ID: 1176164970

View in Genome Browser
Species Human (GRCh38)
Location 20:63668049-63668071
Sequence CTGGGCACACACTGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 1, 2: 0, 3: 44, 4: 409}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176164970 Original CRISPR CTGGGCACACACTGGGAGGA GGG (reversed) Intronic
900282628 1:1880961-1880983 CAGAGCACACCCTCGGAGGAAGG + Intronic
900539881 1:3197328-3197350 CTGGGGGCACACAGGAAGGAGGG - Intronic
901052775 1:6433794-6433816 CTGGGCAAAGACTTGGAGGAAGG - Intronic
901878321 1:12179611-12179633 CTGTGAACACACTGTGAGCAGGG - Intronic
902481463 1:16714254-16714276 CTGGGCAAAGACTTGCAGGAAGG + Intergenic
902691056 1:18110317-18110339 CTGGGCACAGACTTGGAAGGAGG - Intronic
903342299 1:22662041-22662063 CTGAGAAGATACTGGGAGGAAGG - Intergenic
903361469 1:22779872-22779894 CTGGGCACAGAATTGGAGCATGG + Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903592758 1:24469686-24469708 CTGGGCCAACCCTGGGTGGAAGG + Intronic
903952695 1:27005421-27005443 TTGGGTAATCACTGGGAGGAGGG - Exonic
904343661 1:29854146-29854168 CTGGGCTCACCCTGTGAGGCGGG - Intergenic
905402846 1:37716059-37716081 CTGAGCTCACCCTGGGAGGGAGG - Exonic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
906157189 1:43620615-43620637 CTGTCCACACGCTGGGTGGATGG + Intronic
906838462 1:49109493-49109515 CTGAGTGGACACTGGGAGGAAGG - Intronic
907119736 1:51998009-51998031 CAGGGCACACACTGTCAGCAGGG + Intergenic
907614943 1:55913791-55913813 CTGGGCCCACACTGCATGGAAGG - Intergenic
907920157 1:58904151-58904173 ATGGGCCCAGACTGGGAGGGTGG - Intergenic
908783561 1:67713513-67713535 CAGAGCACACTCTGGGAGGAAGG + Intronic
909131367 1:71741509-71741531 CTTGGCAAATACTGGCAGGAAGG - Intronic
910624165 1:89288894-89288916 CTGGGCCCACACTGGGGTGGTGG + Intergenic
910836954 1:91523619-91523641 CTGGGCACACAAGGGGTGCAGGG + Intronic
912547437 1:110461001-110461023 CTAGACACAGACTGAGAGGAGGG + Intergenic
912607457 1:111006472-111006494 CTGGTCCCACATTGGGAGGGAGG - Intergenic
913071009 1:115298554-115298576 CTGGGCAGAAACTAGGAGAAAGG + Intronic
913228429 1:116720812-116720834 GGTGGCACACACTGGGAGCATGG - Intergenic
916564140 1:165958600-165958622 CTCTGCCCACAGTGGGAGGAGGG - Intergenic
916731780 1:167573094-167573116 CTATGCACAATCTGGGAGGAGGG + Intergenic
917592820 1:176494732-176494754 CTCTGCACACACTGGGAGCTGGG + Intronic
919325305 1:196099735-196099757 CTAGACACACACTGGGCAGAAGG + Intergenic
920117298 1:203629733-203629755 CTCGGCACAACCTGGGAGGCAGG - Intronic
920180762 1:204130481-204130503 CTGGGCACTTACTGGCAGGGGGG + Intergenic
920365532 1:205446503-205446525 CTGGGCTCAGCCTAGGAGGAAGG - Intronic
920500033 1:206480131-206480153 CTGGGCACAGAGGGGGAGGCGGG + Intronic
921587530 1:216965616-216965638 CTAGTCAGCCACTGGGAGGATGG - Intronic
921694527 1:218192333-218192355 CTGGGCACACATTGGGATCAGGG - Intergenic
922575388 1:226657951-226657973 CTGGGAACAGACTTGGAGGGAGG - Intronic
922619836 1:226982799-226982821 CTCGGCCCCCACTGGGTGGAGGG + Intronic
923706181 1:236346625-236346647 CTTTGCACACACTTGGGGGAGGG + Intergenic
924603875 1:245515676-245515698 ATGGGCCCACACTGCAAGGATGG - Intronic
924794352 1:247281933-247281955 CTGTCCACAAACTGTGAGGAAGG + Intergenic
1063703211 10:8405777-8405799 CTTGGGACACACTTGGAGGGAGG + Intergenic
1063862983 10:10332537-10332559 GTGAGCACACACTAGGAAGAAGG - Intergenic
1064223396 10:13460785-13460807 CTGTACACAAACTGGGGGGAGGG + Intronic
1064371108 10:14752184-14752206 CTGAGCACAAACAGGAAGGATGG - Intronic
1065684916 10:28274627-28274649 CTGTGTAAACACTGGGTGGATGG - Intronic
1065809449 10:29427892-29427914 CCTGGCACTCACTGGTAGGATGG - Intergenic
1067055211 10:43045979-43046001 CTGGGCACCGCCTGGGAAGAAGG + Intergenic
1067118744 10:43456122-43456144 CTGAGGACACACTGGCTGGACGG - Intronic
1067465839 10:46498146-46498168 CTGGGAACACTCTGGAAGAAAGG - Intergenic
1067621348 10:47886460-47886482 CTGGGAACACTCTGGAAGAAAGG + Intergenic
