ID: 1176159805

View in Genome Browser
Species Human (GRCh38)
Location 20:63642310-63642332
Sequence TGCCGCTCACGCGCGCCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176159805_1176159809 -1 Left 1176159805 20:63642310-63642332 CCGGCGGGCGCGCGTGAGCGGCA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1176159809 20:63642332-63642354 AACCCCGGGCCCTGCCCGGCCGG 0: 1
1: 0
2: 5
3: 28
4: 287
1176159805_1176159808 -5 Left 1176159805 20:63642310-63642332 CCGGCGGGCGCGCGTGAGCGGCA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1176159808 20:63642328-63642350 CGGCAACCCCGGGCCCTGCCCGG 0: 1
1: 0
2: 1
3: 28
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176159805 Original CRISPR TGCCGCTCACGCGCGCCCGC CGG (reversed) Intronic