ID: 1176151231

View in Genome Browser
Species Human (GRCh38)
Location 20:63592056-63592078
Sequence GTCCATCTGGCACTTGTGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176151224_1176151231 2 Left 1176151224 20:63592031-63592053 CCCGGGCGTACTGCTCCCGCGAG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1176151231 20:63592056-63592078 GTCCATCTGGCACTTGTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 92
1176151222_1176151231 12 Left 1176151222 20:63592021-63592043 CCTGCCAGGTCCCGGGCGTACTG 0: 1
1: 0
2: 0
3: 13
4: 65
Right 1176151231 20:63592056-63592078 GTCCATCTGGCACTTGTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 92
1176151223_1176151231 8 Left 1176151223 20:63592025-63592047 CCAGGTCCCGGGCGTACTGCTCC 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1176151231 20:63592056-63592078 GTCCATCTGGCACTTGTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 92
1176151225_1176151231 1 Left 1176151225 20:63592032-63592054 CCGGGCGTACTGCTCCCGCGAGC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1176151231 20:63592056-63592078 GTCCATCTGGCACTTGTGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176151231 Original CRISPR GTCCATCTGGCACTTGTGGC TGG Exonic
902558411 1:17260675-17260697 ATCCATGAGGCACTTGGGGCAGG + Intronic
905793283 1:40801637-40801659 TACCATCTGGCACCTGTGCCTGG + Intronic
907239576 1:53074147-53074169 CTCCATCTGGCAGATGTGTCAGG - Intronic
908201411 1:61799488-61799510 GTCAATATGGCATTTGTGCCAGG - Intronic
917058213 1:171007198-171007220 GTGCTTCTGGGACTTGTGGTTGG + Intronic
918319186 1:183348728-183348750 TTCCATCTGGAATGTGTGGCAGG - Intronic
918649801 1:186947761-186947783 GTCCATCAGGCACTTCTCCCAGG - Intronic
919286830 1:195574077-195574099 GTAATTCTGGCACTTGTGGGAGG - Intergenic
919358050 1:196551613-196551635 GTGCATCTGGCACTTGCAGTGGG + Intronic
920191815 1:204198627-204198649 GTCCAGCTGGCGGTTGTGGTGGG + Intronic
920543279 1:206795124-206795146 CTCCAGCTGGCCCTTGTGTCTGG - Intergenic
1062811832 10:472388-472410 GTCCATCTGCCACCTGTGCCAGG - Intronic
1065136072 10:22671536-22671558 CTCCATGTGGCCCATGTGGCAGG - Intronic
1065167362 10:22993779-22993801 ATCCCTCTGGCACTTGTGGCTGG - Intronic
1067663253 10:48252187-48252209 GTCGCTCTGGCACTTCAGGCAGG - Intronic
1067725899 10:48770784-48770806 GTCCATCTGCCAGTTCAGGCTGG + Intronic
1070382387 10:75892678-75892700 CTGCCTCTGGCACCTGTGGCTGG + Intronic
1072925676 10:99614402-99614424 GACTATCTGGCAATGGTGGCTGG + Intronic
1075389887 10:122084507-122084529 CTCCATCTGGCACAGGGGGCAGG - Exonic
1076105891 10:127823391-127823413 GTCCTTCTGGGATCTGTGGCTGG + Intergenic
1076176603 10:128373017-128373039 GTCCTTGTGGCAGTTGTGCCTGG - Intergenic
1083683961 11:64365179-64365201 GCCCATCTGGCATTTGGGGTGGG - Intronic