1068208839 10:53893790-53893812 CGGGGGACAGAGTGGGAGGAAGG + Intronic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1070765721 10:79054990-79055012 CAGGGCACTCACTGGAATGAGGG + Intergenic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1072058744 10:91787900-91787922 CTAGACACACCCTGGGAAGAAGG + Intergenic
1072411247 10:95203986-95204008 CTGGGGAAACACTGGGAGCCTGG - Intronic
1072654613 10:97321078-97321100 CTGGGCACGCACTGGGTTGCGGG + Exonic
1072731847 10:97851513-97851535 CTGGGCAGACCCTGGGAGCTTGG + Intronic
1073176931 10:101562370-101562392 TTGGGCACAGAATGGGAGGCGGG + Intergenic
1073180286 10:101579254-101579276 CTGGGCAGACACTGGGAGCCGGG + Exonic
1073180291 10:101579272-101579294 CCGGGCAGACACTGGGAGCCGGG + Exonic
1074783335 10:116818093-116818115 CTGGCCACACACTGCCAGTAGGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075344660 10:121673371-121673393 CTGGGCTTACCCAGGGAGGAGGG - Intergenic
1075498765 10:122953574-122953596 CTGGGCACCTACTGGGTGCAGGG + Intronic
1075630204 10:123995943-123995965 CTGGGCACACAGTGGGTCGCAGG + Intergenic
1075764231 10:124879871-124879893 CTGGGCTCACCTTGGGAGAAAGG + Intergenic
1076408966 10:130232490-130232512 CTGAGCTCCCACTGGGATGAAGG - Intergenic
1077034706 11:489033-489055 CGGGGCACCCACAGGCAGGAGGG - Intronic
1077799202 11:5521609-5521631 CTGTGCACTCACCGGGGGGAGGG + Intronic
1079083041 11:17427410-17427432 CTGGGCTCATACTAGGAGCATGG - Intronic
1079335267 11:19565164-19565186 CTGGGCACACACTAGGCGGCCGG - Intronic
1080493813 11:32796056-32796078 CTGGGCAAACGCTTGGAGAAAGG - Intergenic
1083431407 11:62615373-62615395 CTGGGCATGCACTGGGGGGCTGG - Exonic
1084161804 11:67354077-67354099 TTGGGCACAGACTGTGAGAAAGG - Intronic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1087290990 11:96320290-96320312 CTGCTGACACACTGGGAGGCTGG + Intronic
1088359858 11:108978747-108978769 CTTGGTGCTCACTGGGAGGATGG + Intergenic
1088421510 11:109653319-109653341 CTGGGCACTCAGTGGCTGGAAGG - Intergenic
1089076636 11:115743874-115743896 CCGGGCACACCCCAGGAGGAAGG + Intergenic
1089324932 11:117650567-117650589 CTGAACACACACTTGGTGGAAGG + Intronic
1089748545 11:120634104-120634126 CTGCACACACACTGGAAGGCAGG - Intronic
1090198693 11:124839119-124839141 GTGGGCACACAATGGGCGGCCGG + Intergenic
1090424645 11:126598946-126598968 CTGGCCAAACAATGGGAGGGAGG - Intronic
1091397433 12:162666-162688 CCCTGCACAGACTGGGAGGAGGG - Intronic
1091730434 12:2876861-2876883 CTGGGCACAGGCGGGGAGCAAGG - Intronic
1091771942 12:3157784-3157806 CTGGGCAGACGCTGGCAGGCAGG + Intronic
1091804616 12:3346849-3346871 CTGGGTATACCCTGGAAGGAAGG - Intergenic
1092250407 12:6891914-6891936 CTGTGAATACTCTGGGAGGATGG + Intronic
1092265628 12:6978285-6978307 CTGGGAAGACAGTGGAAGGAAGG + Intronic
1092438695 12:8476847-8476869 CTGGGTAAAGACTGGGAGGTTGG - Intronic
1092857857 12:12691977-12691999 GAAGGCACAAACTGGGAGGAGGG - Intronic
1095967515 12:47878940-47878962 CTGGGGAGAGCCTGGGAGGAGGG + Intronic
1096620430 12:52861210-52861232 CTGGGCACAGCCAGGCAGGAGGG + Intergenic
1097478058 12:60083832-60083854 CTGGGCACACACAGGGTTGAGGG + Intergenic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1101897834 12:108769278-108769300 CTAAGCACACAATGGGAAGAGGG - Intergenic
1102236804 12:111298765-111298787 CTGGGCCCACCCTGGGAGCTTGG - Intronic
1102259820 12:111437127-111437149 CTGGGCCCCTACTGGGAGCAAGG - Intronic
1102597073 12:114001076-114001098 CTTGGCAGAGCCTGGGAGGAGGG - Intergenic
1102874227 12:116437214-116437236 CTGGACACACATTAGGAGAAAGG + Intergenic
1103331353 12:120156449-120156471 CTGAGCACACACCCGGAGCACGG + Exonic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1103700943 12:122848474-122848496 CTGGGCACACACCACGAGAAGGG + Exonic
1104013675 12:124948987-124949009 CTGGGCACAAATCTGGAGGAAGG - Intronic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104580915 12:130010110-130010132 CTGAGCAGACACCGGGGGGATGG - Intergenic
1104889765 12:132134643-132134665 GTGGGCACACTCGGGGAGGTAGG - Intergenic
