ID: 1176160645

View in Genome Browser
Species Human (GRCh38)
Location 20:63646146-63646168
Sequence GAGCAGCACAGAGCCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176160643_1176160645 -5 Left 1176160643 20:63646128-63646150 CCTACACTTTTCTGGACAGAGCA 0: 1
1: 1
2: 0
3: 14
4: 163
Right 1176160645 20:63646146-63646168 GAGCAGCACAGAGCCCAAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 300
1176160641_1176160645 3 Left 1176160641 20:63646120-63646142 CCTGGTGACCTACACTTTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1176160645 20:63646146-63646168 GAGCAGCACAGAGCCCAAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 300
1176160640_1176160645 17 Left 1176160640 20:63646106-63646128 CCTGACTTAAATTTCCTGGTGAC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1176160645 20:63646146-63646168 GAGCAGCACAGAGCCCAAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176160645 Original CRISPR GAGCAGCACAGAGCCCAAGA GGG Intronic
900169797 1:1261325-1261347 GACCAGCACAGAGCCACACACGG + Intronic
900234137 1:1578581-1578603 GAGCTGCAGAGTCCCCAAGAGGG - Intergenic
900376848 1:2358871-2358893 GAGGAGCAGAGAGCCCACGGAGG - Intronic
901025888 1:6278520-6278542 GAGCAGCACAGAGGCGGAGAGGG + Intronic
901624664 1:10617231-10617253 GACCAGCACAGAGGGCAAGAAGG - Intronic
902576490 1:17381192-17381214 GGGCAGCAAAGAGACCAAGAAGG - Intronic
903016356 1:20364685-20364707 GAGCAGCAGGGAACCCTAGATGG + Intergenic
904294288 1:29507706-29507728 GCACAGCACAGAGCCTAAAAAGG - Intergenic
904540179 1:31227612-31227634 GGGAAGCACAGCCCCCAAGAGGG + Intronic
904769944 1:32875559-32875581 CAGCAGCACACAGCACAGGAAGG + Intergenic
904882828 1:33713707-33713729 GAACAGCTCAGAGGCCAAGCTGG - Intronic
905473219 1:38208234-38208256 GAGGAGGACAGAGCCCAGGTGGG + Intergenic
905838586 1:41152698-41152720 GAGCAGCACAGAGCCCCTTTGGG + Exonic
906375340 1:45292189-45292211 GAGTAGCCCAGAGCCCTGGAAGG - Intronic
906624731 1:47315556-47315578 GATCAGCCCAGTGCCCAACATGG - Intergenic
907967815 1:59350271-59350293 GAGCAGCACACAGTCCACTAGGG + Intronic
908571035 1:65410718-65410740 GTGCAGAACAGAGCTCAAAAAGG - Intronic
908695288 1:66833002-66833024 GAGCAGCAGAGTGGCCAAGGGGG + Intronic
913521171 1:119647397-119647419 CAGCAGCTCGCAGCCCAAGAGGG - Intronic
916576995 1:166076309-166076331 GAACAGCACAGAGGCCAGAATGG - Intronic
916828150 1:168463325-168463347 CAGCAGCCCAGCACCCAAGAGGG - Intergenic
918692551 1:187499887-187499909 AAGAAGCACAGAGTCCAAAAGGG + Intergenic
919135116 1:193497923-193497945 CAGCTGCACAGAGCACGAGAGGG - Intergenic
919797615 1:201330860-201330882 GATGGGCACACAGCCCAAGAGGG - Exonic
920120037 1:203649702-203649724 GAGGATCACTGAGCCCAGGAAGG + Intronic
920646436 1:207807428-207807450 GAGCAGAGCACAGCCCAAGGGGG + Intergenic
920945125 1:210521801-210521823 GTGCAGCTCAGAGCCCAAAAAGG - Intronic
921462480 1:215445141-215445163 GAGCAGCAGAGAGCTCCAGTGGG - Intergenic
923465616 1:234245836-234245858 TTGCAGCTCAGAGCCCCAGAGGG + Intronic
923805799 1:237256533-237256555 GAGCAGCAGAGAACCAAGGAAGG - Intronic
924328987 1:242923607-242923629 GGACTGCACAGAGGCCAAGAAGG + Intergenic
