ID: 1176161023

View in Genome Browser
Species Human (GRCh38)
Location 20:63648844-63648866
Sequence CTGTAGGCTCATACAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176161021_1176161023 -10 Left 1176161021 20:63648831-63648853 CCGAAAAAAAGATCTGTAGGCTC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG No data
1176161014_1176161023 20 Left 1176161014 20:63648801-63648823 CCCCTGTCTGCCCTAAGCCTGAA 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG No data
1176161018_1176161023 9 Left 1176161018 20:63648812-63648834 CCTAAGCCTGAAATTTTCACCGA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG No data
1176161019_1176161023 3 Left 1176161019 20:63648818-63648840 CCTGAAATTTTCACCGAAAAAAA 0: 1
1: 0
2: 2
3: 34
4: 413
Right 1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG No data
1176161015_1176161023 19 Left 1176161015 20:63648802-63648824 CCCTGTCTGCCCTAAGCCTGAAA 0: 1
1: 0
2: 0
3: 21
4: 855
Right 1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG No data
1176161017_1176161023 10 Left 1176161017 20:63648811-63648833 CCCTAAGCCTGAAATTTTCACCG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG No data
1176161016_1176161023 18 Left 1176161016 20:63648803-63648825 CCTGTCTGCCCTAAGCCTGAAAT 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176161023 Original CRISPR CTGTAGGCTCATACAGAGGA AGG Intronic
No off target data available for this crispr