1104889798 12:132134749-132134771 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104889822 12:132134819-132134841 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104889857 12:132134924-132134946 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104889890 12:132135032-132135054 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104889958 12:132135242-132135264 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890004 12:132135383-132135405 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890038 12:132135491-132135513 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890084 12:132135631-132135653 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890096 12:132135667-132135689 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890108 12:132135703-132135725 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890202 12:132135979-132136001 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890226 12:132136049-132136071 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890238 12:132136085-132136107 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890250 12:132136121-132136143 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890262 12:132136157-132136179 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890297 12:132136262-132136284 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890331 12:132136369-132136391 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104917000 12:132270859-132270881 ATTGCCACACACAGGGAGGAAGG + Intronic
1104984297 12:132587871-132587893 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1104984319 12:132587960-132587982 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1106083467 13:26519734-26519756 CAGAGCAGCCACTGGGAGGAAGG - Intergenic
1106587918 13:31073220-31073242 GTGGGGACACACTGGGGGTAGGG - Intergenic
1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG + Intergenic
1106777800 13:33025459-33025481 CTGGGCACACAAAGTGAGAAGGG + Intronic
1107544023 13:41420322-41420344 CTGCCCACACACTGGGGAGATGG - Intergenic
1107954957 13:45502772-45502794 CGGGGCAAAGACTGGGAGGCAGG - Intronic
1112433726 13:99375490-99375512 CTGAGCTCACACTGGGTGCAGGG - Intronic
1113574714 13:111387102-111387124 CTGTGGACACCCTGGGAGGGAGG - Intergenic
1113811894 13:113147714-113147736 CTGGACACCCAGTGGGAGAAGGG - Intronic
1114367707 14:22047767-22047789 CTAGGCACACACATGGAGAATGG + Intergenic
1114946550 14:27688890-27688912 ATGAGCACACACTGAGAGGCTGG + Intergenic
1118629421 14:67689180-67689202 CTGGGCACAGACTGGGCATAAGG + Intronic
1119140930 14:72266419-72266441 CTAGGTAAAAACTGGGAGGACGG - Intronic
1119265409 14:73261075-73261097 CTGGGCTGCCACGGGGAGGATGG - Intronic
1120674491 14:87405094-87405116 ATGGGAAGACACTGGGAAGAAGG + Intergenic
1121278711 14:92685312-92685334 CTGGACACACACTGGCAGCAGGG - Intronic
1121440691 14:93947289-93947311 CGAGGCCCACACTGGGAGTAGGG - Intronic
1121720058 14:96103034-96103056 GTGAGCACACACTGTGAGTAAGG - Intergenic
1121825435 14:97006702-97006724 CTGGGATCACCCTGGTAGGAAGG + Intergenic
1122902109 14:104786259-104786281 CTGGGAACCCACTGGGTGGAGGG - Intronic
1123196022 14:106617460-106617482 CTGAGCACACACAGGGAAGCAGG + Intergenic
1124215994 15:27807408-27807430 CTGGGGACACACTGGGCAAAGGG - Intronic
1125724795 15:41862717-41862739 CTGGGCACAAGTGGGGAGGAGGG - Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1125891893 15:43273363-43273385 CTGTGCACACCATGGGGGGATGG + Intergenic
1127282042 15:57501138-57501160 CTGGGCACAGAGTGGGATGGAGG + Intronic
1128683215 15:69666290-69666312 AAAGGCACACACTGGGAGGAAGG + Intergenic
1128883310 15:71263109-71263131 GAGGGCAGAGACTGGGAGGAGGG - Intronic
1129456884 15:75680855-75680877 CCTGGCCCACTCTGGGAGGAGGG - Intronic
1129699762 15:77760829-77760851 CTGGGCCCAAACTGGGAATATGG + Intronic
1129887328 15:79047805-79047827 CACGGTCCACACTGGGAGGAAGG + Intronic
