ID: 1176145476

View in Genome Browser
Species Human (GRCh38)
Location 20:63563487-63563509
Sequence CCCCTACGGCTCCCTGCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176145476_1176145485 -6 Left 1176145476 20:63563487-63563509 CCAGCTGCAGGGAGCCGTAGGGG 0: 1
1: 0
2: 0
3: 19
4: 182
Right 1176145485 20:63563504-63563526 TAGGGGACGGGGCAGGGGTCAGG 0: 1
1: 0
2: 3
3: 76
4: 810
1176145476_1176145486 7 Left 1176145476 20:63563487-63563509 CCAGCTGCAGGGAGCCGTAGGGG 0: 1
1: 0
2: 0
3: 19
4: 182
Right 1176145486 20:63563517-63563539 AGGGGTCAGGCAGCGTCTCCCGG 0: 1
1: 0
2: 2
3: 17
4: 233
1176145476_1176145489 16 Left 1176145476 20:63563487-63563509 CCAGCTGCAGGGAGCCGTAGGGG 0: 1
1: 0
2: 0
3: 19
4: 182
Right 1176145489 20:63563526-63563548 GCAGCGTCTCCCGGTTGCTGGGG 0: 1
1: 1
2: 1
3: 7
4: 116
1176145476_1176145488 15 Left 1176145476 20:63563487-63563509 CCAGCTGCAGGGAGCCGTAGGGG 0: 1
1: 0
2: 0
3: 19
4: 182
Right 1176145488 20:63563525-63563547 GGCAGCGTCTCCCGGTTGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 89
1176145476_1176145487 14 Left 1176145476 20:63563487-63563509 CCAGCTGCAGGGAGCCGTAGGGG 0: 1
1: 0
2: 0
3: 19
4: 182
Right 1176145487 20:63563524-63563546 AGGCAGCGTCTCCCGGTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
1176145476_1176145492 28 Left 1176145476 20:63563487-63563509 CCAGCTGCAGGGAGCCGTAGGGG 0: 1
1: 0
2: 0
3: 19
4: 182
Right 1176145492 20:63563538-63563560 GGTTGCTGGGGAAGAGCAGCCGG 0: 1
1: 0
2: 1
3: 45
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176145476 Original CRISPR CCCCTACGGCTCCCTGCAGC TGG (reversed) Exonic
900243978 1:1629375-1629397 CGCCTGCCGCTCCCTGCAGGGGG - Exonic
902249954 1:15147806-15147828 CCCCAGCAGGTCCCTGCAGCAGG - Intergenic
904541971 1:31239493-31239515 CGCCTTCTGCTGCCTGCAGCTGG - Exonic
905263958 1:36738485-36738507 CCCCACCGTCTCCCTCCAGCAGG - Intergenic
907464035 1:54623441-54623463 TCCCTGAGGCTCCCTGCAGCTGG + Exonic
907522734 1:55035013-55035035 TCCCTGTGGCTCCCAGCAGCGGG + Intergenic
915199921 1:154220106-154220128 ACCCCACGCCTCCCTGCTGCTGG - Intronic
915538423 1:156551781-156551803 GCCCTACTGCTTCCTGCAGCTGG - Exonic
919838783 1:201594412-201594434 CTCCTAAGGCTCCCTCCCGCAGG - Intergenic
920184483 1:204151721-204151743 GCCCGGCGGCTCCCGGCAGCTGG + Exonic
1066460385 10:35607966-35607988 CCCCGAAGGCTGCCTCCAGCAGG - Exonic
1070774164 10:79100181-79100203 CCCCTGGGGCTCCCCTCAGCAGG - Intronic
1071739430 10:88340219-88340241 TTCCTAAGGCACCCTGCAGCAGG - Intronic
1074182748 10:111078038-111078060 GCCCATGGGCTCCCTGCAGCCGG + Exonic
