ID: 1176154645

View in Genome Browser
Species Human (GRCh38)
Location 20:63612462-63612484
Sequence CCTTCCCAGCTCACCCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 1, 2: 4, 3: 28, 4: 284}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176154645_1176154655 7 Left 1176154645 20:63612462-63612484 CCACAAGGGGTGAGCTGGGAAGG 0: 1
1: 1
2: 4
3: 28
4: 284
Right 1176154655 20:63612492-63612514 AAAGGCGGGAGGCGGACGAATGG 0: 1
1: 0
2: 0
3: 17
4: 156
1176154645_1176154652 -1 Left 1176154645 20:63612462-63612484 CCACAAGGGGTGAGCTGGGAAGG 0: 1
1: 1
2: 4
3: 28
4: 284
Right 1176154652 20:63612484-63612506 GCCCAGGAAAAGGCGGGAGGCGG 0: 1
1: 0
2: 5
3: 39
4: 426
1176154645_1176154651 -4 Left 1176154645 20:63612462-63612484 CCACAAGGGGTGAGCTGGGAAGG 0: 1
1: 1
2: 4
3: 28
4: 284
Right 1176154651 20:63612481-63612503 AAGGCCCAGGAAAAGGCGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 294
1176154645_1176154649 -8 Left 1176154645 20:63612462-63612484 CCACAAGGGGTGAGCTGGGAAGG 0: 1
1: 1
2: 4
3: 28
4: 284
Right 1176154649 20:63612477-63612499 TGGGAAGGCCCAGGAAAAGGCGG 0: 1
1: 0
2: 4
3: 61
4: 553
1176154645_1176154650 -7 Left 1176154645 20:63612462-63612484 CCACAAGGGGTGAGCTGGGAAGG 0: 1
1: 1
2: 4
3: 28
4: 284
Right 1176154650 20:63612478-63612500 GGGAAGGCCCAGGAAAAGGCGGG 0: 1
1: 0
2: 7
3: 55
4: 616
1176154645_1176154656 23 Left 1176154645 20:63612462-63612484 CCACAAGGGGTGAGCTGGGAAGG 0: 1
1: 1
2: 4
3: 28
4: 284
Right 1176154656 20:63612508-63612530 CGAATGGAAATGTCATTCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176154645 Original CRISPR CCTTCCCAGCTCACCCCTTG TGG (reversed) Intronic
901909597 1:12445519-12445541 CTTTCCCAGGTCACCCTTTGTGG + Intronic
903006711 1:20303504-20303526 CCTTCCCAGCTCAGACCTGGAGG + Intronic
903183297 1:21615916-21615938 ACTTCCCAGCTGAGCCCTAGAGG - Intronic
904168566 1:28574913-28574935 CCTTCCCAGCCCACCCCACAAGG - Intronic
904198272 1:28802215-28802237 CCTCCCCTGCTCACCTCCTGAGG - Intergenic
904370383 1:30044286-30044308 CCTGCACAGACCACCCCTTGGGG + Intergenic
905313893 1:37068931-37068953 TCTACCCAGCTCAGCCCTCGGGG + Intergenic
905772212 1:40645711-40645733 CCTTCCCTTTTCACCCCCTGGGG - Intronic
906501222 1:46342822-46342844 ACTCCCCAGCACACCCCTTCTGG + Intronic
906611907 1:47209438-47209460 TCTTCCCAGCTAACCCTCTGCGG - Intergenic
906764026 1:48409893-48409915 CCTTCCCATCACAGGCCTTGAGG - Intronic
907451359 1:54547820-54547842 CCTTCCAGCCTGACCCCTTGTGG + Intronic
907476405 1:54708836-54708858 CCTTCCCAGGACCCCTCTTGGGG + Intronic
911992465 1:104718647-104718669 ACTTCCCAACTGACTCCTTGAGG + Intergenic
912496416 1:110094872-110094894 CATGCCCAACTCACCCCATGTGG + Intergenic
912629770 1:111236527-111236549 CCTACCCAGCTGACCTCATGGGG - Intronic
914742890 1:150480070-150480092 CCTTCCCAGAACATCTCTTGGGG - Intergenic
915303934 1:154967262-154967284 CTTTCCCACCTCAGGCCTTGAGG - Intronic
915442116 1:155951727-155951749 AATTCCCATCTCACCTCTTGCGG + Exonic