924903282 1:248425118-248425140 TTGCAACACAGAGCCCAAGTAGG + Intergenic
1063300108 10:4843529-4843551 GGGCAGCTCAGACACCAAGAGGG - Intronic
1064148812 10:12846149-12846171 CAACAGCACAAAACCCAAGAAGG - Intergenic
1065721979 10:28636110-28636132 GAGCAGCACAGCATCCATGAAGG + Intergenic
1065753057 10:28906078-28906100 GCCCAGCACAGAGCCCAAGCAGG - Intergenic
1065917650 10:30366308-30366330 GAGGAGGAGAGAGCCCCAGAAGG - Intronic
1066113955 10:32223099-32223121 AAGCAGCTCAGGGCACAAGATGG - Intergenic
1066157518 10:32693876-32693898 TAGCAGCTCAGAGCACAAGGGGG - Intronic
1067052558 10:43030434-43030456 AATCAACTCAGAGCCCAAGATGG - Intergenic
1070495140 10:77014853-77014875 GAGCATGACAGAGGCAAAGATGG - Intronic
1072032740 10:91537030-91537052 AAGAGCCACAGAGCCCAAGAAGG + Intergenic
1072414595 10:95236702-95236724 GGGCACCACTGAGCCCATGAGGG + Intergenic
1072656545 10:97334232-97334254 GCGCAGCGCAGGGCCCCAGAGGG + Exonic
1073538894 10:104302101-104302123 GAGAAGTACAGAGCCAAAGAGGG + Intronic
1076735061 10:132455272-132455294 CAGCAGCACAGAGACCCAGATGG + Intergenic
1079094990 11:17504323-17504345 GAGGCCCACAGAGGCCAAGATGG - Intronic
1079328920 11:19518026-19518048 CAGCAGCACAGAGCTAAAGAGGG + Intronic
1080313360 11:30920689-30920711 TAACAGCACAGAGCCCATGCAGG - Intronic
1080605657 11:33862771-33862793 GGGCAGCAGAGAGCTTAAGATGG - Intronic
1081649438 11:44813822-44813844 GAGCAGCACAGAGCCCTCCTGGG + Intronic
1082723339 11:56705815-56705837 GAGCAACACAGCACCCAGGAAGG + Intergenic
1083154243 11:60812826-60812848 GTGCAGCACAGACCCTAACATGG + Intergenic
1083187251 11:61024887-61024909 AAGAAGCAAGGAGCCCAAGAGGG - Intergenic
1083667411 11:64283466-64283488 GAGAAGCACAGGCTCCAAGATGG - Intronic
1084636768 11:70398322-70398344 GAGCAGCACACAGCCCGCGGCGG - Intergenic
1084697335 11:70763496-70763518 GAGCAGCTCAGAGCACAGAAGGG - Intronic
1085302744 11:75467916-75467938 GAACAGGACAGAGACAAAGAAGG - Intronic
1085346327 11:75770339-75770361 GAGCAGCACCCACACCAAGAGGG - Intronic
1088977958 11:114832656-114832678 AATCAGCACAGAGGCCAGGATGG - Intergenic
1089847393 11:121469111-121469133 GAGGAGGGCAGAGCCGAAGACGG - Intronic
1090051563 11:123384401-123384423 CAGCAGCACAAAGACCAAGGAGG - Intergenic
1090547838 11:127784780-127784802 GCCCAGCACAGAGTCCAAGAAGG - Intergenic
1091739268 12:2948566-2948588 GAGCAGGACAGGGCACAGGAAGG + Intergenic
1094608024 12:31966232-31966254 GGGCAGCATGCAGCCCAAGACGG - Intronic
1096443792 12:51669870-51669892 GTGCAGCACAGAGACCATTACGG + Intronic
1096594302 12:52684800-52684822 GAGCAGAGCAGAGGCCAGGAAGG + Intergenic
1099251432 12:80259865-80259887 GAGCAGGAGAGAACCCAAGCAGG - Intronic
1101904084 12:108812477-108812499 GAGCTGCAGAGAGCACAGGACGG + Intronic
1102567891 12:113808979-113809001 GGGCAGCAGAGAGCCCCTGAAGG - Intergenic
1104119300 12:125783763-125783785 GAGCAGCACAGACCCTCAAAGGG + Intergenic
1105448392 13:20476605-20476627 GAGCAGCAGGGAGCCCAAGCCGG + Intronic
1105553274 13:21418761-21418783 GAGGATCACTGAGCCCATGAAGG - Intronic
1105979496 13:25503879-25503901 TAGCAGCTCAGAGCCAAACAAGG + Intronic
1106229785 13:27812972-27812994 AAGGAGGACAGTGCCCAAGAGGG + Intergenic
1107034081 13:35882519-35882541 GAGCAACAAAGAGTCCTAGAAGG - Intronic
