ID: 1176146918

View in Genome Browser
Species Human (GRCh38)
Location 20:63569600-63569622
Sequence GGGAGCCACCAGAGAGAAGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176146908_1176146918 8 Left 1176146908 20:63569569-63569591 CCCGTGCGTAGAGCCGGCCTGGC 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1176146918 20:63569600-63569622 GGGAGCCACCAGAGAGAAGTCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1176146915_1176146918 -5 Left 1176146915 20:63569582-63569604 CCGGCCTGGCGGGAGGCCGGGAG 0: 1
1: 0
2: 1
3: 47
4: 344
Right 1176146918 20:63569600-63569622 GGGAGCCACCAGAGAGAAGTCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1176146916_1176146918 -9 Left 1176146916 20:63569586-63569608 CCTGGCGGGAGGCCGGGAGCCAC 0: 1
1: 0
2: 2
3: 22
4: 220
Right 1176146918 20:63569600-63569622 GGGAGCCACCAGAGAGAAGTCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1176146906_1176146918 9 Left 1176146906 20:63569568-63569590 CCCCGTGCGTAGAGCCGGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1176146918 20:63569600-63569622 GGGAGCCACCAGAGAGAAGTCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1176146909_1176146918 7 Left 1176146909 20:63569570-63569592 CCGTGCGTAGAGCCGGCCTGGCG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1176146918 20:63569600-63569622 GGGAGCCACCAGAGAGAAGTCGG 0: 1
1: 0
2: 2
3: 24
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176146918 Original CRISPR GGGAGCCACCAGAGAGAAGT CGG Exonic
900761490 1:4474751-4474773 GGAAGTCACCAGAGAGCATTAGG + Intergenic
901752473 1:11419209-11419231 GGGAGCAACCAGAGAGAGACAGG - Intergenic
902197865 1:14810999-14811021 GGAGGCCACCAAAGAGCAGTTGG - Intronic
902254212 1:15177051-15177073 GGGAGGCAGCAGGGAGTAGTGGG + Intronic
903141465 1:21341739-21341761 GAGAGGCACCAGAGTGACGTGGG + Intronic
903179499 1:21598105-21598127 GGGAGGCACCAGGGAGACGGGGG + Intronic
903875634 1:26471721-26471743 GGGAGCCACCCGAGAGGAGTTGG + Intergenic
904238250 1:29127727-29127749 GGGTCCCTCCAAAGAGAAGTGGG - Intergenic
904583398 1:31564622-31564644 GGGAGGCTCCAGAGAGGAGGTGG - Intergenic
905462312 1:38129781-38129803 GGGACCCAGCAGGAAGAAGTTGG - Intergenic
907293168 1:53430801-53430823 GAGAGCCAGCAAACAGAAGTAGG + Intergenic
907647930 1:56262877-56262899 GGGAGCCTGCAGAGTGAAGCAGG + Intergenic
910359725 1:86403675-86403697 GAGAGCCACCACTGAAAAGTTGG + Intergenic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
911621371 1:100069416-100069438 GGGACCCACCATGGATAAGTAGG + Intronic
911659855 1:100489060-100489082 GGCAGCCAGAAGAGAGATGTGGG + Intronic
912512382 1:110198183-110198205 TGGAGCCATCAGAGAGCAGGTGG - Exonic
913553806 1:119943343-119943365 AAGAACCACCAGAAAGAAGTAGG + Intronic