1131403596 15:92145779-92145801 CTGGGCAGACACTGAGGGGAAGG + Intronic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1134450566 16:14360823-14360845 CTGGGCTCACACAGCTAGGAGGG + Intergenic
1135177931 16:20247653-20247675 CTGGGTCCACACTGGAAGGTGGG - Intergenic
1135350666 16:21726545-21726567 AAGGGCACACACTGGGAGGCTGG - Exonic
1136146954 16:28321451-28321473 CTGGGCACAGGCTGGGATCAGGG + Exonic
1136377413 16:29873508-29873530 TGGGGCACACCCTGGGAGGGTGG - Intronic
1138255707 16:55557533-55557555 CTAAGTACACAATGGGAGGAAGG + Intronic
1138384227 16:56625473-56625495 CCCGGAACACGCTGGGAGGAGGG + Exonic
1141379736 16:83565539-83565561 CTGGGAACTCCCTGAGAGGAAGG + Intronic
1141569815 16:84927844-84927866 CTGGACAAACACTTGGAGTAGGG - Intergenic
1142141641 16:88475295-88475317 GTGGGCACACACAGGGACCATGG + Intronic
1142320699 16:89380934-89380956 GTGGGCCCACACTGGGAAGCAGG - Intronic
1142860316 17:2756776-2756798 TCAGGCACACACTGAGAGGAAGG + Intergenic
1144770621 17:17757476-17757498 CAAGGCACACACTGGCAGGTGGG - Intronic
1144780809 17:17807550-17807572 CTGGGCACTCACTGACAGGTTGG - Intronic
1144968799 17:19094175-19094197 CTGAGCACACACTGTGAGTCAGG + Exonic
1144979117 17:19157891-19157913 CTGAGCACACACTGTGAGTCAGG - Exonic
1144989105 17:19220341-19220363 CTGAGCACACACTGTGAGTCAGG + Exonic
1146518363 17:33507263-33507285 GTGGGCCCTCTCTGGGAGGAAGG - Intronic
1147164516 17:38586278-38586300 CAGGGCCCACGCTGGGGGGATGG - Intronic
1147324943 17:39665648-39665670 CTGGGCACAGGCTGGGTGGGGGG - Intronic
1147401284 17:40181420-40181442 CTGGGCAGCCACTGCGAGGGTGG - Intronic
1147605061 17:41769718-41769740 CTGGGCAGACACTGGGGAGCAGG + Intronic
1147979966 17:44268241-44268263 CTGGGCACCCAGTGGGAGCGGGG - Intergenic
1148647926 17:49230041-49230063 CTGGGCACTCCCTGGGTGGGAGG + Intronic
1149010427 17:51850975-51850997 CAGGGCAGGCACTGGGAAGAAGG - Intronic
1149604680 17:57916385-57916407 CTGGGATCAAAGTGGGAGGAGGG - Intronic
1149775164 17:59351516-59351538 CTGGGCACACTCTGGGTAGCAGG - Intronic
1149997536 17:61412717-61412739 CTGCGGACACACTGAGCGGAGGG + Exonic
1150227627 17:63532397-63532419 CTGGGCACACAGCGGGGAGAGGG + Intronic
1150285368 17:63950957-63950979 TTTGGCCCACACTGGGAGGTTGG + Intronic
1151210230 17:72538936-72538958 CTGGAGAGAAACTGGGAGGAGGG + Intergenic
1151253052 17:72852686-72852708 CTGTGCACACATTGGGGGAAGGG + Intronic
1152230829 17:79113214-79113236 CCGGGCAGCCTCTGGGAGGAAGG + Intronic
1152456049 17:80416772-80416794 CTGGGCACAGAGTGGGGGAAGGG - Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152607772 17:81301674-81301696 CTGGGCACCGTCTGGGAAGAGGG + Intergenic
1152835638 17:82528956-82528978 GTTGGCATAGACTGGGAGGACGG + Intronic
1153003250 18:475232-475254 CAGGACTGACACTGGGAGGAAGG - Intronic
1155345490 18:24853076-24853098 CTGGGCTCACCTTGGGAGGGGGG + Intergenic
1156154654 18:34287550-34287572 CAGGGCACACACTGGTATGAGGG + Intergenic
1156174025 18:34521164-34521186 CTGGAAACATACTGGGATGAGGG - Intronic
1157779752 18:50427768-50427790 CTGGGGACATAGTGGGAGGCAGG + Intergenic
1159923523 18:74247107-74247129 ATGGGGAGACAATGGGAGGATGG - Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160703180 19:517911-517933 CTGGGTAGAGGCTGGGAGGAGGG + Intronic
1160703197 19:517960-517982 CTGGGTAGAGGCTGGGAGGAGGG + Intronic
1160778928 19:869212-869234 CGGGGCCCACACAGGGACGAGGG + Intronic
1160928229 19:1557019-1557041 TTGGGCACAGGCTGGGAGGTAGG - Intronic
1161217758 19:3102976-3102998 CAGTGCACACACCGGGAGCAAGG - Intronic
1161539662 19:4842621-4842643 AAAGGCACACACTGGGAGGTAGG + Intronic
1161642859 19:5435301-5435323 CTGGACCCACAGTGGCAGGAGGG - Intergenic
1161729246 19:5948857-5948879 CTGGGCACTCACTGCGAGCCTGG - Intronic
1163006078 19:14397438-14397460 CTGATGACTCACTGGGAGGAAGG + Intronic
1163061667 19:14766002-14766024 CTGATGACTCACTGGGAGGAAGG - Intronic
1163106288 19:15124899-15124921 CGGGGCACAGAATGGGAGGTGGG - Intronic
1163268347 19:16234539-16234561 CTGGGCAGAGGCTGGGAGGGTGG - Exonic
1163395888 19:17061090-17061112 CAGGGCACAGACTGGGAGCCTGG + Intronic