1108944549 13:56004458-56004480 GAGACCCACAGATCCCAAGAAGG + Intergenic
1109776947 13:67053074-67053096 GAGCAGGAGAGAGCTCAAGGTGG + Intronic
1110702202 13:78562186-78562208 GAACTGCACAGTGCCTAAGAGGG + Intergenic
1113500212 13:110767437-110767459 GAGAAGGACATAGCCCAAGCTGG + Intergenic
1116617224 14:47154716-47154738 GTACAGCAGAGAGGCCAAGATGG + Intronic
1117387344 14:55229198-55229220 GAGCAGCACCAAATCCAAGATGG + Intergenic
1117408634 14:55429399-55429421 GAGCAGCACAGTTACCTAGAGGG - Intronic
1121113600 14:91328897-91328919 GAGGAGCACACAGCACCAGAGGG + Intronic
1121120851 14:91375107-91375129 CAGGAGCCCACAGCCCAAGAAGG - Intronic
1121162786 14:91760509-91760531 CAAGAGCACAGAGCTCAAGAAGG + Intronic
1121586328 14:95065452-95065474 GAGCCGCAGGGAGCCCAGGAAGG - Intergenic
1122296989 14:100711348-100711370 GAGCCGGACAGAGCCCAGGCAGG - Intergenic
1122871139 14:104639609-104639631 GATTAGCACAGAGCACAGGAAGG - Intergenic
1123627464 15:22237754-22237776 TAGCAGCACAGAGCACTAGCTGG + Intergenic
1125194804 15:37034004-37034026 GAGCGGCACAGAGAGAAAGATGG + Intronic
1127489827 15:59451999-59452021 ATGCAGCATAGAGCCAAAGATGG + Intronic
1127919018 15:63478566-63478588 GAGGTGCACAGAGCCCACGCTGG - Intergenic
1128472710 15:67968424-67968446 GAACAGCTCAGCCCCCAAGAGGG + Intergenic
1128672107 15:69581411-69581433 GAGTAGGACAGAGCCCAGCAAGG - Intergenic
1128767466 15:70259920-70259942 GAGCAGCACCAACCACAAGAGGG + Intergenic
1130660282 15:85826033-85826055 CAGCTGCACAGATACCAAGATGG + Intergenic
1131200572 15:90392448-90392470 AAGCTCCACAGAGCACAAGATGG - Intronic
1132051510 15:98611361-98611383 GAGAAGCATAAAGTCCAAGAGGG - Intergenic
1132252655 15:100345836-100345858 GAGGAGCCCAGAGCCCAGGGTGG - Intergenic
1132842805 16:1986451-1986473 GAGCAGCACAGAGCCATGGGGGG - Exonic
1133434286 16:5765959-5765981 GAGCACCCCAGAGACAAAGATGG - Intergenic
1133721201 16:8495907-8495929 GAGGAACACAGAGTCCAATAAGG + Intergenic
1135990499 16:27216045-27216067 CAGCCGCACTGAGCCCAGGAGGG - Intronic
1137058748 16:35764213-35764235 GAGCAACTCAGAGCCCATTAAGG - Intergenic
1137549155 16:49425101-49425123 GACCAGGACAGAGCCACAGAAGG - Intergenic
1137983111 16:53086337-53086359 GTGCGGCACAGACCCCAGGAGGG - Intronic
1138190104 16:55007732-55007754 GTGGTGCACAGACCCCAAGATGG + Intergenic
1139369169 16:66455418-66455440 TAGCACCAGAGAGCCAAAGAAGG + Intronic
1139374342 16:66487421-66487443 GCCCAGCACAGAGCCCAGGAGGG + Intronic
1141157766 16:81609330-81609352 CTGCAGCACAGAGTCCATGAAGG + Intronic
1141200164 16:81891620-81891642 GGGCAGCACAGAGCACGTGAGGG + Intronic
1141590631 16:85066441-85066463 GACGAGAACAGAGCCCAGGAAGG + Intronic
1141648135 16:85378231-85378253 GAACATCACAGAGTCCCAGAGGG - Intergenic
1141976491 16:87519618-87519640 TAGCAGCACAGAGCACTAGCTGG - Intergenic
1142355534 16:89599836-89599858 CAGCAGCACAGAGACCAGGGTGG - Intergenic
1143481723 17:7231008-7231030 GAGCAGCACTGTGCCCCTGAGGG - Intronic
1144787710 17:17840984-17841006 GCTCACCACAGAGCCCAAGCTGG - Intergenic
1148124238 17:45228783-45228805 GCCCAGCACAGAGCCACAGAGGG - Intronic
1148432915 17:47656997-47657019 CAACAGCACAGAGCACATGAAGG + Exonic