1076002934 10:126926779-126926801 CCCGTAGGGCTCCCTGGAGCTGG + Intronic
1076714001 10:132354130-132354152 CCCTTTCTGCCCCCTGCAGCTGG - Intronic
1076898768 10:133326877-133326899 CCCCGACGGCTTCCTGCTGCGGG - Exonic
1077199732 11:1299951-1299973 TCCTTATGGCTCCCTGCAGCAGG - Intronic
1077240473 11:1508015-1508037 ACCCCACGGCCCCCTGGAGCTGG + Intergenic
1077429911 11:2511258-2511280 CCCCTACTGTTCCTGGCAGCAGG + Intronic
1079543147 11:21600005-21600027 CACCTAAGCCTCCCTGTAGCTGG + Intergenic
1081567901 11:44270968-44270990 CCCCTGCAGCCCCCTGGAGCAGG + Intronic
1081645198 11:44785522-44785544 CCCCCACCGCCCCCTGAAGCAGG + Intronic
1081776501 11:45679182-45679204 CCCCAAGGGCTGCCTGCAGAGGG + Intergenic
1082003893 11:47409275-47409297 GGCCTGGGGCTCCCTGCAGCAGG - Intronic
1083326594 11:61876187-61876209 CCCCGCCGGCTTCCGGCAGCTGG - Exonic
1083484873 11:62977001-62977023 TACCTACTGCTCCCTGGAGCTGG + Intronic
1083618331 11:64036921-64036943 CAACCACGGTTCCCTGCAGCTGG - Intronic
1083641534 11:64148308-64148330 CCCCTCCACATCCCTGCAGCTGG + Intronic
1089305353 11:117522921-117522943 CCCCTACCCCTCCCCACAGCAGG - Intronic
1089311329 11:117560034-117560056 CCCCCACCCCTCCCAGCAGCCGG - Intronic
1090438590 11:126708033-126708055 CCCCTCCGCATCCCTGAAGCAGG + Intronic
1091657031 12:2353501-2353523 GCCCTGGGGCTCCCTGCAGCAGG + Intronic
1097279038 12:57833232-57833254 CCTGTTGGGCTCCCTGCAGCGGG - Intronic
1104140703 12:125983813-125983835 CCCCTACCGCGCCCTGCCCCCGG - Intergenic
1104784109 12:131438723-131438745 CCACTTCGGCTCACTGCAGTGGG - Intergenic
1105439858 13:20405926-20405948 CCCGTTCGCCTCCCGGCAGCAGG - Intronic
1108578788 13:51811301-51811323 CCCCTCCCGCCCCCAGCAGCAGG - Intergenic
1108615623 13:52129088-52129110 CCGCTGCGCCTCCCTGCGGCCGG + Intergenic
1113457414 13:110458382-110458404 CCCTGACGGCTCCCTGGAGCCGG + Intronic
1117307236 14:54488791-54488813 CCGCTTCCGCTCCCAGCAGCTGG - Intronic
1121044998 14:90781489-90781511 ACCCTGCGGCTCCCTTCATCAGG + Intronic
1123011003 14:105349459-105349481 CCCACACAGGTCCCTGCAGCTGG + Intronic
1123020164 14:105394284-105394306 CCCCCAGGGCTGCCTGCAGGTGG - Intronic
1124619179 15:31264459-31264481 CCCCTGCCGCCCCCTGGAGCTGG - Intergenic
1125524744 15:40367873-40367895 CCACTTCGGCTACCTGCTGCTGG + Exonic
1125859607 15:42986768-42986790 CCCCCACAGCTCCCTCCACCAGG + Intronic
1128108911 15:65063892-65063914 CCCCCTGCGCTCCCTGCAGCAGG - Intronic
1128430434 15:67588009-67588031 CCCCTCCTCCACCCTGCAGCTGG + Intronic
1128520744 15:68373147-68373169 CACCGACGGCTTCCTGGAGCAGG - Intronic
1129648813 15:77464725-77464747 CACATAGGGCTCCATGCAGCAGG - Intronic
1132461536 16:57730-57752 CCTTTAGGGTTCCCTGCAGCAGG + Intergenic
