ID: 1176157069

View in Genome Browser
Species Human (GRCh38)
Location 20:63627207-63627229
Sequence GTCGGTCCGCGCACGCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176157069_1176157071 1 Left 1176157069 20:63627207-63627229 CCGGGGCGCGTGCGCGGACCGAC No data
Right 1176157071 20:63627231-63627253 CTGTCAGCTCCTAACGCCGCAGG No data
1176157069_1176157077 27 Left 1176157069 20:63627207-63627229 CCGGGGCGCGTGCGCGGACCGAC No data
Right 1176157077 20:63627257-63627279 CTCCTGGTCCCCGAGGCCCCCGG No data
1176157069_1176157075 20 Left 1176157069 20:63627207-63627229 CCGGGGCGCGTGCGCGGACCGAC No data
Right 1176157075 20:63627250-63627272 CAGGTTCCTCCTGGTCCCCGAGG No data
1176157069_1176157073 11 Left 1176157069 20:63627207-63627229 CCGGGGCGCGTGCGCGGACCGAC No data
Right 1176157073 20:63627241-63627263 CTAACGCCGCAGGTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176157069 Original CRISPR GTCGGTCCGCGCACGCGCCC CGG (reversed) Intergenic