917334980 1:173917039-173917061 CCCTCCCACCCCACCTCTTGGGG - Intronic
917952161 1:180050188-180050210 CTTTCACAGATCACACCTTGAGG - Intronic
922748143 1:228058766-228058788 CCTTCCCAGGTCAGGGCTTGGGG - Intronic
923001187 1:230007535-230007557 AATTCCCAGCTCTCCCCTTCCGG - Intergenic
923156323 1:231282354-231282376 CCTGCCCAGCTCACCCCACCAGG - Intergenic
1064925308 10:20563023-20563045 CCTTCTCAGCTCACCCCTCCTGG + Intergenic
1067095292 10:43295555-43295577 CCTTCCCTGCTCTCCTCTTGAGG - Intergenic
1069843240 10:71353123-71353145 CCTTCTCAGCGCAGCACTTGAGG + Intronic
1071438134 10:85665964-85665986 CTTGCACAGCTCACCCCTGGAGG + Intronic
1074116680 10:110461492-110461514 CCTTCCCAGGTAGCCCCCTGTGG + Intergenic
1074141561 10:110677908-110677930 CCTTCACAGCTTAACCCTCGGGG + Intronic
1074862666 10:117524100-117524122 CCTGGCCTGCTCACCACTTGTGG - Intergenic
1075404156 10:122183465-122183487 CCTTCCCATGTCACTCCCTGCGG + Intronic
1075733031 10:124647671-124647693 CCTTTCCATGTCACCCCATGGGG + Intronic
1075915150 10:126160527-126160549 CCTTCCCAGCTCTCCCTTCCAGG + Intronic
1075957287 10:126534937-126534959 ACTTCCCACCTCACTCCTTCAGG + Intronic
1076223195 10:128751411-128751433 TCTGCATAGCTCACCCCTTGCGG - Intergenic
1076326840 10:129630361-129630383 TCTTCCCATCTCACGCCGTGAGG + Intronic
1077197395 11:1288287-1288309 CCTTCCAAGCTCTGCCCTTAGGG - Intronic
1077378657 11:2217618-2217640 CCTTCCCAAGGCACCTCTTGGGG + Intergenic
1083678610 11:64341233-64341255 CCGCCCCAGTTAACCCCTTGTGG + Intronic
1084725627 11:70939958-70939980 CCACCCCAGCTCAACCCCTGTGG - Intronic
1086164741 11:83764451-83764473 CCTTCCCTGCACACCCCTTTGGG - Intronic
1086690129 11:89780398-89780420 TCTGCCCATCACACCCCTTGAGG - Intergenic
1086698533 11:89872574-89872596 TCTGCCCATCACACCCCTTGAGG + Intronic
1086707633 11:89971922-89971944 TCTGCCCATCACACCCCTTGAGG - Intronic
1086715725 11:90059559-90059581 TCTGCCCATCACACCCCTTGAGG + Intergenic
1087334302 11:96824012-96824034 TCTTCCCACCTCAGCCTTTGGGG - Intergenic
1088908961 11:114176216-114176238 TCCTCCCAGGTCTCCCCTTGGGG - Intronic
1089326373 11:117660261-117660283 CCTTCCCAGTTCCTCCCTTTTGG + Intronic
1090005918 11:123002231-123002253 CCTTCCCAACTCACCTCCTGTGG - Intergenic
1090466782 11:126942104-126942126 CCTTCCCAGCTCAAGTCTTCTGG + Intronic
1092060663 12:5547838-5547860 CCATCCCAGCTCCTCCCTGGAGG - Intronic
1092933062 12:13335603-13335625 TCTTCTCTGCTCACCACTTGTGG - Intergenic
1093745141 12:22731671-22731693 CATTCCAAGCCCTCCCCTTGAGG - Intergenic
1094829610 12:34294072-34294094 CCTTCCCAGCTGCCCCTGTGTGG - Intergenic
1094837477 12:34328919-34328941 CCTTCCCAGCAGCCCCTTTGTGG - Intergenic
1096293840 12:50366375-50366397 ACTTCCCAACTCATCCTTTGAGG + Intronic
1096872472 12:54602093-54602115 CCTTCCCACCTCTTCCCTGGGGG + Intergenic
1097337507 12:58399458-58399480 CCTTCCCAACTCATTCTTTGAGG - Intergenic
1099497882 12:83375224-83375246 CCTCCCCAGCTCATTCCATGAGG - Intergenic
1103499234 12:121388068-121388090 CATTCCCTGCTCACCCCTCCAGG - Intronic