1133201638 16:4207565-4207587 CTGCTACTGCTCCCTGCACCAGG + Intronic
1133267614 16:4594341-4594363 CCACTGCTGTTCCCTGCAGCAGG - Exonic
1134133801 16:11667231-11667253 CCTATGTGGCTCCCTGCAGCTGG - Intergenic
1136500020 16:30665365-30665387 CTCCTTTGGCTCCCTGCAGGGGG + Exonic
1137559258 16:49492509-49492531 CCACTCCTGCTCCCTGGAGCAGG + Intronic
1139558071 16:67725190-67725212 GCCAGACAGCTCCCTGCAGCTGG - Exonic
1139717438 16:68824715-68824737 CCCCTAGGGCTCACTCCAGGTGG - Intronic
1139744740 16:69065218-69065240 ACCATGCAGCTCCCTGCAGCTGG - Intronic
1140453163 16:75087861-75087883 CCCCAGCGGCTCCCTGCACATGG - Intronic
1140526705 16:75629057-75629079 CCCCACAGGCTGCCTGCAGCAGG - Intronic
1141804030 16:86330902-86330924 CCCCTACGGCACTCTGCTGGAGG - Intergenic
1142079935 16:88143557-88143579 GCCATGCGTCTCCCTGCAGCAGG + Intergenic
1142190422 16:88714765-88714787 CCCCTCCCGCCCCATGCAGCTGG - Intronic
1142750827 17:1986606-1986628 CCCCCACGGCCCCCAGAAGCTGG + Intronic
1142849402 17:2697001-2697023 GGCCCACGGCTCCCGGCAGCTGG + Intronic
1143661500 17:8327174-8327196 GCCATAGGGCTTCCTGCAGCGGG + Intergenic
1152270776 17:79323613-79323635 TCCCCAAGCCTCCCTGCAGCGGG + Intronic
1152640770 17:81448316-81448338 CCCATAGGCCTCCCTGCAGCAGG - Intronic
1152700252 17:81815059-81815081 CCCCGGGGGGTCCCTGCAGCAGG + Intergenic
1156788113 18:40939810-40939832 CGGCCACGGCCCCCTGCAGCCGG + Intergenic
1160259201 18:77275299-77275321 CCCAGAGAGCTCCCTGCAGCGGG - Exonic
1160332064 18:78003050-78003072 GCCATACGGCTCCTTGCAGGTGG - Intergenic
1160694263 19:474901-474923 GCCCCACGACTCCCTGCTGCGGG - Exonic
1160795926 19:945456-945478 CTCCGTCTGCTCCCTGCAGCGGG + Intronic
1160857041 19:1222322-1222344 CTCCTGGGGCTCCCAGCAGCAGG + Intronic
1160865850 19:1255639-1255661 CCCCTCAGCCTCCCTGCTGCAGG + Exonic
1160932338 19:1576723-1576745 CGCCCACGGCTCCCTCCACCAGG + Exonic
1161060310 19:2211355-2211377 CCTCTACTGACCCCTGCAGCAGG - Intronic
1161216157 19:3095885-3095907 CCCGACTGGCTCCCTGCAGCAGG - Intronic
1161682612 19:5687561-5687583 CTTCTTCGGCTCCCTGCGGCGGG + Exonic
1163219939 19:15911719-15911741 CCCTAAGGGCACCCTGCAGCCGG - Intergenic
1163363947 19:16865720-16865742 CTCCAAGGGCTCCCTGCAGTGGG - Intronic
1164421873 19:28100635-28100657 CCCTTCCTGCTCTCTGCAGCAGG + Intergenic
1165825907 19:38705622-38705644 CCCCTAGGCCTCTCTACAGCTGG + Intronic
1166283536 19:41810251-41810273 CCCCTACGCCTTCCTGGAGAGGG + Intronic
1167219235 19:48186752-48186774 CCCCTGCAGCTCCCAGAAGCTGG - Intronic
