ID: 1176155269

View in Genome Browser
Species Human (GRCh38)
Location 20:63616802-63616824
Sequence TACAGGACCCTGAGAGCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176155252_1176155269 27 Left 1176155252 20:63616752-63616774 CCTCAGCCCCACTGGCAGAAGAC 0: 1
1: 0
2: 2
3: 32
4: 313
Right 1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG 0: 1
1: 0
2: 3
3: 9
4: 152
1176155253_1176155269 21 Left 1176155253 20:63616758-63616780 CCCCACTGGCAGAAGACCCTGAG 0: 1
1: 0
2: 0
3: 25
4: 201
Right 1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG 0: 1
1: 0
2: 3
3: 9
4: 152
1176155255_1176155269 19 Left 1176155255 20:63616760-63616782 CCACTGGCAGAAGACCCTGAGAG 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG 0: 1
1: 0
2: 3
3: 9
4: 152
1176155261_1176155269 4 Left 1176155261 20:63616775-63616797 CCTGAGAGGTGGAGGCAGGCCCC 0: 1
1: 0
2: 8
3: 38
4: 385
Right 1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG 0: 1
1: 0
2: 3
3: 9
4: 152
1176155260_1176155269 5 Left 1176155260 20:63616774-63616796 CCCTGAGAGGTGGAGGCAGGCCC 0: 1
1: 0
2: 4
3: 40
4: 376
Right 1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG 0: 1
1: 0
2: 3
3: 9
4: 152
1176155254_1176155269 20 Left 1176155254 20:63616759-63616781 CCCACTGGCAGAAGACCCTGAGA 0: 1
1: 0
2: 2
3: 20
4: 180
Right 1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG 0: 1
1: 0
2: 3
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176155269 Original CRISPR TACAGGACCCTGAGAGCTAG GGG Intronic
900265952 1:1757283-1757305 TTCAGGACCCCGCGAGCCAGCGG - Exonic
901446072 1:9308909-9308931 TCCAGGCCCCTGAGAGCCTGTGG + Intronic
904399936 1:30249501-30249523 TCCAAGACCCTGGGAGCAAGGGG + Intergenic
905019282 1:34797347-34797369 TTCAGATCCCTGAGAGGTAGAGG - Intronic
908931344 1:69319432-69319454 AGCAGGACACTGAGAGCTAAGGG - Intergenic
910062030 1:83105391-83105413 TACAGGTCACTGATAGCCAGTGG - Intergenic
913317036 1:117562216-117562238 TGCTGGAGGCTGAGAGCTAGTGG + Intergenic
915529649 1:156496028-156496050 CACAGGACCCTGATAGCCAAGGG - Intronic
915596440 1:156899110-156899132 TGCAGGGCCCTGAGAGATGGCGG + Intronic
916378667 1:164184277-164184299 TGAAGGACTCTGAGAGCCAGTGG + Intergenic
918718906 1:187826828-187826850 TAAAGGAACCTAAGATCTAGTGG - Intergenic
919339396 1:196284145-196284167 TGCATGAACCTGGGAGCTAGAGG + Intronic
920377992 1:205519557-205519579 GACAGGAGCCTGAGAGGAAGTGG - Intronic
920391002 1:205601385-205601407 TACAGATCCCGGAGAGCCAGTGG + Exonic
920987757 1:210906451-210906473 TACTTGATCCTGAGAGTTAGAGG - Intronic
921729947 1:218566604-218566626 TGCAGGAACCCGAGAGGTAGAGG + Intergenic
1062899801 10:1134428-1134450 TACAGGCCCAAGAGAGCTAGTGG - Intergenic
1063461498 10:6217466-6217488 GGCAGGAGCCTGACAGCTAGTGG + Intronic
1063688462 10:8260814-8260836 TACAGGTCCCTGAGAGAGACCGG + Intergenic
1068666713 10:59684182-59684204 TACAGGACTCCAACAGCTAGTGG + Exonic
1069577936 10:69544041-69544063 TCCAGGTCCCTGAGAGCTCCAGG + Intergenic
1071525194 10:86354304-86354326 GACAGGACCCAGAGACCAAGAGG + Intronic
1071953977 10:90736708-90736730 TACAGGACCCAGAGAATTAGGGG - Intergenic
1074481702 10:113828160-113828182 TACGGGACCCTGAGAGCGAGTGG - Intergenic
1075863073 10:125694684-125694706 TACAAAACCCAGAGAACTAGAGG + Intergenic
