGCGTCTGCACACACAGG 0: 1
1: 0
2: 0
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176144828 Original CRISPR CTCTGGGTCTAGGGGTGTCA GGG (reversed) Intronic
900372978 1:2340446-2340468 GTGTGGGTGGAGGGGTGTCATGG - Intronic
900875512 1:5339989-5340011 CTCTAAGCCTAGGAGTGTCAAGG + Intergenic
901932217 1:12602932-12602954 CTTTGGGGCTGGGGTTGTCAAGG + Intronic
904588886 1:31596580-31596602 CTCTGGGGCTAGCGGTGACCTGG + Intergenic
904614684 1:31743354-31743376 CTCTGGGTCTAGGGGTGGGTGGG - Intronic
904657682 1:32061659-32061681 CTCTGAGTCCAGGGCTGACAAGG + Intergenic
905304676 1:37009396-37009418 ATCTGGGGCTGGGGGTGTGAGGG - Intronic
906120961 1:43390074-43390096 CTCTAGGTCTGGGGGTGGCCGGG + Intronic
906777719 1:48544714-48544736 CTCAGGGTCTCAGGGTCTCAGGG - Intronic
909034935 1:70586286-70586308 GTTTGGGTCTAGGGTTGTTAAGG - Intergenic
909468830 1:76003472-76003494 CTCTGTGTCTAGGGCTCCCAGGG + Intergenic
912457207 1:109806186-109806208 CTTTGGGGGTAGGGGTGTGAGGG - Intergenic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
915698432 1:157768120-157768142 CTCTGGGCCAGGGAGTGTCATGG - Intronic
916051326 1:161038817-161038839 CTCTGGGTTGAGGCGTGGCAGGG - Intronic
916189240 1:162162965-162162987 GTCTGGGGCTAGGGGTGTTGGGG - Intronic
921213080 1:212916400-212916422 CTCTGGGTTAAGGGATGCCATGG - Intergenic
922701944 1:227766303-227766325 ATCTGGGCCCCGGGGTGTCAAGG + Intronic
1062894044 10:1089379-1089401 CTCTGGGCCTGGGGGCCTCAGGG + Intronic
1063547859 10:6999698-6999720 CCCTGGGTCTAGGGCTGTTTTGG - Intergenic
1064012901 10:11749685-11749707 CTCTGGGTGTTTGGGTCTCATGG - Intronic
1065965060 10:30764145-30764167 CTCTGGGGCTGGGCGCGTCATGG - Intergenic
1066291487 10:34018271-34018293 CTCTGGGTGTTGGGGCCTCAGGG - Intergenic
1070549223 10:77477459-77477481 CTCTATGTCTAGGGATGACAAGG + Intronic
1070662807 10:78319727-78319749 CTCTGTGTTTGGGGGTGTAAGGG + Intergenic
1072490993 10:95906012-95906034 CTCTGGGTCCTGGGGTGGGATGG + Intronic
1073344946 10:102776003-102776025 CTCTGGCTCTAGGTGGGTCCAGG + Intronic
1076497085 10:130904451-130904473 CTCTGGGTTTGGGGGTGCTAGGG - Intergenic
1076909107 10:133378759-133378781 CAGTGGGTCTGGGGGTGCCACGG - Intergenic
1077173508 11:1178706-1178728 CTCTGGGCCCAAGGGGGTCATGG + Intronic
1078583417 11:12558193-12558215 CTCTGGTCCTAAGGGTGTCTAGG - Intergenic
1078847158 11:15128733-15128755 CTCTGGGTCCAGGTGGGTGAGGG - Intronic
1082197795 11:49325169-49325191 CTCTGGGACTAGGGCAGTAAAGG + Intergenic
1082681386 11:56175954-56175976 CTCTGTGACTATGGGTGGCATGG - Intergenic
1083688414 11:64391574-64391596 CTCTGGGGAAAGGGGTGCCAAGG - Intergenic
1084219403 11:67668021-67668043 GTCTGGGTGTAGGGGTGGCAAGG - Intronic
1084747657 11:71183621-71183643 GTCAGGGTAGAGGGGTGTCAGGG - Intronic
1086039606 11:82460033-82460055 GACTGGGTCCTGGGGTGTCAGGG + Intergenic
1086658023 11:89382957-89382979 CTCTGGGTCTAGGGCGGTAAAGG - Intronic
1091326213 11:134690118-134690140 CTCTGTGGCCAGGGGTGGCACGG + Intergenic