1167473564 19:49688143-49688165 GCCCCACCTCTCCCTGCAGCGGG + Exonic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1167622651 19:50568035-50568057 CCCCCGCGCCTCCCCGCAGCGGG - Intronic
1167826207 19:51975870-51975892 AGCCTTCGGCTCCCTGCAGCAGG - Intronic
926134850 2:10329397-10329419 TCCCTCGGGCTCACTGCAGCTGG - Intronic
927509206 2:23634043-23634065 CCCCCACGGCTCCCTGGTGTAGG + Intronic
927783247 2:25955573-25955595 CACCTACACATCCCTGCAGCAGG - Exonic
927809130 2:26172493-26172515 CACCTCCGGCTCCGTGGAGCTGG - Intergenic
930024974 2:47024323-47024345 CCTCTATGTCTCGCTGCAGCTGG + Exonic
930196374 2:48514787-48514809 GCCCTGCGGCTCTGTGCAGCAGG - Exonic
930700877 2:54456860-54456882 CGCCGGCGCCTCCCTGCAGCCGG + Intronic
934571771 2:95377107-95377129 CACCTGGGGCTCCCTGCTGCTGG - Intronic
935270134 2:101427355-101427377 TCTCTCTGGCTCCCTGCAGCTGG - Intronic
936863875 2:117055655-117055677 CCCCTAGAGCTCCGGGCAGCGGG - Intergenic
937288611 2:120768486-120768508 CCCCTTCTGTTCCCAGCAGCGGG - Intronic
937369820 2:121289404-121289426 CTGCCAAGGCTCCCTGCAGCAGG + Intergenic
938277163 2:130037198-130037220 GCCCTACGGCGCCCTGGAGCTGG + Intergenic
938328134 2:130427971-130427993 GCCCTAGGGCGCCCTGGAGCTGG + Intergenic
938361815 2:130693507-130693529 GCCCTAGGGCGCCCTGGAGCTGG - Intergenic
938438221 2:131300191-131300213 GCCCTACGGCGCCCTGGAGCTGG - Intronic
938895196 2:135742336-135742358 CCGCTGCGTCTCCCGGCAGCCGG + Intronic
942003939 2:171678891-171678913 CCCTTACTCCTCCCTGCAGGAGG + Intergenic
945041407 2:205746357-205746379 CCCCATCAGCTCCCTGCAACAGG - Intronic
945170000 2:206985982-206986004 CCCCTGCCGATCCCTGCAGAAGG + Intergenic
946169600 2:217886813-217886835 TACCTAGGGCTCCCAGCAGCAGG - Intronic
946242943 2:218367913-218367935 CCCTTTCCGCTCCCTGGAGCCGG + Exonic
947742264 2:232490061-232490083 ACCCAACTGCTCCCTGAAGCTGG - Intergenic
948516878 2:238509695-238509717 CCCCTGCTGCTCCCTGCACTGGG + Intergenic
948767852 2:240232826-240232848 CCCCCAGGGCTCCCAGCAGCGGG + Intergenic
948972665 2:241441463-241441485 CCACTGCGCCTCTCTGCAGCTGG - Exonic
1168878143 20:1185223-1185245 CCCGTCCGCCTTCCTGCAGCCGG + Intronic
1170673131 20:18453492-18453514 CCCCCATGGCTCCCGGCAGTGGG + Intronic
1171947005 20:31387721-31387743 CCCCTGCAGCTCCTTGAAGCAGG + Intronic
1172187749 20:33041857-33041879 CCCCAACGCCTCCCTGATGCAGG - Intronic
1175217306 20:57398386-57398408 CCGCCACGGCGACCTGCAGCTGG - Intronic
1175237152 20:57522681-57522703 CCTCTACGGCTTCCTGAAGGAGG + Intronic
1175826048 20:61937105-61937127 CCCCCACAGCGCCCTGCACCCGG + Exonic
1176145476 20:63563487-63563509 CCCCTACGGCTCCCTGCAGCTGG - Exonic
1176429305 21:6566428-6566450 CCCCTCCTCCTCCCTCCAGCAGG + Intergenic