916445083 1:164864588-164864610 GGCAGCCACCAGAGCAAACTGGG + Intronic
917328910 1:173862066-173862088 GGGAGGTACCAAAGACAAGTTGG - Intergenic
917456894 1:175193100-175193122 GGGAGCCACCGGCGGGAAGACGG - Intergenic
920709109 1:208278105-208278127 GGGAGCCACCAGGCAGAAATGGG + Intergenic
924559844 1:245148897-245148919 GGGGGCCACCAGAGAGTCATCGG - Intergenic
1064472154 10:15646980-15647002 GAGAGCAACCCCAGAGAAGTAGG - Exonic
1065266209 10:23978889-23978911 CAGAGCCACCAGAGAGAACATGG - Intronic
1065300315 10:24315143-24315165 GGAAGCTTCCAAAGAGAAGTGGG + Intronic
1065990393 10:31003802-31003824 GGGAGCCACCAGAGAGTTTTGGG - Intronic
1067266456 10:44749488-44749510 GGAAGCCACAAGAGAGAACGGGG + Intergenic
1068324500 10:55466809-55466831 GGGAGACGCTAGAAAGAAGTAGG - Intronic
1071561867 10:86651620-86651642 GGGAGGAACCAGAGCAAAGTGGG + Intergenic
1073550863 10:104399980-104400002 GGGACCTGGCAGAGAGAAGTTGG + Intronic
1074272318 10:111966667-111966689 GGGAGGCAGGAGAGGGAAGTGGG + Intergenic
1075743811 10:124712617-124712639 GGGAGTCACGGGAGAGAGGTGGG - Intronic
1076121767 10:127941901-127941923 CAGAGCCACCAGTGAGAAGTTGG + Intronic
1076730743 10:132437666-132437688 GGGTGCCCACAGAGGGAAGTGGG - Intergenic
1077445774 11:2590002-2590024 TGGAGCTCCCAGGGAGAAGTGGG - Intronic
1078477942 11:11649110-11649132 AAGAGCCACCAGAAAGCAGTAGG + Intergenic
1079843608 11:25435478-25435500 GGGAGACAGCAGAGAGGAGTTGG - Intergenic
1081481982 11:43497961-43497983 GGCAGAAACCAGAGAGAAGAGGG - Intergenic
1082003445 11:47407323-47407345 CTGGGCCACCAGGGAGAAGTTGG + Intronic
1083945397 11:65920196-65920218 GGGAGCCACCTGAGTAAAGCAGG + Intronic
1084704837 11:70810160-70810182 GTGAGCCACCAGGGAGCAGAGGG + Intronic
1085351258 11:75799286-75799308 GAGAGCCACCAGAGAGTGTTTGG + Intronic
1087074308 11:94114957-94114979 TAGAGCCTCCAGAGAGAGGTTGG + Intergenic
1087076043 11:94128333-94128355 GGGAGCCAGCAGAGAGAGGGGGG - Intergenic
1088663661 11:112073490-112073512 GGGAGCCACCAGTCAGGTGTTGG - Intronic
1088737361 11:112738708-112738730 GGGAGCAACCTGAGAGCAGGAGG - Intergenic
1088802644 11:113320440-113320462 GGGAGCAGCCAGAGGGGAGTTGG + Intronic
1089526540 11:119100954-119100976 GGGAGGTACCTGAGAGAACTGGG - Intronic
1089742354 11:120593316-120593338 GGCAGCCGCCAGATTGAAGTGGG - Intronic
1089746892 11:120623899-120623921 GGGAGGGCCCAGAGAGAAGCAGG - Intronic
1090238247 11:125165012-125165034 GGGAGCGTGCAGAGAGAAGCTGG + Intronic
1090422422 11:126584655-126584677 GTTAGACACCAGAGAGAAGCTGG - Intronic
1090658457 11:128863093-128863115 GGTAGTCACCTGAGAGAACTTGG + Intronic
1090805095 11:130197781-130197803 GGGAGCCAGCGGAGGGAGGTGGG + Intronic