1076561029 10:131363887-131363909 AACAGGAATCTGAGTGCTAGTGG - Intergenic
1077101896 11:826121-826143 GACAGGACCTTGAGACCAAGGGG - Intergenic
1077240773 11:1509278-1509300 TGCATGACCCTGAGAGGGAGAGG - Intergenic
1077601283 11:3576626-3576648 TCCTGGACCCTGAGAACCAGGGG + Intergenic
1079796575 11:24811240-24811262 TGCAGGATTCTGAGGGCTAGTGG - Intronic
1083823803 11:65187133-65187155 TCCAAGACCCTGAGTGCTGGGGG + Intronic
1084257198 11:67951200-67951222 TCCTGGACCCTGAGAACCAGAGG + Intergenic
1084439147 11:69161234-69161256 CACAGGAGGCTGAGAGATAGTGG + Intergenic
1084680538 11:70663826-70663848 TCCAGGACCCTGGGAGCCTGGGG + Intronic
1084815579 11:71644068-71644090 TCCTGGACCCTGAGAACCAGGGG - Intergenic
1086681430 11:89678065-89678087 TACAGGAGCCTTTGAGATAGGGG - Intergenic
1087008118 11:93488751-93488773 GACAGGACCCTGGGAGCTGTGGG + Intronic
1089138495 11:116268235-116268257 AACAGGACCCCGGGAGCCAGTGG - Intergenic
1091630581 12:2157486-2157508 GACAGCACTCTGAGAGCAAGTGG - Intronic
1091817140 12:3447050-3447072 AACAGGTCCCTGGGAGCTAAGGG - Intronic
1092427431 12:8385986-8386008 TCCTGGACCCTGAGAACCAGGGG + Intergenic
1092938241 12:13383899-13383921 TGCAGGACCCTGAGAGTGAGTGG - Intronic
1102566866 12:113802793-113802815 GAAAGCACCCTGAGAGCTCGGGG - Intergenic
1103508975 12:121461154-121461176 AACAGGACCCTGCGTGCCAGGGG + Intronic
1103743702 12:123108033-123108055 AACAGGAACCTGACAGGTAGAGG + Intronic
1105860390 13:24405228-24405250 TGCAGGACCCATAGAGTTAGTGG + Intergenic
1105892137 13:24689444-24689466 CACAGGGCCCTGAGGGCTACGGG + Intronic
1108827025 13:54424608-54424630 AACAGGTCCCTGAGAGCAGGGGG + Intergenic
1114501871 14:23175704-23175726 TCCAGGAACCAGAGAGCTAAAGG - Intronic
1114683550 14:24506990-24507012 TTCAGGACCCTGAGAACTAGAGG + Intronic
1118610603 14:67536591-67536613 TACAGGACCCTAAAAGAAAGAGG - Intronic
1119673540 14:76537356-76537378 AACAGGAGCCTGAGAGGTCGAGG + Intergenic
1121211189 14:92209048-92209070 TCCAGAACCCTGAGAGAAAGTGG + Intergenic
1121288035 14:92751800-92751822 TACTTGAGCCTGGGAGCTAGAGG + Intergenic
1124681144 15:31732019-31732041 TACAGGATCCTGAGAGCTAAAGG + Intronic
1131253443 15:90845780-90845802 CACAGAACCCTGTGAGCAAGGGG + Intergenic
1132809356 16:1790158-1790180 TACTGGAGCCTGGGAGGTAGAGG - Intronic
1133217412 16:4301344-4301366 TGCTTGACCCTGAGAGGTAGAGG - Intergenic
1143880027 17:10022938-10022960 TACAGGAGCTGGAGAGCCAGTGG + Intronic
1147050301 17:37789522-37789544 TACAGAACCCTGACAACTACAGG - Intergenic
1147429430 17:40362637-40362659 ACCAGGACCCTGAGAGAGAGTGG - Intronic
1148565760 17:48631952-48631974 GACAGGACCCTGAGGGCTTTAGG + Intronic
1148745583 17:49916225-49916247 CACAGCAGCCTGAGAGCTACAGG - Intergenic
1151529615 17:74695987-74696009 TACAGGAGCCTGAGAAGTGGAGG - Intronic
1152273511 17:79339966-79339988 TACAGGACTCTGAAAGACAGAGG - Intronic
1154350826 18:13582072-13582094 TACAGATGCATGAGAGCTAGGGG - Intronic
1161233418 19:3186636-3186658 AACAGGACCCTGGGAGCTGGAGG - Intronic
1161237187 19:3203981-3204003 TGCAGGACACCGAGAGCTGGCGG - Intronic
1161355759 19:3818942-3818964 TCCAGGCCCATCAGAGCTAGGGG + Intronic
1162410028 19:10500063-10500085 TCCAGGTCCCTGAGTGCCAGAGG - Exonic
925235391 2:2273022-2273044 CACAGGCCCCTGAGAGCTCCTGG - Intronic