1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG + Exonic
1163606823 19:18280316-18280338 CTGGGCACACTCGGGGAGGGGGG + Exonic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1164979601 19:32603900-32603922 CTGTGTTCACACTGTGAGGATGG + Intronic
1165062513 19:33211722-33211744 CTGGACACAGGCTGGTAGGATGG + Intronic
1165351485 19:35278298-35278320 GTGGGCACATACTGGAAGGCAGG - Intronic
1165397130 19:35570628-35570650 CTGGGCACGCCCAGGTAGGAGGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG + Intronic
1166562831 19:43744716-43744738 GTGGGCACCCACTGGGAGCAGGG - Intronic
1166709934 19:44930354-44930376 CTGGGCATACGCAGGGAGGCTGG + Intergenic
1166944566 19:46388955-46388977 CTGGGCAATCAGTGGGAGAAAGG - Intronic
1167209318 19:48123103-48123125 CTGGGGACAGGCTGGGAGGCCGG + Intronic
1167326934 19:48832459-48832481 CTGGGGACACACAGGAGGGATGG + Intronic
1168268667 19:55237753-55237775 CTGGGCACACAGTGGGTCTAGGG + Intronic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168469590 19:56629548-56629570 CTGTGCCCACACATGGAGGAAGG - Intergenic
1202715503 1_KI270714v1_random:40165-40187 CTGGGCAAAGACTTGCAGGAAGG + Intergenic
925975844 2:9141440-9141462 CTGGGCACTCACTGTGTGGATGG + Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
928179837 2:29061222-29061244 CTGGGCATACGATGTGAGGAAGG + Exonic
931645584 2:64418927-64418949 CTGTGCAGATGCTGGGAGGATGG - Intergenic
932435189 2:71699249-71699271 AGGGGCACCCACTGGCAGGAGGG - Intergenic
932704684 2:74014395-74014417 CAGGGCCCTTACTGGGAGGAAGG - Intronic
932833617 2:75013577-75013599 CTGGGCACTGACAGGCAGGAGGG + Intergenic
934606273 2:95697858-95697880 CTGGACATACACTGGGATGCTGG + Intergenic
934778033 2:96951242-96951264 CTGGGCTCAGGCTGGGAGGAGGG - Intronic
935142738 2:100368261-100368283 CTGAGCACTCACTGGATGGAGGG - Intergenic
935174542 2:100638362-100638384 CGGGGCAGAGCCTGGGAGGATGG - Intergenic
935795277 2:106634917-106634939 CAGACCACACACAGGGAGGAAGG + Intergenic
935899590 2:107776590-107776612 CTGCGCACACACTGAGAACAGGG + Intergenic
936077734 2:109412350-109412372 CTGGGGCCACACTGGGAGGGTGG - Intronic
937384333 2:121413863-121413885 CTGGGGACAGAGTGGCAGGAAGG + Intronic
937984964 2:127634306-127634328 CTGGGCAGACGGTGGGCGGACGG + Intronic
938244028 2:129763675-129763697 CTGGGCACCATCTGGGTGGAAGG + Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938580798 2:132645078-132645100 CTGGGCAGACACGAGCAGGAGGG - Exonic
941293750 2:163709685-163709707 CTGGGCAGATACTGGGAAGAAGG - Intronic
941440842 2:165533505-165533527 CAGGGCACACAATGTGAGCATGG - Intronic
942326255 2:174779294-174779316 CATGGCACACACCTGGAGGAAGG - Intergenic
943672693 2:190680357-190680379 CAGGGCACACTCTGGGAAGCCGG - Intronic
944139056 2:196434967-196434989 CTGTGAACTCAATGGGAGGATGG - Intronic
945416493 2:209579357-209579379 CTGGGGACACACTTGGATGGAGG + Intronic
946422454 2:219572306-219572328 CTGGGCAGACCCTGGCAGAAGGG + Exonic
948708296 2:239809471-239809493 CAGCGCCCACACAGGGAGGAGGG - Intergenic
948763879 2:240209653-240209675 CCGGGCACACAGTGGGAGTCTGG - Intergenic
949009708 2:241671569-241671591 CTGGGCGCAAGCTTGGAGGAGGG - Intronic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1171517313 20:25747716-25747738 CTGGGCAGGCACTGGGAGGGAGG + Intergenic
1172105602 20:32515520-32515542 GTGGGTGCACACTGAGAGGATGG + Intronic
1172523163 20:35582318-35582340 CTGGGCACACGTTGGGTGGAAGG + Intergenic
1173709147 20:45139233-45139255 CTGGATACACACTGGGACGAGGG - Intergenic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175751266 20:61499579-61499601 CTGAGGTCACACAGGGAGGAGGG + Intronic
1175772789 20:61634247-61634269 CTGTCCACACACAGGAAGGAGGG - Intronic
1176164930 20:63667906-63667928 CCGGGCACGCGCTGGGAAGAGGG - Intronic