1092164237 12:6333232-6333254 GGGGGCGGCCAGAGAGGAGTTGG + Intronic
1093322396 12:17728898-17728920 GGGAGCCATCAGCAAAAAGTGGG + Intergenic
1094479385 12:30869664-30869686 AGGAGGCACCAGAGGGAGGTTGG - Intergenic
1100618727 12:96251336-96251358 GGGAGACACAGGAGAGCAGTTGG - Intronic
1101262073 12:103043707-103043729 GGCAGCCAGCAGAGAGGATTAGG - Intergenic
1101574089 12:105981324-105981346 GGAAGCCAGCAGAGAGTAGCTGG + Intergenic
1101946221 12:109139569-109139591 GGGAGACACCGCAGAGAAATGGG + Exonic
1104052858 12:125208145-125208167 GTGAGCTACCAGGGAGATGTGGG - Intronic
1104953622 12:132453518-132453540 GGGAGGCACCACAGACATGTGGG - Intergenic
1107442735 13:40442712-40442734 GGGAGACAGCAGAGAGAGCTGGG + Intergenic
1111790702 13:92851333-92851355 GGGAGCCAAATGGGAGAAGTAGG - Intronic
1113437166 13:110302120-110302142 GGAAGCATCCAGAAAGAAGTAGG + Intronic
1114615724 14:24067300-24067322 GGGAGCCACTAAAGAAAAGCTGG + Intronic
1114841087 14:26262439-26262461 GGTAGCAAGCAAAGAGAAGTAGG + Intergenic
1115555802 14:34544284-34544306 TGGAGCAAACAGAGAGAAGCAGG + Intergenic
1115558106 14:34558803-34558825 TGGAGCAAACAGAGAGAAGCAGG - Intergenic
1116153407 14:41171269-41171291 GGGAGACCCCTGAGTGAAGTAGG + Intergenic
1117753339 14:58946485-58946507 GGAAGCCACTAGAGAGATCTAGG - Intergenic
1118180045 14:63483573-63483595 GGGCGCCACTAGAGAAAAGCTGG + Intronic
1118318913 14:64742079-64742101 GGGAGCCATCACAGAGGAGTCGG + Exonic
1120002399 14:79317261-79317283 GAGAGCCTCCAGAGAGATCTTGG - Intronic
1121234047 14:92379559-92379581 GGGAGACGCCAGAGAGGAGGAGG - Intronic
1122520279 14:102338923-102338945 GGGAGCTAGCAGCGAGAAGAGGG + Exonic
1122799976 14:104224638-104224660 GGGAGCCCCCACTGTGAAGTGGG - Intergenic
1122819641 14:104335024-104335046 GGGAGCCACCTGACAGGGGTGGG - Intergenic
1123144779 14:106118403-106118425 GGGAGCCTGCAGAGAAAACTAGG + Intergenic
1202851395 14_GL000225v1_random:22734-22756 GCGAGACCCCAGAGAGAAGATGG - Intergenic
1127667688 15:61165054-61165076 GGGAACCTACAGAGAGAAGCAGG - Intronic
1128324883 15:66717816-66717838 GGGAGCCACCAAAGACCAGAAGG - Intronic
1128376199 15:67077828-67077850 GGGAGTGGCCAGAGAGGAGTTGG + Intronic
1128384132 15:67135102-67135124 TGGAGCCACAGGAGAGAAGATGG + Intronic
1128891665 15:71337339-71337361 GGGAGCCAGGAGTGAAAAGTGGG + Intronic
1134225004 16:12382839-12382861 GAGAGGCACCAGAGAGAAGCAGG - Intronic
1134412163 16:14012093-14012115 GGCAGCCTCCAGAGGAAAGTGGG + Intergenic
1134811824 16:17174088-17174110 GGGAACAACCACAGAGAGGTTGG - Intronic
1135382948 16:22008864-22008886 GGGAGCCACTAGAGAGCTGGTGG + Intronic
1135471972 16:22739314-22739336 GGAAGCCAACAGAAAGAAGCAGG - Intergenic
1135677945 16:24433110-24433132 AGAAGCCACGAGAGAAAAGTGGG + Intergenic