1092539634 12:9412946-9412968 CTCTAGGTATAGGAGTGTCCAGG - Intergenic
1092569045 12:9702003-9702025 CTCTGGGGCTTGAGGGGTCATGG - Intergenic
1094288067 12:28816713-28816735 CTCAGGGTCTAGGGGTGCCTCGG - Intergenic
1096742135 12:53701750-53701772 CTCTGGGACTCTGGGTGTCTAGG - Intergenic
1097175153 12:57138308-57138330 CTATGTGCCTGGGGGTGTCAGGG - Intronic
1098650939 12:72967657-72967679 CTCTGGTTTTAGGGGTATCCAGG + Intergenic
1099152375 12:79130691-79130713 ATTTGGGACTTGGGGTGTCAAGG + Intronic
1099208598 12:79757260-79757282 CTTTGGGTCTAGGGCTCTCAAGG + Intergenic
1103557385 12:121774854-121774876 CTCTGGGCCCAGGGATGCCAAGG + Intronic
1103906937 12:124332650-124332672 TCCTGGGGCTAGGGGTGTCTTGG + Intronic
1106757317 13:32836071-32836093 CACTGGGTCTAGGGAAGACAAGG - Intergenic
1110324553 13:74199056-74199078 GTCTGGGTCTAGTGGACTCATGG - Intergenic
1113760132 13:112840948-112840970 CTCAGTGTCTGGGGGTCTCAGGG + Intronic
1113761428 13:112850060-112850082 CACTGGGTCAACGGCTGTCATGG - Intronic
1114769887 14:25417015-25417037 CTCTGGGTCTGCTGGTGACACGG + Intergenic
1119545285 14:75467535-75467557 CCCTGCCTCAAGGGGTGTCAGGG - Intronic
1122888593 14:104722604-104722626 CAGTGGGTCTGGGGGTGTCAAGG - Intergenic
1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG + Intergenic
1123794826 15:23761014-23761036 CTCTGAGTTTAGGGTTGTGATGG + Intergenic
1124790074 15:32718610-32718632 CGCTGGGTCTGGGGGCGTCTTGG + Intronic
1128738603 15:70067790-70067812 CTCTGGGGCCAGGAGTGCCATGG - Intronic
1129115484 15:73363207-73363229 CTCTGGGTCTGGGGGTTCCGAGG - Intronic
1129515662 15:76155548-76155570 CTCTGTGACAAAGGGTGTCACGG + Intronic
1129868387 15:78925753-78925775 CTCTGGGTTTATGGGTGTAGGGG - Intronic
1130100774 15:80892213-80892235 CTCTGGGCCAGGGAGTGTCAAGG + Intronic
1131129956 15:89892224-89892246 CTCTGGGGCTGGGAGAGTCATGG + Intronic
1132619092 16:855944-855966 CTTTGGGTCTGGGTGTGTGATGG + Intronic
1132840470 16:1976327-1976349 GGCTGGGCCCAGGGGTGTCAGGG + Intronic
1136607346 16:31345228-31345250 CCTAGGGTCTAGGGGTGTGATGG - Intergenic
1136684179 16:31984357-31984379 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1136784807 16:32927909-32927931 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1136884976 16:33925897-33925919 CTCAGGGTCTTGGGGTGGAAGGG - Intergenic
1137222972 16:46473794-46473816 GTCTCGGTCTAGGGGTCTCCTGG - Intergenic
1137406576 16:48193790-48193812 CTCTGGCTCTTGTGGTCTCAAGG + Intronic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1139668264 16:68473332-68473354 CACTGGGTGGAGGGGAGTCAAGG - Intergenic
1203087468 16_KI270728v1_random:1191915-1191937 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1146296963 17:31657910-31657932 CTCTGGGTCTTGGAGAGGCAAGG + Intergenic
1147145116 17:38480051-38480073 CTCAGGGTCTCGGGGTGGAAGGG + Intronic
1148053150 17:44779118-44779140 CTCTGGGGCAAGGGGTCGCATGG + Intronic
1148854361 17:50570633-50570655 CTCTGGGGCTCGGGGTGTGTTGG + Intronic