1085699115 11:78730492-78730514 GTCCATCTGGCACTGGAGCTGGG - Intronic
1089352219 11:117828244-117828266 CTCCACCTGGCACTTGAGGATGG + Intronic
1093031111 12:14289346-14289368 GGACCTCTGGCATTTGTGGCTGG - Intergenic
1095980263 12:47969042-47969064 TTCCATCTGCCTCTTGCGGCAGG + Intergenic
1103918673 12:124388599-124388621 GGCCATCTGGGATTTGAGGCTGG - Intronic
1104566557 12:129890230-129890252 ATCCATCTGGAACTTGGCGCAGG + Intronic
1105038803 12:132946037-132946059 TTCCATCTGGCATTTATGGGTGG - Intronic
1118430117 14:65709752-65709774 ATCCAACTGGCACGTTTGGCAGG + Intronic
1119948961 14:78724886-78724908 GTACATCTGGAACTTGAGGCTGG + Intronic
1121626695 14:95390306-95390328 GTACAACTGGCACTTGGGGCTGG + Intergenic
1122166557 14:99829204-99829226 GTCCAGGTGACACTGGTGGCTGG - Intronic
1122927160 14:104909793-104909815 GTCCATCTGTCATTTTTTGCTGG - Intergenic
1123087561 14:105723838-105723860 GTCCATTTGGTGCCTGTGGCTGG + Intergenic
1123718803 15:23046641-23046663 GTCCTCCTGGCACCTCTGGCCGG - Intergenic
1125818562 15:42607903-42607925 GTCAATCAGGAACTTGAGGCTGG - Intronic
1127993317 15:64136579-64136601 GGCAATCTTACACTTGTGGCTGG + Intronic
1128058810 15:64720404-64720426 GTTCATCTGGCACATGCTGCAGG - Intergenic
1138248357 16:55483693-55483715 TTCCATCTGTCACTTCTGGCTGG - Intronic
1138503145 16:57461145-57461167 GTCCAGCAGGCACTTGTCTCAGG - Exonic
1139594402 16:67949692-67949714 GTCCAGCTGGGAGATGTGGCAGG - Intronic
1144684809 17:17219018-17219040 GTCCCTCCGGCACATGAGGCAGG - Exonic
1151868486 17:76820675-76820697 GTCCATCTGGCACCTGCCCCAGG + Intergenic
1152056157 17:78028527-78028549 GTCTATCTGTCACTAGTGCCTGG - Intronic
1152925277 17:83084791-83084813 GTCCGTGTGGCACCTGTGGCCGG + Intronic
1153917012 18:9754919-9754941 GTCTCTCTGGCACTTGTCACAGG + Intronic
1155428059 18:25726568-25726590 GTCCCTCTGTCACTACTGGCCGG - Intergenic
1156305283 18:35873423-35873445 GTCCATCAGGCATTTCTTGCAGG - Intergenic
1165485436 19:36092695-36092717 GTTCATCTGGCACCTGGGCCCGG + Exonic
926229301 2:10990667-10990689 GTCCCTCTCGCACACGTGGCTGG - Intergenic
931766871 2:65464677-65464699 GGCCCTCTGACACTTGTGGCTGG + Intergenic
935116608 2:100142698-100142720 GGCCAACTCTCACTTGTGGCAGG + Intronic
936106883 2:109632344-109632366 GACCCTCTGAGACTTGTGGCTGG + Intergenic
937043622 2:118839031-118839053 ACCCATCTGTCACCTGTGGCAGG - Intergenic
946353774 2:219172328-219172350 GTCCATCTGGGACATGTCCCTGG + Exonic
948737020 2:240015804-240015826 GGCCATCTGTCACTTCTGGAAGG - Intronic
1168835171 20:873041-873063 GTCCATCTTGTACTTGTTGTCGG + Exonic
1173170787 20:40721911-40721933 GTCTGTCTGGCACATGTGGGGGG + Intergenic
1175176770 20:57117318-57117340 GTACATCTGGCATTGCTGGCAGG - Intergenic
1176151231 20:63592056-63592078 GTCCATCTGGCACTTGTGGCTGG + Exonic