1106581872 13:31025905-31025927 CCCTCCCAGCTCTCCCCATTTGG - Intergenic
1108228747 13:48317276-48317298 CCTGCCCAGCCTACCCCTTGTGG - Intronic
1108602980 13:52011182-52011204 CCTTCCCTGCGCACCCCCTGGGG + Intronic
1110250720 13:73377538-73377560 CCTTCCCATCTCAGGCCTGGAGG - Intergenic
1111169729 13:84509942-84509964 CCTCCCCAGCTCACCCTATGAGG + Intergenic
1112261816 13:97884328-97884350 CCTGCCCAACTCACTCCTTCTGG - Intergenic
1113023464 13:105915012-105915034 CCTCCCCAGCTCACCCTGTGTGG - Intergenic
1113419256 13:110157419-110157441 CCTTCTCAGCTCTTCCCTTTAGG - Intronic
1113662331 13:112116313-112116335 CCTCTCCAGCTCACTCCTGGAGG + Intergenic
1113770115 13:112902852-112902874 CCTGCCCAGCTCTCACCTCGGGG - Intronic
1113776691 13:112951657-112951679 TCCTCCCAGATCACCCCTCGTGG - Intronic
1114828948 14:26115090-26115112 CCTTCCTAGCTGATCCCTGGTGG + Intergenic
1115503789 14:34074484-34074506 CCTTCCCAGCGCATCCCATCAGG - Intronic
1118991932 14:70804937-70804959 CCTTCCCTGCTCAGTCCCTGTGG + Intronic
1119924979 14:78484963-78484985 CCTTGCCAGCACACTCCTTTGGG + Intronic
1121170232 14:91847665-91847687 CTTCCCCACCTGACCCCTTGTGG + Intronic
1121885573 14:97539698-97539720 TCTTCCCAGGCCACCTCTTGGGG + Intergenic
1124901450 15:33826973-33826995 CCTTTCCATCTAGCCCCTTGGGG + Intronic
1129481303 15:75828583-75828605 CCTCCCCATCTCACCACTTTTGG - Intergenic
1130520327 15:84656945-84656967 CCTTCCCAGTAGACCCCATGGGG - Intronic
1130634064 15:85599579-85599601 GCTTCCCACCTCCCCCCTTCTGG - Intronic
1130672267 15:85923134-85923156 CCTTCCCAGCACAGGCCTTTGGG - Intergenic
1133130385 16:3673032-3673054 CCTCCCCAGCCCACCCCCTAAGG + Intronic
1135109764 16:19681459-19681481 CCTTGCTAGCCCACCCCATGCGG - Intronic
1135910194 16:26553471-26553493 CCTTCCTAGGCCACACCTTGAGG - Intergenic
1136067905 16:27771054-27771076 CCTTCCCAGAGCACTCCCTGAGG + Intronic
1136526553 16:30834837-30834859 GCTTCCCAGCTCACCCACCGCGG - Exonic
1137569384 16:49555250-49555272 CCTTCCCAGCTTCTTCCTTGTGG - Intronic
1137782636 16:51110650-51110672 CCTTCCTTTCTGACCCCTTGTGG + Intergenic
1137903584 16:52295865-52295887 CCTTTCCAGCCCACCCATGGTGG - Intergenic
1139345520 16:66300602-66300624 CCTTCCCAGCTCAGGATTTGTGG + Intergenic
1139655284 16:68383660-68383682 CCTTCTCGGCTGATCCCTTGTGG + Intronic
1140550582 16:75861544-75861566 CCCTCCCAGCTGCCTCCTTGTGG - Intergenic
1141108479 16:81252874-81252896 ACTGCCCACCTCACCACTTGAGG + Intronic
1141896760 16:86963306-86963328 CTTTCCAAGCTCACCCTTTCTGG - Intergenic
1141930874 16:87201940-87201962 CCCTCCCAGCTCCAGCCTTGGGG + Intronic
1143373431 17:6454320-6454342 CCTTCCCAGCCCACCCAGAGAGG + Exonic
1143445485 17:7006660-7006682 CCTTCCCAGCCCTGCCCTTCTGG + Intronic
1143681258 17:8477634-8477656 CCTTCCCACCCCCACCCTTGGGG - Intronic
1143869017 17:9944602-9944624 CCTTCCCAGTTCCCCCGGTGTGG + Intronic
1145909083 17:28532396-28532418 CCTGCCCAGGTCACCCCATAGGG - Intronic
1146062530 17:29614613-29614635 CCTTCCCGGCTCAGCCAGTGAGG + Exonic
1146482835 17:33218827-33218849 CCTTACCACTTCACCCCTTCAGG + Intronic