1151199220 17:72455518-72455540 CTCTGAGTCTTGTGGTTTCAGGG - Intergenic
1151314255 17:73311998-73312020 CTCTGGCTCTCGGGCTTTCAGGG + Exonic
1151403396 17:73871040-73871062 CATTGGGTCTGGGGGTGGCAGGG - Intergenic
1151464769 17:74277463-74277485 CTCTGGGGCTAGGAGTGGGATGG + Intronic
1152391298 17:80005567-80005589 CTCAGGGTCTTGGGGTCTCAGGG + Intronic
1152524984 17:80883493-80883515 CTCTGGGGCTGGGGGTGGCTGGG - Intronic
1155032781 18:21998758-21998780 GTCTGGGTGTAGGGATGGCAGGG + Intergenic
1156361851 18:36390637-36390659 CTCTGTGACTTGGTGTGTCAAGG + Intronic
1156484707 18:37457388-37457410 CCCTGGATCTTGGGGTGTAAGGG - Intronic
1159236468 18:65680260-65680282 GTCTGGGCCTAGGGAGGTCAAGG + Intergenic
1160719945 19:592615-592637 CTTCGGGACTAGGGGAGTCACGG + Intronic
1160827916 19:1089310-1089332 CTGGGGGTCTGGGGGTGTCCTGG + Intronic
1162299857 19:9838371-9838393 CTGTGGGCCCAGGGGTGTCCTGG + Intronic
1162334550 19:10052474-10052496 CTCTGGGGCTGGGGAAGTCAGGG - Intergenic
1162782446 19:13013315-13013337 CTCTGGCTCCAGGGGTGGCTCGG - Intronic
1163298207 19:16426126-16426148 CACTGGGTCAAGGTGGGTCAAGG - Intronic
1164864207 19:31590492-31590514 CTCTGTGTGTAGGGATGTCAAGG + Intergenic
1167007960 19:46787744-46787766 CGCTGGGACTGGGGGTGTCGGGG - Exonic
1168248108 19:55124509-55124531 TTCAGGGTCTAGGGCTGTAAAGG - Intergenic
1168652226 19:58098455-58098477 CTCCGGGTCTCTGGCTGTCAGGG - Intronic
926464809 2:13175324-13175346 CTCTGGGTCTCCAAGTGTCATGG - Intergenic
927811047 2:26180269-26180291 CGCTGGGTTTAGGGGTCTCCAGG + Intronic
929114935 2:38436061-38436083 CTTTGGGTCTATTTGTGTCATGG + Intergenic
929557131 2:42932402-42932424 CACTGGGTCTTGGGGTGTCTCGG + Intergenic
933885473 2:86716278-86716300 TTCTGGGTCTTGGGCTTTCATGG + Intronic
933924705 2:87080413-87080435 TTCTGGGTCTTGGGCTTTCATGG - Intergenic
934555327 2:95284126-95284148 GTCTGGGGCTTGGGGTGTCCAGG + Intronic
934938736 2:98484142-98484164 CTCTGGGGCCAGGGGTAACATGG - Intronic
936249520 2:110857114-110857136 CTCTGGTCCTTGAGGTGTCACGG - Intronic
941609559 2:167644418-167644440 CTCTGGGTACAGGGTTTTCAGGG - Intergenic
944604990 2:201344749-201344771 TTCTGGGTCTAAGGCTGCCATGG + Intronic
947845035 2:233237030-233237052 CTCTGGGTCTGGAGCAGTCAAGG - Intronic
948790872 2:240376232-240376254 CTCTGCGTCCAGGAGTGTGAAGG + Intergenic
1169204005 20:3730089-3730111 CTCTGGGTCATGGGGAGCCACGG + Intergenic
1170089517 20:12575371-12575393 CTCTGGCTCTGGGTGTCTCACGG + Intergenic
1170673564 20:18457552-18457574 AGCTAGGTATAGGGGTGTCATGG + Intronic
1173337564 20:42125104-42125126 ATCTGGGTCTAGGGCTGGTAAGG + Intronic
1174169163 20:48605516-48605538 CACTGGGTCTGGGGGTGTCCTGG - Intergenic
1175304270 20:57965245-57965267 CTCTGGGAAGTGGGGTGTCAAGG - Intergenic
1176098625 20:63355123-63355145 CTCAGGGTCTGGGTGTGGCAGGG - Intronic
1176144828 20:63560952-63560974 CTCTGGGTCTAGGGGTGTCAGGG - Intronic
1178763062 21:35422561-35422583 CTCTGGGTCTTGGGGTGATGAGG - Intronic