1176164950 20:63667978-63668000 CCGGGCATGCACTGGGAAGAGGG - Intronic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176165004 20:63668151-63668173 CCGGGCACACACTGGGAGGAGGG - Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179399109 21:41067858-41067880 CTGGGCAGACACGGGAAAGATGG - Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179476732 21:41651336-41651358 CTGGCCATCCACTGGGAGGGGGG - Intergenic
1179478969 21:41665896-41665918 CTTGGCACACAGTGGGTGGGTGG + Intergenic
1179802877 21:43819743-43819765 CTGGGCCCACACAGGAAGGCCGG - Intergenic
1179955407 21:44735487-44735509 CTGGGTAAACACTGGGAGCTGGG - Intergenic
1180981703 22:19881212-19881234 CTGGGCACACCCTGGGACGGAGG - Intronic
1181133481 22:20748459-20748481 CTGGCCACCCAGTGGGAGAAGGG + Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181660200 22:24341167-24341189 CAGGGCAGATACTGGGAGGAGGG + Intronic
1182365921 22:29779284-29779306 CTGGGCACTCACTCGGGGGCAGG + Intergenic
1183101459 22:35586683-35586705 CTGGGGACCCTCTGGGAGGCTGG - Intergenic
1183283863 22:36950639-36950661 CTGGGCACACAGTGGGGACAGGG + Intergenic
1183321820 22:37169651-37169673 GGGGGCAAACCCTGGGAGGAGGG - Intronic
1184729542 22:46365131-46365153 CTGGGCATATCCTGGGAGGAAGG + Intronic
1185181469 22:49365902-49365924 CTCGGCACACACAGTGAGGAGGG + Intergenic
1185181475 22:49365954-49365976 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181479 22:49365980-49366002 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181491 22:49366026-49366048 CTCGGCACACACAGTGAAGAGGG + Intergenic
1185181497 22:49366078-49366100 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
1185388123 22:50545830-50545852 CTGGGCCCAGGCTGAGAGGAGGG + Intergenic
949891530 3:8737140-8737162 CTGGACAGAGACTGAGAGGAAGG + Intronic
950031335 3:9855755-9855777 CTGGGAACCCACTGGGAAGTCGG + Intergenic
950914619 3:16631979-16632001 CTGGGCACCCATTGGGAAAAGGG + Intronic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
952383037 3:32818877-32818899 CTCGGGAAACACTGAGAGGATGG - Exonic
953046013 3:39294696-39294718 CAGGGCTCCCACTGAGAGGAGGG - Intergenic
953406037 3:42660279-42660301 GTGAGCACACGATGGGAGGAGGG + Intronic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
953734513 3:45480429-45480451 CAGGGCACCCACTGGAAAGAAGG - Intronic
953850621 3:46463459-46463481 CTGGACACCCACGGGGAGCAGGG + Intronic
953884573 3:46708030-46708052 CCAGGCATACACTTGGAGGAGGG - Intronic
953896626 3:46808219-46808241 CTGAGTACCCACAGGGAGGAGGG - Intronic
954306382 3:49727716-49727738 CTGGGCAAACACTGTCTGGAAGG + Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
955015373 3:55064461-55064483 CTGGGAACACCCTGGGGAGATGG + Intronic
955570131 3:60295830-60295852 CTGGGCATACATAGGAAGGAGGG + Intronic
955751154 3:62186460-62186482 ATGGGCACACAGGGTGAGGAGGG + Intronic
956937311 3:74117866-74117888 CTGGGTACACTTTGGGAGGCAGG - Intergenic
961635496 3:128330332-128330354 TGGGGCACACTCTGAGAGGAAGG - Intronic
961786989 3:129353311-129353333 CTGGGGACACACGGGGACCACGG - Intergenic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
962710560 3:138082147-138082169 CAGAGCACTCCCTGGGAGGAAGG + Intronic
963533399 3:146498261-146498283 CTACGAACCCACTGGGAGGAAGG + Intergenic
964791150 3:160453712-160453734 CTGGGCAAGCACTGGGGGGCTGG + Intronic
965069094 3:163894219-163894241 CAAGGTACACAATGGGAGGAGGG + Intergenic
965286334 3:166824697-166824719 CTGGGTAGGCACTGGAAGGAAGG + Intergenic
965453888 3:168873632-168873654 CTATCCACACATTGGGAGGATGG + Intergenic
965784901 3:172325098-172325120 CTGGTCACACACAGGCAGCAGGG - Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968926292 4:3550136-3550158 CTGGGCACTCCTTGGGAAGAGGG + Intergenic
971642277 4:29149701-29149723 CTGGCCCTACACTAGGAGGAAGG + Intergenic
977459455 4:97307279-97307301 CTGGGCCAAAACTGGAAGGAGGG + Intronic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
985639019 5:1054496-1054518 CTGGGGAAACGCTGGGCGGAGGG + Intronic
986239871 5:5951399-5951421 CTGTGGACACACTGGGCTGAGGG + Intergenic
986802509 5:11276792-11276814 ATGAGCACACACAGAGAGGAAGG + Intronic
988328801 5:29807583-29807605 CCGGGCACAAACTGAAAGGAAGG - Intergenic