1146992724 17:37289797-37289819 CCTTCCAACTTCACCCCTTAAGG + Intronic
1147316312 17:39622067-39622089 ACTTCCCAGCTCCCACCTGGGGG + Intergenic
1148131299 17:45264091-45264113 CCTGGCCAGCTCACCCCTTTTGG - Exonic
1148567726 17:48643423-48643445 CCTTCCCATCTCTCCTCTTGGGG - Intergenic
1148908434 17:50926561-50926583 CCTTCCCAGCCCACATCCTGGGG - Intergenic
1149603725 17:57910276-57910298 CCTCCCCTGCTCAGCCCATGGGG + Intronic
1149970217 17:61210515-61210537 CTTTCCCAGCTCATGCCTAGTGG + Intronic
1151391774 17:73791961-73791983 CCTTCCCAGCTCAGACCCTTGGG - Intergenic
1151607389 17:75147154-75147176 ACTTCGCAGCACACCCCCTGGGG + Intronic
1151756743 17:76079586-76079608 CCTGCCCAGCTCAGCACTTGGGG - Intronic
1152392301 17:80010100-80010122 CCTGCCCAGGTCAGGCCTTGGGG + Intronic
1152794719 17:82301375-82301397 CCTGCCCAGCTCACCCCTCCTGG - Intergenic
1155831379 18:30519008-30519030 CCATCCCTCATCACCCCTTGAGG - Intergenic
1156167420 18:34439089-34439111 CTTTCCCTGCTCAGGCCTTGGGG - Intergenic
1157424894 18:47576612-47576634 CCTTCCCTCCTCACTCCATGGGG + Intergenic
1157685336 18:49638775-49638797 CCTTCCCATCTCAGCACTCGAGG - Intergenic
1158025856 18:52896831-52896853 CCTACCCAGCTTTCCCCTGGAGG - Intronic
1159070813 18:63622065-63622087 CCTTTCCAGCTCACTCTCTGGGG + Intergenic
1160571882 18:79822999-79823021 CCTTCCCACCTCCCTCCATGGGG + Intergenic
1160717580 19:583382-583404 CCTCCCCAGCTCACCCCTGGAGG + Exonic
1160754526 19:750704-750726 CTGGCCCAGCCCACCCCTTGGGG - Intergenic
1160847902 19:1174351-1174373 CCTTCCAAGCCAATCCCTTGAGG + Intergenic
1161167338 19:2795320-2795342 CCCTGCCAGCTCACGCCATGTGG - Intronic
1161856255 19:6767494-6767516 CCTTCCCAGACCACACCTAGTGG + Exonic
1162060156 19:8090006-8090028 CCTTCCCTGCACACACCTGGGGG - Intronic
1162499222 19:11041924-11041946 TCATCCCACCTCATCCCTTGAGG - Intronic
1163446415 19:17349036-17349058 CCCTCCCAGCCCATCCCCTGGGG - Intergenic
1163516046 19:17764441-17764463 CCTACCCCACTCACCCCATGGGG - Exonic
1163549254 19:17956402-17956424 CCAGCCCAGGTCAGCCCTTGTGG + Intronic
1164454989 19:28399498-28399520 CCTTCCCAGATCTCCACTTGTGG + Intergenic
1164513203 19:28913845-28913867 CCTTTCCAGCTCACCCTTCTGGG + Intergenic
1164932495 19:32186440-32186462 CCTCCCCTGCTCAACCCTGGGGG + Intergenic
1165242062 19:34476834-34476856 CCTTTCCAGCTCAGCTCCTGGGG - Intergenic
1165900550 19:39167443-39167465 CCAGCCCAGCCCACCCCTGGTGG - Intronic
1166201837 19:41242802-41242824 CCCTCCCACATCACCCCTTTGGG + Intronic
1166257452 19:41616697-41616719 CATCCCCAGCTGAGCCCTTGAGG - Intronic
1167439625 19:49500747-49500769 CCCGCTCACCTCACCCCTTGGGG + Intergenic
1167590883 19:50403591-50403613 CCTGCCCAGCCCTCACCTTGAGG - Exonic
1167609963 19:50502221-50502243 CCCTCCCAGCTCCCACCCTGTGG - Intergenic
1168539640 19:57199452-57199474 CATTCCCAGCTCACCCATGATGG + Intronic
1168643903 19:58047686-58047708 CATACCCTTCTCACCCCTTGTGG + Intronic
1168697512 19:58412657-58412679 CATTCCCAACTCATCCATTGAGG - Intronic
926548187 2:14268499-14268521 CATTCCCAACTCACACCTTAGGG + Intergenic