1135895436 16:26396963-26396985 GGAAGCCACCAGCTAGAATTTGG + Intergenic
1136594608 16:31239483-31239505 AGGAGCCAGCAGAGAGGAGTGGG - Intergenic
1137707451 16:50545373-50545395 GGGAGGCACCAGGGTGAAGGTGG + Intergenic
1139402977 16:66696752-66696774 GGGAGCCAGGAGAGGGAAGGAGG + Intergenic
1139848562 16:69937059-69937081 GGGAGCCACCCCTGAGCAGTGGG + Intronic
1141435859 16:83999356-83999378 GGGAGGCTCCAGGGTGAAGTAGG + Intronic
1142774375 17:2124661-2124683 GGGAGTCATTAGAGAGAAGCTGG + Intronic
1142913809 17:3117153-3117175 GAGAGACACCACAGAGAGGTGGG - Intergenic
1142991582 17:3734738-3734760 GGGGGCCACCACAGAAAAGCAGG + Intronic
1143163255 17:4885066-4885088 CTGAGCCACCAGAGAGAAAAAGG - Intronic
1145248142 17:21283392-21283414 GGGAGCCACAGGAGATAAGAGGG - Intergenic
1146788588 17:35738740-35738762 AGGAACCCCCAGAGAGGAGTGGG + Intronic
1148322063 17:46763154-46763176 GGTAGACCCCAGAGAGAAGGGGG + Exonic
1149869922 17:60172036-60172058 GGGAGCCTCCAGAATGGAGTAGG - Intergenic
1150568631 17:66365303-66365325 GGGAGGGAGGAGAGAGAAGTGGG + Intronic
1152201919 17:78952341-78952363 GGAAGCATCCAGAGAGAAGAGGG - Intergenic
1152444072 17:80330472-80330494 GGGAGCCAAGAGGGAGAAGCGGG + Intronic
1152461796 17:80445607-80445629 GGGAGCCATCAGAGGGAGGGGGG + Intergenic
1156528717 18:37794588-37794610 GGGAGCAACCACACAGAATTTGG - Intergenic
1158307056 18:56117391-56117413 GGGAGGCAGCAGAGAGTAGTGGG - Intergenic
1159161982 18:64654428-64654450 AAGAGCAACGAGAGAGAAGTGGG + Intergenic
1159424284 18:68264479-68264501 GGGAGACACAAGAGATAATTTGG - Intergenic
1159449458 18:68581736-68581758 GGTAGCCCACAAAGAGAAGTTGG - Intergenic
1160122225 18:76140798-76140820 GGGAGGGGACAGAGAGAAGTGGG + Intergenic
1160527207 18:79544790-79544812 GGGAGCCTCCGGAGGGAAGGAGG + Intergenic
1160961035 19:1720940-1720962 GGGGGCCTCCAGAAAGAAGGGGG - Intergenic
1163492411 19:17624659-17624681 GGAAGCCACCAGAGGTCAGTGGG - Intronic
1165941126 19:39415269-39415291 GGCAGACACCAGAGGGCAGTGGG + Intronic
1165989722 19:39803265-39803287 ACGAACCACCAGAGAGGAGTTGG + Intergenic
1166521987 19:43486757-43486779 GTGAGACATCAGAGAGAAGGTGG - Intronic
1167349493 19:48965596-48965618 GGGACTCACCAGAGAGAGGTAGG - Exonic
926105092 2:10144993-10145015 GGGAGACACCAAAGAGGAGGTGG + Intronic
926389209 2:12370264-12370286 GAGAGCCAGCAAACAGAAGTAGG + Intergenic
927936280 2:27078572-27078594 GGGAGCCAGCAGGGAGGAGGAGG + Exonic
929317233 2:40494163-40494185 GGGAGTCACCACATGGAAGTGGG - Intronic
929459379 2:42090951-42090973 GGGAGCCTCCAGAGAGAGATGGG + Intergenic
930092298 2:47539968-47539990 GACAGCCACCAGTGAGTAGTGGG - Intronic
930694723 2:54400005-54400027 GGCATCCACCACAGAGAAGAAGG - Intergenic
