ID: 1176146909

View in Genome Browser
Species Human (GRCh38)
Location 20:63569570-63569592
Sequence CGCCAGGCCGGCTCTACGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176146909_1176146922 30 Left 1176146909 20:63569570-63569592 CCGTGCGTAGAGCCGGCCTGGCG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1176146922 20:63569623-63569645 CTCCTGGCTCCTGCTTCAGCAGG 0: 1
1: 0
2: 4
3: 44
4: 353
1176146909_1176146920 14 Left 1176146909 20:63569570-63569592 CCGTGCGTAGAGCCGGCCTGGCG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1176146920 20:63569607-63569629 ACCAGAGAGAAGTCGGCTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 199
1176146909_1176146918 7 Left 1176146909 20:63569570-63569592 CCGTGCGTAGAGCCGGCCTGGCG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1176146918 20:63569600-63569622 GGGAGCCACCAGAGAGAAGTCGG 0: 1
1: 0
2: 2
3: 24
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176146909 Original CRISPR CGCCAGGCCGGCTCTACGCA CGG (reversed) Exonic
900237079 1:1598056-1598078 CGCCTGACCGGCGCCACGCAGGG + Exonic
1072426748 10:95336625-95336647 TGCCGGGCCGGCTCTCCTCAGGG + Exonic
1074753723 10:116609696-116609718 CGCGAGGCCGCCTCGACCCAGGG - Intergenic
1077169456 11:1159741-1159763 CACCATGCTGGCTCTATGCAGGG + Intronic
1078057579 11:8019783-8019805 CGCCCCGCCGGCCCTCCGCAGGG + Intronic
1085319725 11:75566480-75566502 GGCCAGGCCGGCGCTGCGCTCGG - Exonic
1102711893 12:114935414-114935436 CTCCAGGCCTGCTCTAAGCATGG - Intergenic
1123156530 14:106232684-106232706 GGCCAGACAGGCTCTACTCAAGG + Intergenic
1126767063 15:52019635-52019657 CGCCTGGCCGGCCCCACGCGGGG - Intronic
1135995499 16:27244694-27244716 CCCCAGGCCCGCTCTACCGAGGG + Intronic
1148228992 17:45919454-45919476 CGCCAGGCCGGATCCACGAACGG + Intronic
1151696814 17:75722068-75722090 CGCCATCCCGGCTCCAGGCAGGG + Intronic
1151725117 17:75878899-75878921 GGCCAGGCCAGCGCTCCGCAGGG + Intergenic
933749810 2:85596026-85596048 CCCCAGGCCGGCCCAACGGACGG - Intronic
934678469 2:96266068-96266090 CGCGCCGCCGGCTCTGCGCAGGG + Intergenic
942837708 2:180320347-180320369 CTCCAGGCCTGTTCTACCCAGGG + Intergenic
946407023 2:219497227-219497249 CGCCAGCCCAGCTCTGGGCACGG + Intronic
948466865 2:238156482-238156504 CCCCACGCCGGCTCTGCCCATGG + Intergenic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1178603134 21:34012285-34012307 GGCCAGGCTGCCTCCACGCATGG - Intergenic
1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG + Intronic
1180712538 22:17849169-17849191 CGACAGGCAGGCTCTACACACGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1185272368 22:49935293-49935315 CCCCAAGCCCGCTCTGCGCAGGG - Intergenic
968473447 4:792151-792173 AGCCAGCCAGGCTCCACGCAGGG + Intronic
969207152 4:5655590-5655612 CGCCAGGCCTGCACCACCCAAGG + Intronic
1002261518 5:177996576-177996598 CGCCAGGCAGGCTCCACTCCTGG - Intergenic
1007609881 6:43142458-43142480 CGACAGCCCGGCTCTGAGCAAGG - Intronic
1019492371 7:1321427-1321449 CCCCAGGCCGGCTCCCCCCAGGG - Intergenic
1025208516 7:57007725-57007747 CGCCTGGCAGGCTCTGCGCTTGG - Intergenic
1025663432 7:63569153-63569175 CGCCTGGCAGGCTCTGCGCTTGG + Intergenic
1029697682 7:102224964-102224986 TGCCAGGCCGGCCCCTCGCATGG + Intronic
1034979583 7:155467376-155467398 CGCCAGGCCTGCCCGACCCAGGG - Intergenic
1035454873 7:159001585-159001607 AGGCAGGCCGGCTCTCAGCACGG - Intergenic
1037477864 8:19275435-19275457 ACCCAGGCCTGCTCTATGCAGGG - Intergenic
1040073675 8:43208237-43208259 GGTCAGCCCGGCTCTACACAAGG - Intergenic
1056051963 9:82778220-82778242 CGCCAGGCCAGTTCTCTGCATGG - Intergenic
1059430829 9:114249400-114249422 CACCACGCTGGCACTACGCATGG - Intronic
1062190159 9:135243869-135243891 CGCCAGGCGGGGTCTAGACAGGG - Intergenic
1186456383 X:9713169-9713191 CGTCGGGTTGGCTCTACGCAGGG - Intronic
1187332526 X:18354233-18354255 CCCCAGCCCGGCCCTACCCACGG + Intronic