1149192643 17:54082607-54082629 GAGAAGCACCGAGCAAAAGAAGG + Intergenic
1150075279 17:62186849-62186871 GAGCAGCAAAGTTCCAAAGAAGG - Intergenic
1150218942 17:63485049-63485071 CATCAGCCCAGAGCCCAAGTGGG + Exonic
1150263751 17:63818260-63818282 GAGCAAGATGGAGCCCAAGATGG + Exonic
1150905635 17:69333823-69333845 AAGCAGCACAGAGTCAAAGAAGG - Intergenic
1151293442 17:73166259-73166281 TAGCCGCACAGAGACCAAGCCGG + Intronic
1152784895 17:82242440-82242462 GTGCACAACAGAGCCCAAGGGGG + Intronic
1152805649 17:82354564-82354586 GTTCAGGACAGAGCCCAGGAGGG + Intergenic
1152805668 17:82354630-82354652 GTTCAGGACAGAGCCCAGGAGGG + Intergenic
1152900035 17:82935695-82935717 TAGCAGCACATAACTCAAGACGG - Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1154379488 18:13836810-13836832 GGGCAGGACAGAGCCCAGGGCGG - Intergenic
1155645758 18:28075641-28075663 GAGCAGCACAAAGCCACGGAAGG - Intronic
1157197843 18:45634116-45634138 TAGTAGCACAGAGCCCAGGGTGG - Intronic
1160374140 18:78398161-78398183 CAGGGGCTCAGAGCCCAAGAAGG - Intergenic
1161017813 19:1991821-1991843 GGGCTGCACAGAGCCCAACTGGG + Intronic
1161327222 19:3669726-3669748 GAGCAGCACAGTGCCCATGGGGG - Intronic
1163647030 19:18495378-18495400 CAGCAGCAAAAAGCCCAAGCAGG + Intronic
1163671174 19:18629561-18629583 GAGCTGCATGGAGCCCAACAGGG - Intergenic
1163755551 19:19104459-19104481 GGGCAGCACAGAGCCAGAAAGGG + Intronic
1164714135 19:30379313-30379335 GGGCAGCACAGAGCTCAGGCTGG - Intronic
1165334075 19:35156870-35156892 CAGGAGCAGGGAGCCCAAGAAGG + Intronic
1166061360 19:40327745-40327767 GAGGAGGACAGAGGCCAACATGG + Intronic
1167446853 19:49542949-49542971 GAGAAGGACAGGGACCAAGACGG + Intronic
1167639520 19:50673086-50673108 GAGCAGCCCACAGCCCACGATGG + Intronic
1167782247 19:51606377-51606399 GAGCAACAGAGATGCCAAGAAGG - Intergenic
1168310050 19:55455666-55455688 GAGCAGCACAGAGCGCAGCTGGG + Exonic
1168567339 19:57435878-57435900 GAGCCGCAGAGAGCCATAGAGGG + Intronic
924977016 2:187118-187140 GAGAACCACAGAGCACAAGATGG - Intergenic
925054710 2:848483-848505 GAGCTTCACAGAGGCCAACATGG - Intergenic
925221639 2:2146489-2146511 CAGCAGCACTGAGCCCAGGAAGG - Intronic
925468679 2:4135400-4135422 GAGCAGCTCAAAGCCCAACAGGG - Intergenic
926044268 2:9698324-9698346 GAGCAGCACAGACCCCAGGTAGG + Intergenic
927274472 2:21250862-21250884 GAACAGCACAGAGGCCAATGGGG + Intergenic
927482519 2:23465546-23465568 CAGCAGGACAGAGCCCCAGCTGG + Intronic
928330674 2:30355695-30355717 GCACAGCACAGAGCCAGAGAAGG + Intergenic
928536821 2:32249209-32249231 GGGCTGCACATAGCCCAAGACGG - Intronic
929273385 2:39999102-39999124 GAGCAGAACAAATCCCAAGATGG - Intergenic
929577166 2:43059110-43059132 CAGCACCCCAGAACCCAAGAGGG + Intergenic
930291956 2:49505579-49505601 CAGCAGCTCAGGGCACAAGATGG - Intergenic
932769151 2:74490812-74490834 GAACAGGAGAGAGCTCAAGATGG + Intronic
933517228 2:83320156-83320178 GAGCAACACAAAGTCCAAGAAGG + Intergenic
933561150 2:83887791-83887813 GAGAAGCACAGAGCTGAAGAAGG + Intergenic
934985879 2:98884199-98884221 CAGCAGCACTGAGTCCAAGAGGG + Intronic
936018629 2:108978102-108978124 GACCAGCAAAGGGCCCCAGAGGG + Intronic
938177123 2:129144115-129144137 ATGCAGCACAGACCCAAAGAGGG + Intergenic