926931062 2:18041385-18041407 ACTTCCCTGCTCACCCCATAAGG - Intronic
927959955 2:27234971-27234993 CCTTCCCAGATCACCCCTTTTGG - Intronic
928327989 2:30335218-30335240 CCTTCCCAGCTCAGCCCTCTGGG + Intergenic
932458047 2:71862187-71862209 CCCTTCCAGCTCAGCCCTTCTGG - Intergenic
933968575 2:87451434-87451456 CCTTCCCAGCACCCCTCTTGGGG + Intergenic
936008223 2:108908577-108908599 CCCACCCAGCTCACCCGCTGGGG - Intronic
936325219 2:111499071-111499093 CCTTCCCAGCACCCCTCTTGGGG - Intergenic
937294769 2:120803493-120803515 CCTTGCCTGCTGACCCGTTGAGG + Intronic
937580954 2:123487460-123487482 CCTTCCAAGCTCCGTCCTTGTGG + Intergenic
938072703 2:128317046-128317068 CCTTCCCAGCCCAGACTTTGGGG + Intronic
940209057 2:151237621-151237643 CTTTCTCAGCTCTGCCCTTGTGG - Intergenic
944684436 2:202105660-202105682 CCTTCCCTGCTCACACCATGTGG - Intronic
946160247 2:217831441-217831463 TCTTCCCAACTCACCTCCTGTGG + Exonic
946381972 2:219354990-219355012 CCCTCCCAGGTCTCACCTTGAGG + Intergenic
948094621 2:235324004-235324026 CCTCCCCAGCTCAGCCCCTGAGG + Intergenic
948106555 2:235419120-235419142 CCTGCTTAGCTCACCCCTTGTGG + Intergenic
948196917 2:236103356-236103378 CCAGCCCAGCTGCCCCCTTGGGG - Intronic
948464011 2:238143583-238143605 CCTTTCCAGAGCACCTCTTGGGG - Intronic
948994729 2:241572577-241572599 CCCTCCCCACTCACCCCTTCCGG - Exonic
1169332002 20:4723423-4723445 CTTTCCAATCTCACCCCTGGGGG - Intronic
1171043413 20:21788256-21788278 CCTTCCCAGCTCCTCCTTTCAGG + Intergenic
1172116272 20:32575233-32575255 TCTTGCCAGCTCACCCCTTCAGG + Intronic
1172274535 20:33672561-33672583 CCTGCCCAGCTCAGCCCTGCAGG + Intronic
1172690378 20:36785710-36785732 CGTTCCCAGCAGACCCCTTGAGG - Exonic
1173617139 20:44410644-44410666 CCTTTCCAGCTCACACTTTCTGG - Intronic
1174173239 20:48629736-48629758 GCCTCCCAGCTCACCCCTCTGGG + Intronic
1174187747 20:48719224-48719246 CCTTCCTAGATCACCTTTTGTGG - Intronic
1175801689 20:61804615-61804637 CCTGCCCAGCTCTCGCCTGGTGG + Intronic
1176154645 20:63612462-63612484 CCTTCCCAGCTCACCCCTTGTGG - Intronic
1176278241 20:64286599-64286621 CTTTCTCAGCACACACCTTGGGG + Intronic
1176923940 21:14723396-14723418 CATTCCCTGCTTACCCCTTTAGG - Intergenic
1177912913 21:27054130-27054152 CATTTCCAGCTCACTCCTAGTGG - Intergenic
1178303393 21:31470932-31470954 CCATCCCAGCTGCCCCCTCGGGG - Intronic
1178513909 21:33230195-33230217 CCTTTGCAGCTCTCGCCTTGCGG - Exonic
1179529448 21:42009309-42009331 CCATCCCAGCACACCGCTGGGGG - Intronic
1179572765 21:42287549-42287571 CCTTCCCAGCTCCACCTTGGAGG + Intronic
1179779982 21:43693302-43693324 ACCTGCCAGCTCACCCCTGGTGG + Exonic
1180763114 22:18223725-18223747 CCTGCCCAGCCTGCCCCTTGCGG + Intergenic
1180772531 22:18400822-18400844 CCTGCCCAGCCTGCCCCTTGCGG - Intergenic
1180803911 22:18650438-18650460 CCTGCCCAGCCTGCCCCTTGCGG - Intergenic
1180806852 22:18719011-18719033 CCTGCCCAGCCTGCCCCTTGCGG + Intergenic
1180920037 22:19516921-19516943 CTTTCCCACCTGACCCTTTGAGG + Intronic
1181141027 22:20804983-20805005 CCTTCACAGCCCACACCATGAGG + Exonic