1179414660 21:41188555-41188577 CCCTGGGTCTGGGGGGGTGATGG - Intronic
1179454818 21:41491842-41491864 CACTGGGTCTTGGCTTGTCACGG + Intronic
1179874484 21:44261230-44261252 CTCTGGGTCCAGGGCTGGGATGG + Exonic
1180050927 21:45330670-45330692 CTCAGGGTGAAGGGGGGTCAGGG + Intergenic
1183709066 22:39491845-39491867 CCTTGGGTCTAGGGGTCTCAGGG - Exonic
951159790 3:19404569-19404591 TTCTGGCTCTGGGAGTGTCATGG + Intronic
951691922 3:25405830-25405852 ATCTTGGTCAAGGGGTTTCATGG + Intronic
951732232 3:25823174-25823196 CTCTGGGTTCAGGGCTGTCATGG - Intergenic
953238918 3:41130992-41131014 CTCTGGGTCCAGGACTGCCACGG - Intergenic
956611031 3:71123209-71123231 CCTTGGGTCTAGGGATATCAGGG - Intronic
958115002 3:89203867-89203889 CTCTCAGTCTAGGGGTATTAAGG + Intronic
959088567 3:101877805-101877827 CTCTGGAATTAGGGGTGTCCAGG + Intergenic
959952302 3:112193602-112193624 CTCTGGGTATGGGGATGGCATGG + Intronic
961325716 3:126108239-126108261 CTCAGGGTCTAGAGGGGACAGGG - Intronic
961798734 3:129428314-129428336 CTCTGGGTGAAGGGTTGCCATGG - Intronic
963103708 3:141627611-141627633 CTCTGTGTCCTGGGGTGACAGGG + Intergenic
963111878 3:141695021-141695043 TTCTGGGTCTAGGGCGGTAAAGG + Intergenic
963308880 3:143686426-143686448 CTCTGTGATTAGGGGTGTCTGGG + Intronic
965457181 3:168917066-168917088 CTCTGGGCCTAAGGCAGTCATGG + Intergenic
968973950 4:3811422-3811444 CTTTGGCTGGAGGGGTGTCATGG + Intergenic
969897559 4:10319547-10319569 CTCTGGGTCCATGGTTTTCATGG - Intergenic
971250267 4:24968548-24968570 CTCAGGGTCTAGGGGTGCCTCGG - Intronic
980398783 4:132251942-132251964 CTCTGGGACTGGTGGTGGCAGGG + Intergenic
980993815 4:139761809-139761831 GGCTGGGTCAAGGGGAGTCAGGG + Intronic
982671521 4:158325485-158325507 CCCTGGGTCTGGGGGTGCAATGG - Intronic
986276008 5:6275704-6275726 TTTTGGGTCTAGGGTTGTCAGGG - Intergenic
989281430 5:39648582-39648604 TTCTGGGTGTAGGGGAGGCAAGG + Intergenic
989688941 5:44118474-44118496 CTCTGGGTCTAGGGTGGTAAAGG + Intergenic
993133870 5:83932637-83932659 TTTTGAGCCTAGGGGTGTCATGG - Intergenic
994116590 5:96068028-96068050 CTCTGGGAATAAAGGTGTCAGGG + Intergenic
995624346 5:114060030-114060052 CTGTGGGGCTAGGGCTGTTAGGG - Intergenic
999253603 5:150196881-150196903 CTCAGGGTCTGGGGGAGGCAGGG + Intronic
999379618 5:151110938-151110960 CTCTGGGTTTTGGGGTGCGAAGG - Intronic
999750093 5:154621728-154621750 CTCTGCTTCTGGGGGTATCATGG + Intergenic
1001298216 5:170514198-170514220 CTCTGGGTCCAGGGTTGGCATGG - Intronic
1009590962 6:65670338-65670360 CTTTGGGTTTAGGGGTGGTAAGG + Intronic
1009939248 6:70270313-70270335 CTCTGGGTCCTGGGGGGCCAGGG + Exonic
1009994329 6:70881774-70881796 CTCTGAGAATAGGGGTGTCCAGG + Intronic
1011473198 6:87727904-87727926 TGCTGGGTCGAGGGGTGACATGG - Intergenic
1012625665 6:101401495-101401517 CTGTTGGTTTAGGGTTGTCAAGG - Intronic
1014217631 6:118767973-118767995 CTCTGGATCTTAGGGTGACAGGG - Intergenic
1015467846 6:133567631-133567653 CTCTGGGTGTGGCAGTGTCATGG - Intergenic
1016833370 6:148454263-148454285 CTCTGGGTCAGGGGCTGGCATGG - Intronic