939100893 2:137893916-137893938 GATCTGCAAAGAGCCAAAGATGG - Intergenic
939261379 2:139814677-139814699 AAGCAGCAGAGAGCCAATGATGG + Intergenic
940011380 2:149059026-149059048 GAGCTGAACAGGGCACAAGATGG - Intronic
940707600 2:157124909-157124931 GAGTGGCACAGAGCCAAAGGAGG + Intergenic
942157473 2:173146034-173146056 AAGCAGAACAGAGCCCATGAGGG + Intronic
942202127 2:173581879-173581901 GGACACCACAGAGCACAAGAAGG + Intergenic
945236582 2:207636986-207637008 GAGCAACACCTAGCCAAAGAAGG + Intergenic
945244678 2:207707251-207707273 GAGGAGAAAAGAGCCCAGGAAGG + Intergenic
946859252 2:223984771-223984793 GAGCATCATGGTGCCCAAGAGGG - Exonic
948304261 2:236935097-236935119 GAGAATCCCAGAGCCCGAGAGGG + Intergenic
948653786 2:239464622-239464644 GAGCAACACAGAGGCCAGGATGG + Intergenic
1168941168 20:1712452-1712474 GAATAGCACTGCGCCCAAGAAGG + Intergenic
1169498961 20:6141107-6141129 GAGGAGAAGAGAGCCAAAGATGG - Intergenic
1169677078 20:8166312-8166334 AAGCACCACAGAGCTCAAGATGG - Intronic
1169935385 20:10877981-10878003 CAGTAGCACAGAGCCCACTATGG - Intergenic
1170077144 20:12432294-12432316 AAGCAGCAATGAACCCAAGAGGG - Intergenic
1170396067 20:15926745-15926767 GAACAGCACAGAGGCCAGCATGG + Intronic
1170702242 20:18713918-18713940 GAGCTGCCCAGAGCCCAGCACGG + Intronic
1172870955 20:38135267-38135289 GAGCAGCTCTGAGCACGAGAAGG + Intronic
1172906745 20:38375918-38375940 GAGTATCTCAGAGCCCAAAAGGG - Intronic
1173793610 20:45843645-45843667 CAGCAGTGCAGTGCCCAAGAAGG + Exonic
1173862123 20:46290816-46290838 GAGTTGCAGAGAGCCCAAGCAGG + Intronic
1174117601 20:48237948-48237970 GAGCAGCACAGAGGCCCATGTGG - Intergenic
1174163911 20:48571199-48571221 GAGCAGCACAGAGGCCCATGTGG + Intergenic
1174218974 20:48937137-48937159 GAGCAGGACAGAGCCCGTGCAGG - Intronic
1175166575 20:57048473-57048495 GGGCAGCCCAGAGGCCAGGAGGG + Intergenic
1175344792 20:58265101-58265123 CATCAGCAGAGAGCCAAAGAAGG - Intergenic
1175626737 20:60494732-60494754 CAGCACCACAGAGGCCAAAAAGG + Intergenic
1175789855 20:61734504-61734526 GAGGTGCCCAGAGCCCCAGACGG + Intronic
1175841628 20:62031618-62031640 CAGCTGAACAGAGCCCAAGGTGG + Intronic
1176075497 20:63246475-63246497 GACCAGAGCAGAGCCCAGGAAGG + Intronic
1176160645 20:63646146-63646168 GAGCAGCACAGAGCCCAAGAGGG + Intronic
1176188258 20:63793325-63793347 GAGCATCTCAGAGCCCCAGGAGG + Intronic
1176364033 21:6021810-6021832 GAGCAGCAGAGACCCCAGGAAGG - Intergenic
1177324854 21:19572296-19572318 CAGCAGCTGAGAGCACAAGATGG + Intergenic
1178239033 21:30877870-30877892 TAGAAGCTCAGAGCCCAAGAAGG + Intergenic
1178940383 21:36900541-36900563 GAGCAACAGGGAGCCCCAGAAGG + Intronic
1179011049 21:37556602-37556624 GAGAAGCACAGAGCAAAAGGGGG + Intergenic
1179027443 21:37691351-37691373 GAGCATCACAGCCCCCAATAAGG - Intronic
1179296561 21:40068052-40068074 GAGGAGCCCAGAGCCAAGGATGG - Intronic
1179456701 21:41505607-41505629 GAGCAGCACGGAGCCCAGGTAGG + Intronic
1179556093 21:42177402-42177424 GGGCAGAACAGAGCCCTGGATGG + Intergenic
1179759485 21:43516735-43516757 GAGCAGCAGAGACCCCAGGAAGG + Intergenic
1179907821 21:44433409-44433431 GAGCTGCACTGAGCTCCAGAAGG - Intronic
