ID: 1176148199

View in Genome Browser
Species Human (GRCh38)
Location 20:63574633-63574655
Sequence TTGGGGTCCCAGCAGCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176148199_1176148214 30 Left 1176148199 20:63574633-63574655 CCCTGGTGCTGCTGGGACCCCAA No data
Right 1176148214 20:63574686-63574708 GGAATGGCTAAGTGGCCGCCGGG No data
1176148199_1176148207 5 Left 1176148199 20:63574633-63574655 CCCTGGTGCTGCTGGGACCCCAA No data
Right 1176148207 20:63574661-63574683 TTCTGTCACCAACCAGGATATGG No data
1176148199_1176148208 9 Left 1176148199 20:63574633-63574655 CCCTGGTGCTGCTGGGACCCCAA No data
Right 1176148208 20:63574665-63574687 GTCACCAACCAGGATATGGCAGG No data
1176148199_1176148213 29 Left 1176148199 20:63574633-63574655 CCCTGGTGCTGCTGGGACCCCAA No data
Right 1176148213 20:63574685-63574707 AGGAATGGCTAAGTGGCCGCCGG No data
1176148199_1176148204 -1 Left 1176148199 20:63574633-63574655 CCCTGGTGCTGCTGGGACCCCAA No data
Right 1176148204 20:63574655-63574677 AGTCCCTTCTGTCACCAACCAGG No data
1176148199_1176148212 22 Left 1176148199 20:63574633-63574655 CCCTGGTGCTGCTGGGACCCCAA No data
Right 1176148212 20:63574678-63574700 ATATGGCAGGAATGGCTAAGTGG No data
1176148199_1176148210 14 Left 1176148199 20:63574633-63574655 CCCTGGTGCTGCTGGGACCCCAA No data
Right 1176148210 20:63574670-63574692 CAACCAGGATATGGCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176148199 Original CRISPR TTGGGGTCCCAGCAGCACCA GGG (reversed) Intergenic
No off target data available for this crispr