935213704 2:100959295-100959317 AGGAGCCACAAGAGAGAGCTGGG - Intronic
937551858 2:123103964-123103986 GGGATCCATCAGAAACAAGTTGG + Intergenic
938165118 2:129019355-129019377 GAGAGTCAGCAGAGAGAAGGGGG + Intergenic
939558393 2:143704364-143704386 TGGAGCCCTCAGAGAGAAATGGG + Intronic
941143486 2:161814755-161814777 GGAAACCACCAGAGAGGAGAGGG + Intronic
942546958 2:177075452-177075474 GGCTGACACCAGAGAGAAGTGGG + Intergenic
943650998 2:190457392-190457414 GGGGGCCAACAGGAAGAAGTGGG - Intronic
944091103 2:195912754-195912776 GGGAGAAAACAGAAAGAAGTAGG - Intronic
946018171 2:216620760-216620782 GGGAGCCAGCAGACAGATTTAGG + Intergenic
947809875 2:232997630-232997652 GGCAGGCATCAGAGAGAAGAGGG - Intronic
947935082 2:233997648-233997670 GGGAGCCACCAGAGAAATCATGG - Intronic
948657499 2:239485769-239485791 GGAAGACACCAGAGAGAAGCTGG + Intergenic
948676596 2:239600664-239600686 GGGAGGCTCCAGAGGGAGGTTGG + Intergenic
948791399 2:240379222-240379244 GGGGGCCACGTGAGAGAAGGTGG - Intergenic
948823934 2:240565411-240565433 CTGCACCACCAGAGAGAAGTAGG + Intronic
1171483133 20:25468648-25468670 GGCACCCACCAGTGAGAATTGGG - Intronic
1172146315 20:32760862-32760884 GGGAGATACCAGAGAGAAATGGG - Intergenic
1173011998 20:39191192-39191214 GGGAGCCACCAGAGAGCTGATGG - Intergenic
1173018565 20:39248288-39248310 GGGGGCCACCAAAGAGGAGGTGG + Intergenic
1173448574 20:43142284-43142306 GTGAGCCAGCACACAGAAGTGGG + Intronic
1175807494 20:61837966-61837988 GGGAGCGATCAGAGAGAATGTGG - Intronic
1176146918 20:63569600-63569622 GGGAGCCACCAGAGAGAAGTCGG + Exonic
1177077563 21:16596310-16596332 CAGAGCCAGCAGAGAGAACTTGG - Intergenic
1178758197 21:35373364-35373386 GGGAGCCACAACAGAGGTGTAGG + Intronic
1179045892 21:37844746-37844768 GGGAGCCAGCAGAGACTGGTTGG - Intronic
1179887035 21:44318659-44318681 TGGGGCCCCCAGAGAGCAGTGGG - Intronic
1181588357 22:23866984-23867006 AGGAGGCAGGAGAGAGAAGTAGG - Intronic
1181876013 22:25941423-25941445 AAGAGCCATCAGAGAGCAGTGGG - Intronic
1182119222 22:27775999-27776021 GGGAGCCACAAGGAAGCAGTGGG + Intronic
1182333964 22:29570781-29570803 GGGAGGCTAGAGAGAGAAGTGGG - Intronic
1183334368 22:37238176-37238198 GGGAGCCACAGGAGAGATTTAGG + Intronic
1184406407 22:44303219-44303241 GGGTGCCACCAGGGAGAGGATGG - Intronic
949808287 3:7978601-7978623 GGGCGGCACCACAGAGAAGGAGG - Intergenic
949889831 3:8725498-8725520 GGGAGACAACAAGGAGAAGTGGG - Intronic
949897861 3:8783264-8783286 GGGAGACAATAGAGAGAGGTTGG + Intronic
950371947 3:12538353-12538375 AGGAGGCACAGGAGAGAAGTTGG + Intronic
952752299 3:36834700-36834722 GGCTGCCCCCAGAGAGAAGTGGG + Intronic
953197982 3:40751982-40752004 GGGAGAGATCAGAGGGAAGTGGG + Intergenic