1180221766 21:46363849-46363871 GAGCCGCCCACAGCCCAGGACGG + Exonic
1180825360 22:18857556-18857578 GAGCTGCTCAAAGCCCAGGAGGG - Intronic
1181038619 22:20181657-20181679 GGGCATCAGAGAGCCCAAGGTGG - Intergenic
1181187371 22:21116991-21117013 GAGCTGCTCAAAGCCCAGGAGGG + Intergenic
1181211827 22:21293502-21293524 GAGCTGCTCAAAGCCCAGGAGGG - Intergenic
1181256731 22:21567726-21567748 GAGCAGCACCAAATCCAAGATGG + Intronic
1181397673 22:22633384-22633406 GAGCTGCTCAAAGCCCAGGAGGG + Intergenic
1181500421 22:23312754-23312776 GAGCTGCTCAAAGCCCAGGAGGG + Intronic
1181552595 22:23649279-23649301 GAGCAGTACAGTGCCCTGGATGG - Intergenic
1181581648 22:23832094-23832116 GAGCAGCACTGAGCCCAACCTGG + Intronic
1181705643 22:24648065-24648087 GAGCTGCTCAAAGCCCAGGAGGG + Intergenic
1182318745 22:29464732-29464754 GAGCAGCACAGTGTCCAAAGAGG + Intergenic
1184404238 22:44291237-44291259 TAGAACCAAAGAGCCCAAGAAGG + Intronic
1185001827 22:48250899-48250921 GCGCAGGACAGAACCCAGGATGG - Intergenic
1203215126 22_KI270731v1_random:1930-1952 GAGCTGCTCAAAGCCCAGGAGGG + Intergenic
1203275507 22_KI270734v1_random:83459-83481 GAGCTGCTCAAAGCCCAGGAGGG - Intergenic
949730631 3:7108532-7108554 GAGCAGCAGAAAACTCAAGAGGG - Intronic
950433206 3:12963360-12963382 GAGCAGCTGGGACCCCAAGAAGG + Intronic
950666349 3:14497605-14497627 GAGCAGCAGGGAGCCCCTGAAGG + Intronic
950674357 3:14545553-14545575 GGGAAGCATGGAGCCCAAGAGGG - Intergenic
950907432 3:16552126-16552148 GAACAGCAGAGAGCGCAAGCTGG - Intergenic
950987858 3:17394985-17395007 GAGTAGGACTCAGCCCAAGAGGG + Intronic
952322050 3:32286836-32286858 GGGCTGCATACAGCCCAAGATGG - Intronic
952365989 3:32675395-32675417 GAGCAGAGCAGAGCACAACAAGG + Intergenic
952964858 3:38614814-38614836 AAGCAGGACAGACCCCAGGAAGG - Intronic
953255933 3:41290544-41290566 GACCACCACAGAGCCAAAAAGGG - Intronic
954275584 3:49539782-49539804 GAGCAGCTCTGGGCCGAAGAGGG + Intergenic
955833276 3:63026841-63026863 AAGCTGCACAGAGCACAAGCAGG + Intergenic
956008987 3:64810385-64810407 GAGCAGAACAGTTCCCAATATGG - Intergenic
957034664 3:75282663-75282685 AAGCAGCACAGATCCAAAGTTGG - Intergenic
957764127 3:84599573-84599595 AAGGAGGACATAGCCCAAGAAGG + Intergenic
960056150 3:113278001-113278023 AAGCAGCGCTGAGCCCAAGAGGG - Intronic
960731297 3:120730709-120730731 GAGCAGCCCACAGTCCATGATGG + Exonic
960874355 3:122282247-122282269 GCCCTGCACAGTGCCCAAGAGGG - Intronic
961078532 3:124004248-124004270 AAGCAGCACAGATCCAAAGTTGG - Intergenic
961112904 3:124300067-124300089 GTGAATCACAGAGGCCAAGAAGG + Intronic
961304943 3:125952199-125952221 CAGCAGCACAGATCCAAAGTTGG + Intergenic
961644790 3:128387121-128387143 GAGGAGCACAGGGCCGAGGAGGG - Intronic
961806138 3:129490700-129490722 GCCCAGCACAGTGGCCAAGAGGG - Intronic
962847691 3:139286194-139286216 CAGCAGCCCAGAGTCCAAGGCGG + Intronic
963262734 3:143209305-143209327 GAGCAGGATAGATCCCAAGCAGG + Intergenic
965926739 3:173989820-173989842 GAACAGCACACAAACCAAGAAGG + Intronic
967512249 3:190324902-190324924 AGGCAGCACTGAGACCAAGAAGG + Intronic
968544640 4:1192576-1192598 GAGCAGCACAGAGCAGCAGAGGG + Intronic
968850639 4:3075212-3075234 CAGCAACCCAGAGCCCATGAGGG + Intronic