1181182524 22:21078032-21078054 CCACCCCAGCTCACACCTTCGGG + Intergenic
1181217807 22:21344821-21344843 CCTGCCCAGCCTGCCCCTTGCGG + Intergenic
1182108276 22:27704642-27704664 CCATCACAGCTCACCCAGTGAGG - Intergenic
1182279272 22:29208644-29208666 CCTACCCAGGTCACCCCTGTGGG - Intronic
1182457610 22:30461873-30461895 CCCTCCCAGCTCATCCCTCTGGG + Intronic
1183701296 22:39452715-39452737 CCCTCCCAGCTCAGGCCCTGTGG - Intergenic
1183701646 22:39454440-39454462 CCCTCCCAGCTCAGGCCCTGTGG - Intergenic
1183711078 22:39503802-39503824 CCCTCCTAGATCACCCCCTGTGG + Intronic
1184416627 22:44355610-44355632 CCTTCTCAGCTCTTCCCCTGAGG + Intergenic
1184669872 22:46006983-46007005 CCTTCTCCGCTCTCCCCTGGGGG + Intergenic
1184745058 22:46451261-46451283 CCTTCCCAGCTCCCTCCTTGTGG - Intronic
1184770909 22:46595880-46595902 CCTTCCCAGCTTACCCAGGGAGG + Intronic
1184849510 22:47112263-47112285 ACTTCCCAGCCCGCACCTTGGGG - Intronic
1185041350 22:48506076-48506098 CCTTCCCTGCACACCCCACGGGG + Intronic
1203234369 22_KI270731v1_random:141810-141832 CCTGCCCAGCCTGCCCCTTGCGG - Intergenic
951888252 3:27545483-27545505 TCTTCCAAGCTTTCCCCTTGTGG - Intergenic
952918196 3:38265695-38265717 CCTTCCCAAGTCACACCTAGGGG + Intergenic
953491483 3:43356020-43356042 CCTTCCTAGCTCATTCTTTGAGG + Intronic
953716488 3:45320745-45320767 CCTGCCCTGCTCACACCTTCTGG + Intergenic
954108142 3:48420076-48420098 CCTTCCCTGCTCAGCCCCTGGGG - Exonic
954859771 3:53677524-53677546 CCTTCCCACCTAACCCAGTGAGG - Intronic
954952047 3:54484064-54484086 CCTACCCATCTCACCCCATAAGG - Intronic
955793586 3:62612475-62612497 CCTTCCCCATTCATCCCTTGTGG + Intronic
956213509 3:66825529-66825551 ACTTCCCAGGACACCTCTTGGGG + Intergenic
958153694 3:89725512-89725534 CCTTCCTAACTCTACCCTTGTGG - Intergenic
961102080 3:124208115-124208137 ACTTTCCACCTCACCGCTTGAGG + Intronic
963616075 3:147539717-147539739 CCTTCCCAACTCACTCTATGAGG - Intergenic
966853973 3:184181512-184181534 CCTTGCAAGCTCATCTCTTGGGG - Intronic
967399178 3:189041583-189041605 GCTTCCCTTCTCACCCCATGTGG + Intronic
967695782 3:192528943-192528965 CCTTCCCATCTCAGGCCTAGAGG - Intronic
968646633 4:1744339-1744361 AGTTCCCAGCTCACCCCCTCTGG - Intronic
968684377 4:1947164-1947186 CCTCCCCAGCACACTCCCTGTGG + Intronic
972114203 4:35607500-35607522 CCTTCCCTGATAAACCCTTGTGG + Intergenic
973062160 4:45740910-45740932 CCTTCCCAGCTCATTCTATGAGG - Intergenic
973752440 4:54035247-54035269 CCTTCCCAGCTCACTTTATGAGG - Intronic
975584956 4:75940407-75940429 CCTTCCAAGCTTGCCCCTTTGGG - Intronic
975738353 4:77404159-77404181 AATTCCCAGCTCCCCACTTGTGG + Intronic
977440299 4:97057786-97057808 CATTCCCAGCTCTCCTGTTGTGG - Intergenic
978391687 4:108233461-108233483 CCTTCCCAGCTCATTCTATGAGG - Intergenic
981034021 4:140152286-140152308 TCTCCCCAGCTCACCCCCTTTGG - Intronic
981044490 4:140252912-140252934 CCTCCCCAGCTCACCCATCCCGG - Intergenic
982564628 4:156971789-156971811 CCTTCCCTCTTCACCCCGTGCGG - Intergenic