954081821 3:48216706-48216728 GGGAGACAACAGTGAGAAGTGGG - Intergenic
954130862 3:48560262-48560284 GGGAGGCAGCAGAGAGCAGCAGG - Intronic
955251811 3:57290373-57290395 GGGAGCCAGGAGAGACAACTTGG - Intronic
956442588 3:69294849-69294871 GGGAGGCAGCGGAGAAAAGTGGG + Intronic
956712639 3:72051760-72051782 TGGAGCCACCAGAGGGATGATGG - Intergenic
960202264 3:114851041-114851063 GGGAGCCACCTAAGAGAGTTTGG - Intronic
960399404 3:117177787-117177809 GGGAGACTACATAGAGAAGTGGG + Intergenic
960596721 3:119414125-119414147 AGCAGCCAGCAGAGAGAAGCCGG + Exonic
960858327 3:122125829-122125851 GGGAGCCAAGTGAGAGAAGAGGG + Intergenic
961096119 3:124158299-124158321 GGGAGCTTCCTGGGAGAAGTGGG - Intronic
963766240 3:149338944-149338966 GGGGACCACCAGAGTGAAGAAGG - Intergenic
964193862 3:154038856-154038878 AGGAGACACCACAGAGAAGTAGG + Intergenic
968901183 4:3432694-3432716 GGCAGCCACCAGAGCGCAGGGGG - Intronic
970252575 4:14131499-14131521 GGGAACCAACAGGGAGATGTTGG - Intergenic
970411879 4:15816834-15816856 GGGAGCTAAGAGAGAGAAATAGG + Intronic
971430872 4:26565876-26565898 GAGAGCCAAGAGAGAGAAGCAGG - Intergenic
973337173 4:48968331-48968353 GGGCCCCACCAGAGAGAATCTGG - Intergenic
974078073 4:57185669-57185691 GGAAACCCCCAGAGAGAAGGAGG - Intergenic
976542729 4:86296497-86296519 TGGAACCAGCAGATAGAAGTAGG + Intronic
978573949 4:110169686-110169708 GGGAGAATCCAGAGAGAACTGGG - Intronic
979008698 4:115338580-115338602 GGGAATGATCAGAGAGAAGTTGG - Intergenic
980837753 4:138217744-138217766 GGGAGACACCAGAGCAAAGCGGG - Intronic
982235392 4:153247319-153247341 GGGAGACACCAGTGCTAAGTGGG + Intronic
984373319 4:178894581-178894603 AGGAGCCACGGGAGAGAACTGGG - Intergenic
985299217 4:188469838-188469860 AAGTGCTACCAGAGAGAAGTAGG + Intergenic
986408444 5:7450452-7450474 GGAAGCTACCAAAGAAAAGTGGG + Intronic
986711145 5:10488668-10488690 GGGTGCCACCAAGGAGAAGGGGG - Intergenic
989607231 5:43256126-43256148 AGGAGCCATCAGAGGGAACTGGG + Intronic
994207397 5:97050709-97050731 GGGGGCCTCCAGTCAGAAGTGGG + Intergenic
994571309 5:101517413-101517435 TGTAGCCACCAAAGAGGAGTGGG + Intergenic
995511885 5:112918750-112918772 GGGAGGCACCAGAGAGGTGCAGG - Intronic
996163074 5:120191245-120191267 GGAAGCCAAAAGAGAGAAGGAGG + Intergenic
996789567 5:127278186-127278208 AGGAGCCACCAGAGAGAAAAAGG + Intergenic
998874931 5:146589649-146589671 TGGACCCACCAGAGAAAACTGGG + Exonic
999198880 5:149802143-149802165 TGGAGCAACCAGACAGAAGCTGG - Intronic
999213134 5:149907458-149907480 GAGAGCCACCTGAGAGCAGGGGG - Intronic
999250409 5:150179261-150179283 CAGCTCCACCAGAGAGAAGTTGG + Intronic
999605520 5:153310198-153310220 GGGTGCCACCAATGGGAAGTGGG - Intergenic
999751123 5:154628888-154628910 GGGAGCCTTCAGGCAGAAGTGGG - Intergenic