968929922 4:3573415-3573437 TGGCAGCACAGAGGCCAGGAAGG - Intergenic
968970397 4:3790662-3790684 GAGGAGCACAGAGCTCCAGGTGG - Intergenic
969548129 4:7845538-7845560 GAGCAGCTCAGAGGCCACGAGGG + Intronic
971059649 4:22953330-22953352 GAGCAGCTCAGAGCCCCACATGG + Intergenic
971371871 4:26026429-26026451 GAGCAGCAGAGAGCCACTGATGG + Intergenic
971387591 4:26155379-26155401 GAGCAGCTCAGTGACCCAGAGGG - Intergenic
971388467 4:26162870-26162892 GAGCGGCAGGGAGACCAAGAAGG + Intergenic
971761462 4:30771543-30771565 GAGCAGCAAAGAGCTCCAGGAGG - Intronic
972646908 4:40977142-40977164 AAGAAACACAGAGCCAAAGAAGG + Intronic
973543497 4:51957697-51957719 AGGCAGCACAGACCACAAGAGGG + Intergenic
975118691 4:70705557-70705579 GACCAGCGCCCAGCCCAAGACGG - Intronic
981171157 4:141624803-141624825 GAGCAATAAAGAGCCCAAGCTGG + Intergenic
981239827 4:142463760-142463782 GAGAAGCACAGAGCAAAAGGGGG - Intronic
981531754 4:145761000-145761022 CAGCAGCTCAGAGCCCAACCTGG - Exonic
982126409 4:152187737-152187759 GAGCTGCAGAGAGCCCAGAAGGG + Intergenic
982288922 4:153760473-153760495 GAGCAGCATAGGGGCCAAGATGG - Intergenic
983386190 4:167065230-167065252 AAACATCACAGAGCCCAAGAAGG + Intronic
987538773 5:19225721-19225743 GAGCAGGACAGGGACCATGAGGG - Intergenic
991223429 5:64242164-64242186 CAGAAGCCCAGAGCCCAATATGG - Intronic
997225383 5:132205669-132205691 TAGCAGCACAGTGTCCAAGTTGG - Intronic
997971428 5:138405811-138405833 TAGCAGCACAGAGGAAAAGAGGG + Intronic
998918888 5:147045776-147045798 CTGGAGCACAGAGACCAAGATGG - Intronic
1006770226 6:36547091-36547113 GAGCAGGAGAAAGCCCAAGAAGG + Intronic
1007532438 6:42554724-42554746 AAGCAGCACAGACCCAAAGACGG - Intergenic
1007744895 6:44037765-44037787 TAGCAGCTCACAGTCCAAGATGG + Intergenic
1008147822 6:47912795-47912817 GAGCAGCACAGAGTGCAAAGTGG + Intronic
1008369882 6:50720051-50720073 GAGCAGCACACAAGGCAAGAGGG + Intronic
1010660554 6:78566208-78566230 CAGCAGCACAGAGCTGAAGAGGG - Intergenic
1014778150 6:125533897-125533919 AAGCAGCAGAGAAGCCAAGAAGG - Intergenic
1016031674 6:139344428-139344450 GAATAACACAGAGCCCAGGAAGG + Intergenic
1016691043 6:146938175-146938197 AAGCAGCACAAAGCCAAAGTAGG + Intergenic
1017216216 6:151910384-151910406 GAGCAGGACAAAGCCCAAATGGG + Intronic
1017622057 6:156309219-156309241 GAGGAGCACAGAGCAGAAGCTGG + Intergenic
1018063560 6:160109315-160109337 GTGGAGCACAGAGCCCTGGAAGG + Intronic
1019062126 6:169263994-169264016 GTGCAGCACAGAGCCAGTGATGG + Intergenic
1019487488 7:1296062-1296084 GGGCAGCAGAGAGCCAAGGAAGG - Intergenic
1019518541 7:1450314-1450336 AAGCAGCTCAGAGTCCACGAAGG + Intronic
1021842353 7:24731168-24731190 GAGCAGGACAAGGCCCATGAAGG + Intronic
1022766341 7:33416503-33416525 GACCAGTACAGATCCCAAGGGGG + Intronic
1023456524 7:40344728-40344750 GAGGAGGAAAAAGCCCAAGAAGG - Intronic
1023983181 7:45081322-45081344 GAGCAGCACAGTGCCCAGGAAGG + Intronic
1024583217 7:50817803-50817825 GAACAGCACAGAGGCCAAGAGGG - Intergenic
1026204961 7:68248925-68248947 CAGCAGCATTGAGACCAAGATGG + Intergenic
1028487738 7:91378429-91378451 GCCAAGCACAGAGCCTAAGAAGG - Intergenic
1028627131 7:92889637-92889659 GAGCTGCACAGAGCCAAGGGAGG - Intergenic