983185528 4:164696002-164696024 CTTCCCCAGCTCTCCCCTTTTGG - Intergenic
984840123 4:184060387-184060409 CCTTCCAGGCTCAGCCCTGGGGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
985646019 5:1085109-1085131 CACACCCAGCCCACCCCTTGCGG + Intronic
985837163 5:2280044-2280066 CCCTCCCAGCTCACCCCTTGAGG - Intergenic
986666198 5:10107052-10107074 CCTTTCCAGCTCTCTCTTTGAGG - Intergenic
987000714 5:13656654-13656676 CCTTTCCAACTCAAACCTTGGGG + Intergenic
992414924 5:76543292-76543314 CCTTCGCATGACACCCCTTGTGG + Intronic
993024120 5:82626557-82626579 CCTTCCCATCACAGCCCTGGAGG + Intergenic
995510785 5:112907144-112907166 CCTGCACAGCTAACCCCTAGAGG + Intronic
996547422 5:124695054-124695076 CCTGCCCAACTCACACATTGGGG + Intronic
997659332 5:135577716-135577738 CCTTCCCAATTAACCACTTGAGG - Intronic
998650964 5:144121027-144121049 CCTTCCCAGCTCATTCTATGAGG - Intergenic
999238492 5:150114115-150114137 CCTTCCCAACCCTCCCCGTGCGG + Exonic
999259791 5:150230959-150230981 CCTTCCCAGCTCATCTCCTGAGG + Intronic
999347881 5:150840426-150840448 CCTTCTCTGCTCAGCCCCTGGGG + Intergenic
1000437448 5:161230555-161230577 CCTTCTCAGCTCTCCACTTTGGG + Intergenic
1001221517 5:169904509-169904531 CCTTCCCACCTCACTCCCTCAGG - Intronic
1001587984 5:172846086-172846108 CCTTCTCAGCACATCCCATGGGG + Intronic
1001763825 5:174229225-174229247 CCTTCCCAAATGGCCCCTTGGGG - Intronic
1002177523 5:177409669-177409691 ACTTCCTTGGTCACCCCTTGAGG + Intronic
1002754678 6:148065-148087 CTTTCTCAGCACACACCTTGGGG - Intergenic
1003080440 6:3017094-3017116 CCATCTCATCTCACCCCTCGGGG - Intronic
1003850558 6:10218154-10218176 CCTCCCCAGCCCACCCTCTGTGG - Intergenic
1005412753 6:25567503-25567525 CCTTCCAAATTCAGCCCTTGTGG + Intronic
1006577816 6:35058904-35058926 CCTTCCCTGCTCATCCTTAGAGG + Intronic
1007288910 6:40769415-40769437 CTCTCCCAGCTCCTCCCTTGGGG + Intergenic
1007713472 6:43839235-43839257 CGTTCCCAGCACAGCCCCTGGGG - Intergenic
1008468602 6:51858018-51858040 CCTTCCCCACCCACCCCTTCAGG + Intronic
1012089787 6:94876387-94876409 CCTTCCCAGTTCACTCTTAGAGG + Intergenic
1014802433 6:125791286-125791308 CCTTCCCCGCCCACCCCTTGGGG + Intronic
1015127080 6:129767175-129767197 CGTTCCCTGCTCTCCACTTGCGG - Intergenic
1017955450 6:159173918-159173940 CCTGCCCCCCTCATCCCTTGAGG - Intronic
1018358209 6:163040029-163040051 CCTTCCCATCACAGGCCTTGAGG + Intronic
1018433312 6:163740485-163740507 TCTTCCCATCTCACCACTTGGGG + Intergenic
1020230899 7:6317811-6317833 CCTTCCCAGCTCATCTCCAGGGG + Intergenic
1020271726 7:6600521-6600543 CCCTCCCTGCTCACCCCGTCAGG + Intronic
1022624112 7:32016328-32016350 CCTTCCCAGCTAAGCCCCAGTGG + Intronic
1023334724 7:39156797-39156819 CCTTCCCTGCTTACCTCTTCAGG + Intronic
1028000570 7:85492768-85492790 TCTTCCCAGTTTACCCATTGGGG + Intergenic
1029834301 7:103293107-103293129 CCTCCCCAGTCCAACCCTTGGGG + Intergenic
1032389506 7:131546792-131546814 GCTCCTCAGCTCACCCCTAGGGG - Intronic
1032504118 7:132423039-132423061 CCTGCCCCGCTAGCCCCTTGGGG + Intronic
