ID: 1176148925

View in Genome Browser
Species Human (GRCh38)
Location 20:63579059-63579081
Sequence TCATCTCGAAGGAGGCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176148925_1176148933 0 Left 1176148925 20:63579059-63579081 CCGGGAGGCCTCCTTCGAGATGA No data
Right 1176148933 20:63579082-63579104 GCCCCTGGGGAGAAAGTCAGGGG No data
1176148925_1176148932 -1 Left 1176148925 20:63579059-63579081 CCGGGAGGCCTCCTTCGAGATGA No data
Right 1176148932 20:63579081-63579103 AGCCCCTGGGGAGAAAGTCAGGG No data
1176148925_1176148939 23 Left 1176148925 20:63579059-63579081 CCGGGAGGCCTCCTTCGAGATGA No data
Right 1176148939 20:63579105-63579127 GACCACACCTTCTCCTTGCAGGG No data
1176148925_1176148940 24 Left 1176148925 20:63579059-63579081 CCGGGAGGCCTCCTTCGAGATGA No data
Right 1176148940 20:63579106-63579128 ACCACACCTTCTCCTTGCAGGGG No data
1176148925_1176148935 1 Left 1176148925 20:63579059-63579081 CCGGGAGGCCTCCTTCGAGATGA No data
Right 1176148935 20:63579083-63579105 CCCCTGGGGAGAAAGTCAGGGGG No data
1176148925_1176148931 -2 Left 1176148925 20:63579059-63579081 CCGGGAGGCCTCCTTCGAGATGA No data
Right 1176148931 20:63579080-63579102 GAGCCCCTGGGGAGAAAGTCAGG No data
1176148925_1176148938 22 Left 1176148925 20:63579059-63579081 CCGGGAGGCCTCCTTCGAGATGA No data
Right 1176148938 20:63579104-63579126 GGACCACACCTTCTCCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176148925 Original CRISPR TCATCTCGAAGGAGGCCTCC CGG (reversed) Intergenic