1029950950 7:104585079-104585101 GAGAAGGACAGAGGACAAGAGGG - Intronic
1030097002 7:105909384-105909406 GAGAAGAGCAAAGCCCAAGAAGG - Intronic
1030808462 7:113945656-113945678 GAATAACACAAAGCCCAAGAAGG + Intronic
1031755958 7:125643097-125643119 CAGCAGCTCAGGGCACAAGAAGG + Intergenic
1033331140 7:140417800-140417822 GAGGCACACAGAGCCAAAGATGG - Intronic
1035160067 7:156943746-156943768 GAGCAGTGCAGAGCACAGGAGGG + Intergenic
1036228912 8:6983054-6983076 CAGCAGCCCAGAGCCCCAGCAGG + Intergenic
1036231364 8:7002159-7002181 CAGCAGCCCAGAGCCCCAGCAGG + Intronic
1036233819 8:7021255-7021277 CGGCAGCCCAGAGCCCCAGAAGG + Intergenic
1038220586 8:25603364-25603386 GAGCAGCTCATAGGCCAAGGTGG + Intergenic
1039966819 8:42290020-42290042 GAGGAAGACAGAGCCCAGGACGG - Intronic
1040901288 8:52419582-52419604 GAGCAGCTGAGAGTCCCAGAGGG + Intronic
1040987608 8:53313696-53313718 GTGCAACACAGAGGACAAGAGGG + Intergenic
1044489769 8:92799541-92799563 GAGAAGTACAGAGCAAAAGAGGG - Intergenic
1045268838 8:100644514-100644536 GAGCAGCACTGAGCAGCAGAGGG + Intronic
1046937946 8:119903760-119903782 GAGCAGAAAGGAGCCCAGGACGG - Intronic
1048842247 8:138576486-138576508 GAGAAGCACAGATCCCAAGCAGG + Intergenic
1049757302 8:144316395-144316417 GTGCAGGACAGAGCCCCATAGGG + Exonic
1050722740 9:8609312-8609334 CAGCAGCACAGAGCATAGGAAGG + Intronic
1055468939 9:76592439-76592461 GAGTAGCACAGAGGCCATGGGGG - Intergenic
1057250801 9:93500100-93500122 GAGCAGCAAAGAGCCCCACTGGG - Intronic
1057725927 9:97568115-97568137 GAGCACTACAGAGCAGAAGAGGG - Intronic
1060511913 9:124240597-124240619 GAGGAGGACAGAGCCTAAGCAGG + Intergenic
1060859088 9:126939123-126939145 GAGGATCACAGAGCCCATCAGGG - Intronic
1060880426 9:127114162-127114184 GAGTAGCACAGTGCTCAAGTGGG - Intronic
1061670873 9:132187483-132187505 TAGCAGCACAGAGAGCAAGAGGG + Intronic
1061679661 9:132236715-132236737 GGGCACCACAGACCCCCAGAGGG + Intronic
1062087291 9:134655338-134655360 GAGAAGCACAGAGCCCCGGGAGG + Intronic
1062301906 9:135878285-135878307 GGGCAGGACAGAGTCCCAGAGGG + Intronic
1062356279 9:136164938-136164960 TAGTAGCACAAAGACCAAGAAGG - Intergenic
1062529936 9:136995366-136995388 GCGCAAGACAGAGCCCAGGAAGG - Intronic
1186591447 X:10934183-10934205 GAGCAGAACAAAAACCAAGATGG - Intergenic
1186614159 X:11169399-11169421 GAGCAGCACTGCACCCCAGAGGG + Intronic
1187428994 X:19204290-19204312 GAGCTGGAGAGAGCCCAAAATGG - Intergenic
1187798793 X:23035987-23036009 GAGAAGCTGAGATCCCAAGAAGG - Intergenic
1188232278 X:27679461-27679483 AAACAGCACTGAGCCCAAGCAGG - Intronic
1189853601 X:45200823-45200845 CTGGAGCCCAGAGCCCAAGATGG - Exonic
1193386932 X:80883538-80883560 GAATAGCACTGAGCCCAGGAAGG + Intergenic
1195370333 X:104166738-104166760 GAGCAGCCCAGGGCCAGAGAGGG + Exonic
1195746556 X:108124211-108124233 CAGCAGCAGAGAGGCTAAGATGG + Intronic
1196047495 X:111271471-111271493 GAGCAACATAGAGCTCAACAAGG + Intergenic
1198138115 X:133774871-133774893 GCCTAGCCCAGAGCCCAAGAAGG + Intronic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1201226368 Y:11822709-11822731 GGACTGCACAGAGGCCAAGAAGG + Intergenic
1201327099 Y:12773601-12773623 GAGGAGCACAGAGCCACAGTTGG - Exonic