1032512615 7:132483973-132483995 CCTTCCCTGCACATCCCTGGGGG - Intronic
1032533144 7:132638246-132638268 CCATCCCTGCTTACCCCATGAGG + Intronic
1033466860 7:141599752-141599774 CCTTTCCAGCTCACCATTTCTGG - Intronic
1033651366 7:143346270-143346292 GCACCCCAACTCACCCCTTGTGG + Intronic
1034172319 7:149071867-149071889 CCTGCCCAGTGCACCCCATGCGG - Exonic
1035301016 7:157897174-157897196 CCTTCCGAGCTCATCACGTGGGG - Intronic
1037145994 8:15573546-15573568 CCTTCCCCCCTCATCCCTTGAGG + Intronic
1037396950 8:18453317-18453339 CCTTCCCAGATTGCTCCTTGGGG + Intergenic
1039188642 8:34946630-34946652 CCTTCCAAGCTCAGCCATTAAGG + Intergenic
1039843838 8:41311740-41311762 CCTCCCCCACTCACCCCTAGTGG + Intergenic
1040293094 8:46135502-46135524 CCTGCCCAGGACACCCCTGGGGG + Intergenic
1040312349 8:46243302-46243324 CCTGCCCAGCGCAGCCCTGGGGG - Intergenic
1040315707 8:46259773-46259795 CCTGCCCAGGACACCCCTGGAGG - Intergenic
1041802113 8:61811862-61811884 GCAGCCCAGCTCACCCTTTGTGG + Intergenic
1042555218 8:70028716-70028738 ACTTCCCTCCTTACCCCTTGAGG + Intergenic
1048472488 8:134715694-134715716 GCTTCCCAGCTGACCACTGGTGG + Intergenic
1050578305 9:7023150-7023172 ACTTCCAAGCTCACTCCGTGAGG - Intronic
1053410973 9:37916037-37916059 CCTTTCCACCTCCCTCCTTGGGG - Intronic
1054541191 9:66267834-66267856 CCTTCTCAGCACAGACCTTGTGG - Intergenic
1055091158 9:72365429-72365451 TCTTCCCAGCTCCACCCTAGGGG - Intergenic
1055132972 9:72796355-72796377 TCTTCCCAGCTCATCCTATGAGG + Intronic
1059392717 9:114009043-114009065 CTGTCCCAGGACACCCCTTGAGG + Intronic
1059586347 9:115611530-115611552 CCTCCTCAGCTACCCCCTTGGGG + Intergenic
1061049394 9:128185602-128185624 CCTTCCCAGTTCAACCTTTCAGG - Exonic
1061841432 9:133360610-133360632 GCTTCCCAGCCAGCCCCTTGTGG + Intronic
1061964519 9:134005376-134005398 TCATCCCAGCTCACCACTGGGGG - Intergenic
1062232177 9:135487717-135487739 CCTGCCCAGCCTGCCCCTTGCGG + Exonic
1062323818 9:136003298-136003320 CCTTCCAAGCCAAGCCCTTGAGG - Intergenic
1185871004 X:3664807-3664829 CCTTCCCAGCCTTCCCCTTTTGG - Intronic
1186111294 X:6259135-6259157 CCTTCCCTACTGACCCCTTTTGG + Intergenic
1186546648 X:10456892-10456914 CAATCCCTGCTCAGCCCTTGAGG - Intronic
1188588202 X:31802577-31802599 CCTTCCCACCTCACCCCTGCTGG - Intronic
1189234014 X:39474030-39474052 ACTTCACAGCACACCCATTGTGG + Intergenic
1190324332 X:49197607-49197629 CCTGCCCAGCTCCCACCTCGAGG - Intronic
1190335890 X:49261430-49261452 CTTTTCCAGCTCCCCCCATGAGG - Intronic
1191676384 X:63796067-63796089 CCTTCCCAGTTTACCCCATTAGG - Intergenic
1198028334 X:132730819-132730841 CCTTCCCAGCTCTGCCATTCTGG - Intronic
1199060603 X:143351141-143351163 CCTTCCCATCACAGGCCTTGAGG - Intergenic
1199792123 X:151165080-151165102 CCTTCCAAACTCATCCCATGAGG + Intergenic
1200048125 X:153413374-153413396 CCTTCCCAGCCCTCCCCGCGTGG + Intergenic
1200054333 X:153450873-153450895 GTTTCCCATCTGACCCCTTGAGG - Intronic
1200793084 Y:7316705-7316727 CCTTCCCAGCCTTCCCCTTTTGG + Intergenic
1201159023 Y:11154766-11154788 CCTTCCCATCTCAGCACCTGTGG + Intergenic