1178508580 21:33183181-33183203 CCCCTACAGCTCCCTGCGTGCGG + Intergenic
1179253612 21:39696370-39696392 CACCTACTGCTGCCTGCAGCGGG - Intergenic
1179502578 21:41819514-41819536 CCCTTCCAGCACCCTGCAGCAGG + Intronic
1179704697 21:43173890-43173912 CCCCTCCTCCTCCCTCCAGCAGG + Intergenic
1179714986 21:43281929-43281951 CTCCGGCCGCTCCCTGCAGCGGG + Intergenic
1179878300 21:44282506-44282528 CCGCCACGGCTCCCTGGAGGTGG - Intergenic
1180701925 22:17785831-17785853 CCCCAAGGTCTTCCTGCAGCGGG - Intergenic
1181044817 22:20209565-20209587 CCTCTGCGTCTCCCTGCATCTGG + Intergenic
1181639663 22:24189963-24189985 CCCCTCCGCCTCCCCGCACCTGG + Intergenic
1181694221 22:24584973-24584995 CCCCCAAGGCCCCCTGCTGCTGG + Intronic
1181965754 22:26655794-26655816 TCCCCAGGGCTCACTGCAGCTGG + Intergenic
1183201351 22:36387576-36387598 CCCCTAGGCCTCGCTGCTGCCGG + Intronic
1183368135 22:37417916-37417938 CCCCCTCGCCTCCCTGCAGAAGG - Exonic
1184568315 22:45306684-45306706 CTCCTGCTGCTCCCTGCATCCGG - Intergenic
1184710288 22:46245607-46245629 CCCCTGCCGCTCCCAGCACCAGG - Intronic
1185210416 22:49567727-49567749 CCCCAAAGGATGCCTGCAGCTGG + Intronic
950130901 3:10546213-10546235 CCCCAACTGCCCCCTGGAGCTGG + Intronic
950581632 3:13866113-13866135 CCCCAACTCCTCTCTGCAGCAGG - Intronic
952485689 3:33807544-33807566 CACCTACGGCCCCCTGGGGCAGG + Intronic
954636299 3:52072723-52072745 ACCCGATGGCTCCCTGTAGCTGG - Intergenic
955953839 3:64268038-64268060 CCCCTTCGGCTCCGGGCAGTTGG - Intronic
959932498 3:111999348-111999370 AGCCTCCGGCTCCCTGCAGACGG - Exonic
961319105 3:126060774-126060796 CACCTGCTGCTCCGTGCAGCTGG - Intronic
961534643 3:127562497-127562519 CCCCTGAGGATCCATGCAGCAGG + Intergenic
961683077 3:128611881-128611903 CCCCCAGGGCTCCCAGCACCTGG + Intergenic
962832569 3:139157493-139157515 CCTTCACGGGTCCCTGCAGCGGG + Intronic
967493610 3:190120263-190120285 GCCCTACAACTACCTGCAGCGGG - Exonic
968010465 3:195270971-195270993 CCACTACTGCGCCCTGCTGCTGG - Exonic
968222201 3:196947600-196947622 CCTCTTCGGCTGCCTGCATCAGG - Exonic
968230482 3:197002579-197002601 CACCTCCGGCTCCCTTCAGGCGG + Exonic
968505277 4:968447-968469 CCCCCAGGGCTCCCTGGGGCCGG + Intronic
969621651 4:8281744-8281766 CCCCTACTGCTGACGGCAGCAGG + Intronic
969683607 4:8656800-8656822 TGCCTGGGGCTCCCTGCAGCTGG - Intergenic
970777583 4:19694442-19694464 CCCCTTCGCCTCACTCCAGCAGG + Intergenic
978874476 4:113622434-113622456 CCCCTCCAGCTCCCTCCAGCAGG + Intronic
981029525 4:140110277-140110299 CCCCTACGACTGCATGCAGCAGG + Intronic
983952036 4:173653890-173653912 ACTCTACTGCTTCCTGCAGCAGG + Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986249633 5:6044491-6044513 CCCCTGCGGCTCCCTGCACTGGG - Intergenic