1018423862 6:163662979-163663001 CTCTGGTTGCAGGGGTGACATGG + Intergenic
1019433757 7:1011504-1011526 GTCTGGGTGTGGGTGTGTCAGGG - Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1021867364 7:24971496-24971518 CTCTGGGTGTGGGAGGGTCATGG - Intronic
1022903232 7:34831023-34831045 CTCTTGGTCCAGGGTTGGCAAGG - Intronic
1022948575 7:35313792-35313814 CTCTGTGTCCAGGGGTTACATGG + Intergenic
1026178972 7:68022137-68022159 CTGTGGGTCTGTGGGTGTCCAGG - Intergenic
1029356653 7:100057165-100057187 CTCGGGGTCCAGGGGTATCATGG - Exonic
1029896322 7:103989008-103989030 CGCTGGGGCCAGGGTTGTCATGG + Intronic
1029958151 7:104661122-104661144 CTCTGGGTCCAGAGATGTCATGG - Intronic
1029993438 7:104983866-104983888 TTCTGTGGCTAGGGGAGTCAGGG - Intergenic
1031555447 7:123169776-123169798 CTCTGTTCATAGGGGTGTCAAGG + Intronic
1032617157 7:133485642-133485664 CTCTGGGTCAAGGGAAGTGAAGG - Intronic
1034547550 7:151798974-151798996 TTCTGGGTCTAGCGGTGGCCTGG - Intronic
1035381619 7:158444580-158444602 CTCTGGGTCTAGGGGGGTCTTGG - Intronic
1037567112 8:20127185-20127207 CTCTGGGTCCAGAGGTGCAAAGG + Intergenic
1037913975 8:22760910-22760932 CTTTGGGTCTAGGGTGTTCAAGG + Intronic
1040563041 8:48541430-48541452 CTCTGGCTCTATGGGTGACCAGG + Intergenic
1042692738 8:71520663-71520685 CTCTGGCCCTGGGGGTGTGAAGG - Intronic
1049312087 8:141938654-141938676 CCCTGGGAGTCGGGGTGTCATGG - Intergenic
1049684910 8:143935473-143935495 TTCTGGGTGTGGGGGTGGCAGGG - Intronic
1051142431 9:13992213-13992235 CTCTGGGGCTAGGGGTTTCATGG - Intergenic
1051806315 9:20996565-20996587 CTCTGGATAGAGAGGTGTCAAGG + Intergenic
1053450205 9:38187382-38187404 CTGTGGCTCTAAGGTTGTCAGGG - Intergenic
1055510563 9:76992076-76992098 CACTGGGTCTGGCGGTGTGAAGG - Intergenic
1057155760 9:92837506-92837528 CTCTGGCTCTCGCGATGTCACGG + Intergenic
1058969984 9:110072323-110072345 CTCTGTGGCTAAGGGTGGCAAGG + Intronic
1059952367 9:119479173-119479195 GTCAGGGTCTAAGGGTGACAGGG + Intergenic
1062274003 9:135722131-135722153 CCCTGGGCCCAGGGGTATCACGG - Intronic
1192509623 X:71714171-71714193 CTCTGGGTCTAGGTGTGTGGGGG - Intergenic
1192517074 X:71767382-71767404 CTCTGGGTCTAGGTGTGTGGGGG + Intergenic
1192706103 X:73529611-73529633 TTCAGGGTCTAGGGCTGTAAAGG - Intergenic
1192737160 X:73860769-73860791 CTCTGGGTCTGGTGGTGTGGCGG + Intergenic
1199475301 X:148238490-148238512 ATCTGGGACTAGGGAAGTCAAGG + Intergenic
1199855694 X:151757141-151757163 CTGTGGGTGTAGGGGTGTGTGGG - Intergenic
1200088454 X:153623372-153623394 CGGTGGGTCCAGTGGTGTCAGGG - Intergenic
1200951504 Y:8903267-8903289 CCCAGAGTCTAGGGGTGCCAGGG - Intergenic
1202161444 Y:21940045-21940067 CCCAGAGTCTAGGGGTGCCAGGG + Intergenic
1202197199 Y:22307901-22307923 CCTAGGGTCTAGGGGTGCCAGGG - Intergenic
1202229912 Y:22646328-22646350 CCCAGAGTCTAGGGGTGCCAGGG - Intergenic
1202313244 Y:23549837-23549859 CCCAGAGTCTAGGGGTGCCAGGG + Intergenic
1202557558 Y:26120757-26120779 CCCAGAGTCTAGGGGTGCCAGGG - Intergenic