950537097 3:13584999-13585021 GCCCACCTGGCAGTTGGGGCTGG + Intronic
952574549 3:34759143-34759165 GTCTTGCTGGCACTGGTGGCAGG - Intergenic
953709955 3:45261467-45261489 GGCCATCAGGAGCTTGTGGCAGG + Intergenic
954153987 3:48674604-48674626 GTCCATCTGGCACTGGGGTGAGG + Exonic
956157937 3:66317948-66317970 GTCTTGCTGGCACTGGTGGCAGG + Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
960009999 3:112823386-112823408 GGCAATCTGGGACTTGTGACTGG + Intronic
962635393 3:137326088-137326110 GTCCATCCAGCATTTGTGCCTGG + Intergenic
963681251 3:148380344-148380366 GTCAATCTGGCAGTTTTGTCTGG - Intergenic
963837760 3:150074215-150074237 ATCCCTCTGGCATCTGTGGCAGG + Intergenic
983472532 4:168174381-168174403 CTCCATGTGGGGCTTGTGGCTGG - Intronic
986721386 5:10563708-10563730 GTCCACCTGGGACCTGTGCCCGG - Intergenic
990348798 5:54895192-54895214 GTCCATATAGACCTTGTGGCTGG - Intergenic
991729171 5:69566785-69566807 GTCAAAATGGCACTTGAGGCTGG + Intronic
991805603 5:70421931-70421953 GTCAAAATGGCACTTGAGGCTGG + Intergenic
991865782 5:71061090-71061112 GTCAAAATGGCACTTGAGGCTGG - Intronic
992295507 5:75322909-75322931 GACAATCTGGAATTTGTGGCTGG - Intergenic
996508835 5:124296704-124296726 GTCCATCAGCCACTTGTGCCTGG + Intergenic
997748909 5:136325926-136325948 TTCCATCTGACACTGGTGGAAGG - Intronic
998204770 5:140150492-140150514 GGCCATCTGGCACTCTGGGCAGG + Intergenic
1006168342 6:32079091-32079113 GTGCATCTTGTACTTGTGCCCGG + Intronic
1022487937 7:30794734-30794756 GGCCACCTGTCACTTGTCGCTGG + Intronic
1023159835 7:37286317-37286339 GCCCATCTGACACTAGTGTCTGG - Intronic
1024551388 7:50565443-50565465 GTTTAACTGGCACATGTGGCTGG - Exonic
1032263731 7:130356153-130356175 GTCCATTTTGCATCTGTGGCTGG + Intronic
1038417337 8:27406728-27406750 GTACCACTGGCACTTGGGGCAGG - Intronic
1045237764 8:100370455-100370477 GTCCATTTGGCTCTTGTTCCAGG + Intronic
1046845403 8:118909548-118909570 GACCTTCTGAAACTTGTGGCTGG + Intergenic
1048254648 8:132896532-132896554 CTCCTGCTGGCACTTGGGGCAGG - Intronic
1056383578 9:86077442-86077464 CTCCAGCTGGAAGTTGTGGCTGG + Exonic
1059789537 9:117625415-117625437 GTCAATCTGGCACCTGTCACTGG + Intergenic
1062490973 9:136804751-136804773 GTCCATCTGGCCCTGATGGGAGG - Exonic
1062638081 9:137501864-137501886 GTCCATCAGGCCCTTGTTGGAGG - Intronic
1192944401 X:75949824-75949846 GTCTTGCTGGCACTAGTGGCAGG + Intergenic
1194106292 X:89771369-89771391 GACCATCTGAGACTTGTAGCAGG + Intergenic
1195877508 X:109557553-109557575 GTACATCTGACACTTGTGAAAGG - Intergenic
1196795311 X:119497507-119497529 GGCCATCTGGCAAATGTGGATGG + Intergenic
1200458253 Y:3419228-3419250 GACCATCTGAGACTTGTAGCAGG + Intergenic
1201859569 Y:18581815-18581837 TTCCATTTGACACCTGTGGCTGG - Intronic
1201873752 Y:18738566-18738588 TTCCATTTGACACCTGTGGCTGG + Intronic