988565486 5:32317230-32317252 CCAGGCACCCACCGGGAGGATGG - Intergenic
989536578 5:42571531-42571553 CTGGGCAGAGTCTGGGAGGTTGG + Intronic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
992232106 5:74673548-74673570 CGGAGGACACACTGGGAGGAGGG - Intronic
992582737 5:78198445-78198467 CTGTCCACACACCAGGAGGAGGG - Intronic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992675579 5:79102537-79102559 CTGGGGACATAGTGAGAGGAGGG + Intronic
993373630 5:87121984-87122006 CTGGATACACTCTGGGAGTAGGG - Intergenic
999445209 5:151633409-151633431 CAGGTCTCACCCTGGGAGGAGGG - Intergenic
1000351822 5:160358322-160358344 CAGGGCACAAGCTGGGAGCAGGG - Intronic
1001412880 5:171523355-171523377 CTGGGCACACAAAGGAAGTAGGG - Intergenic
1002059147 5:176616159-176616181 GTGGGCACACAGTAGGAGGTAGG + Intergenic
1002323466 5:178389529-178389551 GTGGGCACCCTCTGTGAGGAGGG - Intronic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1004091133 6:12503025-12503047 CTGGGCAAAGACTTGGAGGAAGG - Intergenic
1004865669 6:19851604-19851626 CTGTGCACACTTTGTGAGGAGGG + Intergenic
1006098220 6:31669486-31669508 CTGGGCACAAACTGGTTGGCAGG - Exonic
1006393199 6:33770908-33770930 CTGGCCACCCACTGGGACCAAGG + Intergenic
1007500446 6:42293024-42293046 CTGGGGACACACTGCCTGGAAGG + Intronic
1007833862 6:44659296-44659318 CTGGGCACACAGTGGCGGCAAGG + Intergenic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1008580801 6:52904800-52904822 CTGCTCAAACACTGGGAGGATGG + Intronic
1008678529 6:53846516-53846538 CTGGGCTCATACAGGGAGCAGGG - Intronic
1012446501 6:99312293-99312315 CTGGGAACACTCTGGGAGACAGG + Intronic
1012837882 6:104293464-104293486 CTCGGCTCACTCTGTGAGGATGG - Intergenic
1013804478 6:113982267-113982289 CTGGACACAGAGTGGGAGGGTGG - Intronic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017236594 6:152122803-152122825 CTGGGCACACTGTGGAAGGCTGG - Intronic
1018716237 6:166534771-166534793 CTTGGCAGACATTGGTAGGATGG - Intronic
1018905622 6:168073786-168073808 CGCTGCAGACACTGGGAGGATGG + Intronic
1019354217 7:570513-570535 CTGGGCAGGCAGTGGGGGGACGG - Intronic
1019372846 7:672059-672081 CTGGGAACACAGTGGGGGTAGGG - Intronic
1019479769 7:1261178-1261200 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479777 7:1261201-1261223 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479808 7:1261288-1261310 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479838 7:1261376-1261398 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479863 7:1261445-1261467 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479886 7:1261510-1261532 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479894 7:1261533-1261555 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479902 7:1261556-1261578 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479918 7:1261602-1261624 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019504311 7:1383201-1383223 CTGGGCACAGACCGTGGGGAGGG + Intergenic
1019875583 7:3807749-3807771 ATGGGCACAGGCTGGGAGGCTGG + Intronic
1022102334 7:27175869-27175891 CTGGATTCACACTGGGAGGAAGG - Intronic
1022487760 7:30793658-30793680 CTGGGCCCACGATGGGAGGCTGG - Intronic
1022526754 7:31043030-31043052 CTGAGCCCACAATTGGAGGAGGG + Intergenic
1023181883 7:37492739-37492761 CTGGGAACCCACTGGGAGGGAGG + Intergenic
1023585529 7:41725850-41725872 AGGAGCACACCCTGGGAGGAAGG - Intergenic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024548552 7:50541593-50541615 GTGAGTACACACTGGGAAGACGG + Intronic
1025142850 7:56479816-56479838 CTGGGCAGGCACTGTGAGGGAGG + Intergenic
1025190328 7:56891299-56891321 ATGGGCAGACACAGGGTGGAAGG - Intergenic
1025258505 7:57400830-57400852 ATGGGCAGGCACTGGGAGGGAGG + Intergenic
1025610142 7:63070879-63070901 CTGGGCAGGCACTGGGAGGTAGG - Intergenic
1025681611 7:63685621-63685643 ATGGGCAGACACAGGGTGGAAGG + Intergenic
1025709267 7:63891930-63891952 CTGGGCAGGCACTGGGAGGGAGG + Intergenic