926555244 2:14349896-14349918 TCCAGGAACCTGAGAGATGGAGG + Intergenic
932105246 2:68936127-68936149 TACAGGACCCAGAGAGAAAATGG + Intergenic
932500880 2:72181787-72181809 TCAAGTACCCTGAGGGCTAGTGG + Intronic
935397535 2:102623466-102623488 TTCAGAACCCTGGGAGCAAGAGG - Intronic
935948318 2:108305925-108305947 TCCTGGACCCTGAGATCCAGCGG - Intronic
941015941 2:160356385-160356407 TCCAGGACCCTAAGAGATATTGG - Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
946016031 2:216604782-216604804 CCCAGGACCCCCAGAGCTAGAGG + Intergenic
947798581 2:232910635-232910657 TGCACCACTCTGAGAGCTAGTGG - Intronic
948505507 2:238424895-238424917 CTCAGGACCCTGAGATCTGGGGG - Intergenic
948718406 2:239881054-239881076 TGCAGGGCTCTGTGAGCTAGGGG - Intergenic
1169382453 20:5119865-5119887 TTCAGGAGCCTCAGAGCGAGCGG + Exonic
1170549564 20:17465298-17465320 TACAGGAAGCAGAGAGCAAGAGG - Intronic
1171427898 20:25059871-25059893 TACAGGGCACTGAGAGGCAGAGG + Intergenic
1174442474 20:50567066-50567088 GAGAGGACACTGAGGGCTAGTGG + Intronic
1175271179 20:57735138-57735160 CACAGGAGCCTGAGAGGGAGGGG - Intergenic
1175690698 20:61063976-61063998 TAATGGACCCTGGGAACTAGTGG - Intergenic
1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG + Intronic
1176679198 21:9810164-9810186 TCCAGGCCCCTGAGAAATAGGGG + Intergenic
1184431620 22:44444495-44444517 TGCAGGACCCTGAGCCGTAGAGG + Intergenic
1184611513 22:45606925-45606947 TACAGGATCCAGAGAGCTTCTGG + Intergenic
950750359 3:15123520-15123542 TCCTGGACCCTGAGAACCAGGGG - Intergenic
953772188 3:45786331-45786353 TAAAGAAACCTGACAGCTAGAGG - Intronic
953807454 3:46083179-46083201 GACAGGATCCTGATAGCTGGAGG - Intergenic
953987006 3:47451828-47451850 TGCAGAGCCCTGAGAGCTAGGGG - Intronic
954314443 3:49793603-49793625 TACAGGAGCCTGAGAGGTGATGG + Exonic
956232754 3:67035569-67035591 AAGAGGACCCTGAGTGCCAGGGG - Intergenic
956661837 3:71606285-71606307 CACTGGAGCCTGAGAGGTAGAGG + Intergenic
957072139 3:75575680-75575702 TCCTGGACCCTGAGAACAAGGGG + Intergenic
959659128 3:108845731-108845753 TACATGTCACTGAGAGCTGGAGG - Intronic
961282002 3:125771405-125771427 TCCTGGACCCTGAGAACCAGGGG - Intergenic
962146066 3:132841292-132841314 TACAGGACACTGGGAGATGGTGG - Intergenic
964504474 3:157383662-157383684 TACAGGACACTGTGCCCTAGTGG - Intronic
965667651 3:171112293-171112315 TACAAGACCTTGAGAGGAAGGGG + Intronic
966805436 3:183804114-183804136 CACCGGACCCTGAGAGCCTGAGG + Exonic
966967244 3:185006169-185006191 CAAAGGACACAGAGAGCTAGAGG - Intronic
967394944 3:188997681-188997703 TTCAGGAACCTGAGAGGTTGTGG - Intronic
969738233 4:9005360-9005382 TCCTGGACCCTGAGAACCAGGGG - Intergenic
969797417 4:9536906-9536928 TCCTGGACCCTGAGAACCAGGGG - Intergenic
979690006 4:123549819-123549841 TACAGGGACCTGAGAAATAGTGG + Intergenic
980322697 4:131299833-131299855 TACATGTGCCAGAGAGCTAGAGG - Intergenic
982133016 4:152247409-152247431 CCGGGGACCCTGAGAGCTAGAGG - Intergenic
982265688 4:153536475-153536497 TCCAGTGCCCTGACAGCTAGAGG - Intronic
984204193 4:176766501-176766523 TGCTGGACCCTGAGAGATTGTGG + Intronic
985379360 4:189375937-189375959 TACAAGACCCTCAGACCTAGAGG + Intergenic
985842637 5:2320253-2320275 TGCAGGAACCAGAGAGCTTGCGG + Intergenic
986357658 5:6944411-6944433 CACAGGTCCCTGAGAGCTTATGG - Intergenic
986748860 5:10767096-10767118 TACAGGATCCTGAGACACAGGGG + Intergenic