1000107203 5:158071341-158071363 GGGAGGCTCCAGAGCAAAGTTGG + Intergenic
1002948075 6:1781552-1781574 GGGAGACAGCAGAGGGGAGTAGG - Intronic
1004678741 6:17871270-17871292 GGAAGGCACCAGAGAGCAGATGG - Intronic
1004755234 6:18603261-18603283 GGTAGCCATCAGAGAGATTTGGG + Intergenic
1004803890 6:19181023-19181045 GAGTGCCTCCAGAGACAAGTCGG + Intergenic
1006063366 6:31442238-31442260 GGGAGGCTCCAGAGAGCAGAAGG + Intergenic
1006066100 6:31463634-31463656 GGGAACAGCCTGAGAGAAGTAGG + Intergenic
1006745680 6:36340456-36340478 GGTAGCCAACGGAGAGGAGTGGG + Intergenic
1007609320 6:43139074-43139096 GGCAGCCTCCAGGGAGAGGTGGG + Intronic
1007941865 6:45789103-45789125 GGGAGACAACAGGGAGAAGGAGG + Intergenic
1008424101 6:51336657-51336679 GGGAGACACAAGAGTGAAGTAGG + Intergenic
1008954860 6:57203528-57203550 TGGAAACACCAGAAAGAAGTAGG - Intronic
1009506213 6:64483555-64483577 GGGGGTCACCAGAGAGAAGGAGG - Intronic
1009821891 6:68813194-68813216 GGCAGCCACAAGAGAGAATGAGG - Intronic
1012110723 6:95228870-95228892 GGGAGAAAGGAGAGAGAAGTGGG - Intergenic
1013456487 6:110334194-110334216 GAGAGCCACCAAAGAGACCTCGG - Intronic
1015340855 6:132098842-132098864 GGGAGCCACCAGAGATTAGTAGG + Intergenic
1015592868 6:134839173-134839195 GAGAGCCACAAGAGAGGAGGGGG + Intergenic
1015911094 6:138168407-138168429 TGGAGCGACGGGAGAGAAGTAGG + Intronic
1018156299 6:160988491-160988513 AGGAGCCACCAGAGAGCAGAGGG + Intergenic
1019091587 6:169539742-169539764 GGGAGCCAGCAGACACAAGCTGG - Intronic
1019347695 7:538811-538833 AGGAGCCACCGGAGTGAAGGAGG - Intergenic
1019954106 7:4399413-4399435 GGGAGTCAGCTGAGAGAAATGGG + Intergenic
1022892886 7:34719075-34719097 GGCAGGCAGCTGAGAGAAGTGGG + Intronic
1023083115 7:36544364-36544386 GGCAGACACCAGAGAGACCTAGG - Intronic
1023821237 7:43981752-43981774 TGAAGCCACCAGAGGGAACTGGG - Intergenic
1027174276 7:75893383-75893405 GGAAGCCAGCAAAGAGAAGGAGG + Intergenic
1028912268 7:96221985-96222007 GAGAGACACAAGAGAAAAGTTGG + Intronic
1029532365 7:101133923-101133945 GGGAGCCAGGAGAGAGGGGTTGG - Intronic
1029598019 7:101548019-101548041 GGGAGCTACAAGGGAGAAGCTGG + Intronic
1029749507 7:102535176-102535198 TGAAGCCACCAGAGGGAACTGGG - Intergenic
1029767454 7:102634279-102634301 TGAAGCCACCAGAGGGAACTGGG - Intronic
1030065384 7:105655390-105655412 GGGAGCCATCAAAGAGTTGTGGG + Intronic
1030638275 7:111974644-111974666 GGGAGAGACCAGGGGGAAGTAGG + Intronic
1030667340 7:112293899-112293921 GGGAACCTCCAGAGGGAACTTGG + Intronic
1030830936 7:114220586-114220608 GGCAGTCACCAAAGGGAAGTAGG - Intronic
1030998293 7:116385103-116385125 GGGAGCCACCAAAAAGTAGGTGG - Intronic
1032432288 7:131871818-131871840 GGAAGACACCAGAGGGAAGCAGG + Intergenic