1025723981 7:64041543-64041565 CTGGGCAGGCACTGGGAAGGAGG - Intronic
1027224337 7:76234540-76234562 CTGGGAGCAGACTGGGAGGTAGG + Intronic
1029097947 7:98104113-98104135 CAGGACAGACACTGGCAGGAGGG + Intergenic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1029653234 7:101908053-101908075 CTGGGCACTCACTTGGGGGTGGG - Intronic
1029658183 7:101941195-101941217 TGGGGAACTCACTGGGAGGAGGG + Intronic
1031371850 7:120977704-120977726 CTGGGAGAACACTGGGAGGCAGG + Intergenic
1032080305 7:128855304-128855326 CTGGGCACAAACCTGGAGGCTGG - Exonic
1035553187 8:545134-545156 CGGGGACCACACTGGGAGGAGGG - Intronic
1035725117 8:1819534-1819556 CTGTGCCCTCACTGGTAGGAGGG + Intergenic
1036395844 8:8370687-8370709 CTGGGCATGAACCGGGAGGATGG - Intronic
1037734420 8:21555264-21555286 TTGGGCTGACCCTGGGAGGATGG - Intergenic
1037963479 8:23116618-23116640 CTGGGTACACACAGAGAGGGAGG - Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038772009 8:30491440-30491462 TTGGGCACACACAGGGTGGGAGG + Intronic
1039763149 8:40599826-40599848 CCGAGGACTCACTGGGAGGAGGG - Intronic
1040391866 8:46956878-46956900 CTGGGCACAGATTGTGAGGTTGG + Intergenic
1040529487 8:48254579-48254601 GTGGGAACAAACTGGGGGGAGGG + Intergenic
1042350990 8:67777476-67777498 CTGGGCTCACACTGGCACCATGG - Intergenic
1042659203 8:71134972-71134994 CTGGTCACAGAATGAGAGGAAGG + Intergenic
1043097791 8:75997506-75997528 CTATGAACCCACTGGGAGGAAGG + Intergenic
1043529689 8:81135570-81135592 CTGGGGACATTCTGGGAGGCGGG - Intergenic
1043740686 8:83807884-83807906 CAGCCTACACACTGGGAGGATGG - Intergenic
1047100950 8:121675305-121675327 TTAGGCACACAATGGGAGGCAGG + Intergenic
1047947857 8:129900437-129900459 CTGGGCAAACACTGGGATTCGGG + Intronic
1049588158 8:143441348-143441370 CTGGGCACAGACTGAGAGCAGGG + Intronic
1049699731 8:144004826-144004848 CAAGGCACAGACTGGGAGCAGGG + Intronic
1049779727 8:144423407-144423429 CTGGGCACATAATAGGAGGCAGG - Intergenic
1050013890 9:1212568-1212590 GTGGGCACACACCGAGAGGCAGG - Intergenic
1052807602 9:33026034-33026056 CTGGGCACACAGTGGTGGGGGGG - Intronic
1053801220 9:41765542-41765564 CTGGGCACTCCTTGGGAAGAGGG + Intergenic
1054143981 9:61549295-61549317 CTGGGCACTCCTTGGGAAGAGGG - Intergenic
1054189649 9:61977692-61977714 CTGGGCACTCCTTGGGAAGAGGG + Intergenic
1054463756 9:65480651-65480673 CTGGGCACTCCTTGGGAAGAGGG - Intergenic
1054648866 9:67610917-67610939 CTGGGCACTCCTTGGGAAGAGGG - Intergenic
1055482749 9:76725977-76725999 CTGAGCACGCGCTGGGAGAAGGG + Intronic
1056126155 9:83538037-83538059 CGGGGCACACGCCGGGAGCAGGG - Intronic
1056172278 9:83997541-83997563 CTCCGCACCCACTGGGAGGAGGG + Intronic
1056385404 9:86092609-86092631 CTGGGCTCCCAATGGGAGCAGGG + Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058574056 9:106381093-106381115 CTTGGCACAACCTGGGATGATGG - Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1061843623 9:133375280-133375302 CTGTACACAGCCTGGGAGGAGGG - Intronic
1061953382 9:133948962-133948984 CTGCGGACAACCTGGGAGGAGGG + Intronic
1061956135 9:133962157-133962179 CTGGGCACAGAGGGGGATGAAGG + Intronic
1061972795 9:134053878-134053900 TGGGGAACACACTGGGAGGCAGG + Intronic
1061997211 9:134192610-134192632 TGGGGGACACACTGGGAGGTGGG + Intergenic
1062133630 9:134913336-134913358 TGGGGCAGACACTGGGAGGTGGG - Intronic
1062188257 9:135230067-135230089 CTGGCCACCAGCTGGGAGGAAGG + Intergenic
1185604196 X:1358276-1358298 CTGGACACAGTCTGGGAGGACGG + Intronic
1186205107 X:7192201-7192223 CTGGGAACACACTGCCAGCATGG - Intergenic
1186530485 X:10290469-10290491 CTTTGCTCTCACTGGGAGGAAGG + Intergenic
1187363852 X:18650800-18650822 CTGCGCACACGCTGAGAGGGTGG - Intronic
1189358125 X:40327014-40327036 GTGGGCACTGAATGGGAGGAGGG + Intergenic
1192554669 X:72080156-72080178 CTGAGCCCACACTGGGGGCAGGG - Intergenic
1195199317 X:102532675-102532697 CTAGGCACACACTGGCAAAATGG + Intergenic
1196938097 X:120749487-120749509 CTGGGCAGCAACTGGGAGAAGGG + Intergenic
1197745861 X:129932052-129932074 CTGGCCACACACAGGGACGGGGG - Intergenic