987394972 5:17414274-17414296 CACAGGACACTGAGAGCGAGAGG - Intergenic
988204627 5:28117687-28117709 AACAAGACCCAGATAGCTAGAGG - Intergenic
988517586 5:31918079-31918101 AACAGGAGCCAGAGAGCAAGGGG + Intronic
989830010 5:45904817-45904839 TGCTTGAACCTGAGAGCTAGAGG - Intergenic
994707349 5:103223076-103223098 TGCAGGAGCCTGAGGGCCAGAGG - Intergenic
996519746 5:124413621-124413643 TACATGACCCCGAGACCTTGTGG - Intergenic
997532969 5:134593799-134593821 TACTTGAGCCTGAGAGGTAGAGG - Intergenic
998178160 5:139914775-139914797 TTCAGGGGCCTCAGAGCTAGTGG - Intronic
998500442 5:142627945-142627967 CACAGGACCATGAGAGCCATCGG - Intronic
999287696 5:150404126-150404148 TTCAGGACCCTGAATCCTAGAGG + Intronic
1000803114 5:165753080-165753102 TACAGCTCCCTAAGAGCTAATGG - Intergenic
1005067475 6:21832563-21832585 TACAAGACCATGAGAGCAAGAGG + Intergenic
1005938502 6:30543300-30543322 TACAGGATCCTGTGGGGTAGTGG - Exonic
1006529525 6:34639367-34639389 ACTAGGACCCTGAGAGTTAGAGG + Intronic
1006716039 6:36121282-36121304 TAGAGGCCACTGAGAGCTACCGG + Intergenic
1006896845 6:37476657-37476679 TCCAGGACCCTGAGAGAGAAAGG + Intronic
1007619737 6:43204640-43204662 TCCAGGCCCCTGAGACCTACTGG + Intronic
1007745731 6:44041940-44041962 GCCAGGAGCCTGAGAGCTATTGG - Intergenic
1009243170 6:61203689-61203711 TGCATGAACCTGAGAGCTTGAGG - Intergenic
1019261986 7:86895-86917 TGCAGGACCCTCAGAGCCACAGG + Intergenic
1020808521 7:12821902-12821924 TTCAGGACCCAAAGAGCCAGTGG + Intergenic
1022089585 7:27098596-27098618 TACAGAAGCCTAAGGGCTAGAGG - Intergenic
1022332428 7:29392638-29392660 AACAGGACACTAGGAGCTAGGGG - Intronic
1022454357 7:30545570-30545592 TACAGGACCCTTAATCCTAGGGG - Intronic
1023272546 7:38480327-38480349 CACATGACCCTGAGAGTAAGGGG - Intronic
1023570368 7:41565539-41565561 TACAGAAGCCTGAGAGTCAGAGG + Intergenic
1024914663 7:54485600-54485622 AACTGGACCCTGGGAGATAGAGG - Intergenic
1025111490 7:56220479-56220501 TCCAGGATCCTGGGAGATAGAGG + Intergenic
1029074397 7:97924635-97924657 TCCTGGACCCTGAGAACCAGGGG + Intergenic
1032854599 7:135823967-135823989 TACAGCACCCTGAGAGAAGGAGG + Intergenic
1036243309 8:7096655-7096677 TCCTGGACCCTGAGAACCAGGGG - Intergenic
1036257501 8:7217412-7217434 TCCTGGACCCTGAGAACCAGGGG + Intergenic
1036309547 8:7676008-7676030 TCCTGGACCCTGAGAACCAGGGG + Intergenic
1036359990 8:8070111-8070133 TCCTGGACCCTGAGAACCAGGGG - Intergenic
1036898521 8:12654775-12654797 TCCTGGACCCTGAGAACCAGGGG + Intergenic
1037163558 8:15799989-15800011 GAGAGGACCCTGAGAGCTTTGGG + Intergenic
1038783722 8:30591398-30591420 TGCATGACCCTAAGAGCTTGAGG + Intronic
1040828627 8:51651922-51651944 TGCTGGAGCCTAAGAGCTAGAGG - Intronic
1048169960 8:132096891-132096913 TACTGGAGCCTGAGAGGTGGAGG - Intronic
1048543559 8:135365160-135365182 TCCAGGAGCCTGGGAACTAGGGG - Intergenic
1052180367 9:25518939-25518961 TACAGGATTCTGAGAGCTTCTGG + Intergenic
1053454933 9:38226770-38226792 GACAGCCCCCTGAGAGCTATTGG + Intergenic
1057919680 9:99086858-99086880 TAAAGGACCCAGTGAGTTAGAGG + Intergenic
1203664370 Un_KI270754v1:12700-12722 TCCAGGCCCCTGAGAAATAGGGG + Intergenic
1191895494 X:65988120-65988142 CTCAGGGTCCTGAGAGCTAGAGG + Intergenic
1197365274 X:125557478-125557500 TACAGAAATCTGAGATCTAGGGG + Intergenic