1032557780 7:132855736-132855758 AGGAGCCACCAAATAGAAGCTGG - Intronic
1035177151 7:157059636-157059658 AGGAGCCACCAGAGAGAAAGGGG - Intergenic
1037355993 8:18019994-18020016 GGAAGCCAGCAGAGAAATGTGGG - Intronic
1039780432 8:40779750-40779772 GGCAGCCACCAGGGAGAGATGGG - Intronic
1040391890 8:46957122-46957144 TGCAGCCACCAGAGGGCAGTGGG - Intergenic
1042468343 8:69154146-69154168 GGCAGGCACCAGAGAATAGTGGG - Intergenic
1042562750 8:70085373-70085395 GAAAGCCACTAGAGAGCAGTGGG + Intergenic
1044927814 8:97224195-97224217 GGGTGCCACCACAGGGGAGTAGG - Intergenic
1046497804 8:115036970-115036992 GGGAGCCACCTGGGAGAGGGGGG - Intergenic
1047319258 8:123764225-123764247 GGGAGGCAGTAGGGAGAAGTGGG + Intergenic
1047327977 8:123858098-123858120 GGGAGTCGCCAGAGAAGAGTGGG - Intronic
1048180411 8:132189257-132189279 GGGAGCCTGCAGAGAGCAGCTGG - Intronic
1048634374 8:136279974-136279996 GGAGGCCACCAGATAGGAGTTGG + Intergenic
1050526621 9:6552060-6552082 GGAAGCCACGAGAGATACGTGGG + Intronic
1051827328 9:21234485-21234507 GGGCTCCACCACAGAGAAGCAGG - Intronic
1052830531 9:33211870-33211892 GTGAGTCACCAGAGAGGAGCAGG + Intergenic
1053016941 9:34667233-34667255 GGGAGTGACCAGAAATAAGTGGG + Intergenic
1056103441 9:83322826-83322848 GGGATTCACCAGAGAGGAGATGG - Intronic
1056609373 9:88114754-88114776 GGAAGCCACCAGAAGGAAGAAGG - Intergenic
1057890605 9:98867229-98867251 GGAAGCCTCCAGAGAGGAGAGGG + Intergenic
1061093500 9:128440490-128440512 TGGAGCCCCCAGAGAGATGGAGG + Intergenic
1061216589 9:129225239-129225261 GGGAGCCCTGAGAGAGAAGATGG - Intergenic
1062239182 9:135526648-135526670 GGCACCCACCAGGGAGAACTGGG - Intergenic
1062595869 9:137298952-137298974 AGCAGCCAGCAGAGAGAACTTGG - Intergenic
1186342625 X:8660103-8660125 GGGAGCCAGCATAGAGGAGAAGG + Intronic
1187489308 X:19736222-19736244 GGGAGGCAATAGAGTGAAGTGGG - Intronic
1189133901 X:38529429-38529451 GAGAGCCAGGAAAGAGAAGTTGG - Intronic
1189240444 X:39520484-39520506 GGCAGCCACCAGTGGGAGGTGGG - Intergenic
1192125701 X:68499038-68499060 GGGAGCGACCCGGGAGAAGGAGG + Exonic
1193312241 X:80022984-80023006 GATAGGCACCAGCGAGAAGTGGG + Intronic
1195278248 X:103303775-103303797 GAGAGCCATCAGAGAGAACATGG + Intergenic
1195590129 X:106615079-106615101 GGGAGCCACCTGAGAGATTTAGG - Intronic
1196764187 X:119227978-119228000 GGGATACAGCAGGGAGAAGTGGG + Intergenic
1198536164 X:137589081-137589103 TGAACCCACCAGAGAGAAGGGGG - Intergenic
1198813218 X:140557903-140557925 GGTGGCCACCAGCCAGAAGTGGG + Intergenic
1199723796 X:150562918-150562940 GGCAGCTCCCAGAGAGAAGCTGG + Intergenic
1200101394 X:153690538-153690560 GGGAGCCAGCTGGGAGAAGGGGG - Intronic
1200411742 Y:2868205-2868227 GGGAGCCAGGAGAGGGCAGTGGG + Intronic