990509974 5:56481159-56481181 CCCCCACGGCCCCCACCAGCTGG + Intronic
992530132 5:77645294-77645316 CCCCTACCGCACCCCCCAGCCGG + Intergenic
997231866 5:132251377-132251399 TCCCTATGGCCCCCTGCACCTGG + Intronic
1000541929 5:162550848-162550870 CCCCTAGAGGTCCCAGCAGCGGG + Intergenic
1006096755 6:31660963-31660985 CCCCTACAGCCCCCTGCCCCTGG + Intergenic
1006400521 6:33814658-33814680 TCCCTACCGCTCCCTCCAGCAGG + Intergenic
1006839867 6:37021852-37021874 ACCCTACTGCCCCCTGCAGCTGG - Intronic
1006929254 6:37677910-37677932 CCCCTATCTCCCCCTGCAGCTGG - Intronic
1007092459 6:39192707-39192729 CCAAGAAGGCTCCCTGCAGCAGG - Intronic
1014913606 6:127119949-127119971 CACCTCCGGCTCCCCACAGCTGG - Intronic
1016010669 6:139135197-139135219 CCTCTCCGGCTTCCTGGAGCCGG - Exonic
1019266322 7:119347-119369 CACCCACGGCTCCCTCCAGTGGG + Intergenic
1019310240 7:356937-356959 CCCCTTCCCCTCCCTGCTGCAGG - Intergenic
1019940067 7:4282734-4282756 CCCCCACACCACCCTGCAGCAGG - Intergenic
1022109443 7:27219544-27219566 CCCCTCCCCATCCCTGCAGCTGG - Intergenic
1031021516 7:116633698-116633720 ACGCTCCGGCTCCCTTCAGCTGG + Intergenic
1033477158 7:141702084-141702106 CCCCGCCGTCTCCCTGCCGCAGG - Exonic
1035036406 7:155897985-155898007 TCCCTGAGGCTCCCTGCAGCTGG - Intergenic
1037814843 8:22106710-22106732 CCCCTGGGGCTCCCTCCAGTTGG - Intergenic
1038005654 8:23427738-23427760 CCCCTAGCGTCCCCTGCAGCAGG + Intronic
1045311413 8:101006494-101006516 GCCCTTCGTCTCCCTGTAGCTGG + Intergenic
1047004532 8:120605985-120606007 CCCCTACTCGTCCCTGCATCTGG + Intronic
1049246043 8:141563142-141563164 CCCCCATGCCTGCCTGCAGCCGG - Intergenic
1049712883 8:144074276-144074298 CCCCTCCAGCTCTATGCAGCAGG - Intergenic
1049766368 8:144357118-144357140 CCCCTCTGTCTCCCCGCAGCTGG - Exonic
1052825475 9:33170982-33171004 TCCCTGCTTCTCCCTGCAGCTGG + Intergenic
1053054931 9:34988588-34988610 CCCCGCCTGCTCCCTGCATCGGG + Intergenic
1053381090 9:37650530-37650552 CCCCCAGGGCTCCCCGTAGCTGG + Intronic
1055308502 9:74953993-74954015 CCATCACGGCTCACTGCAGCCGG + Intergenic
1059331957 9:113541328-113541350 CCCTTTCGGCTCTCTCCAGCAGG + Intronic
1062027285 9:134346441-134346463 CCCCCACTGGTCCTTGCAGCTGG + Intronic
1062068843 9:134544416-134544438 AGCCAGCGGCTCCCTGCAGCTGG - Intergenic
1062286526 9:135775388-135775410 CCCCTTCTGCTGCCTGCGGCTGG + Exonic
1062641632 9:137521588-137521610 CCCATGCTGCTCCATGCAGCTGG - Intronic
1190087029 X:47404277-47404299 CCCCTCGGCCTCCCTGTAGCTGG + Intronic
1196935588 X:120727462-120727484 CCCCTAGGGCAGCTTGCAGCAGG - Intergenic