ID: 1176166923

View in Genome Browser
Species Human (GRCh38)
Location 20:63679254-63679276
Sequence TGGGATTCCCCCGACCAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176166923_1176166933 27 Left 1176166923 20:63679254-63679276 CCGACCTGGTCGGGGGAATCCCA 0: 1
1: 0
2: 1
3: 9
4: 62
Right 1176166933 20:63679304-63679326 CAGCGTAATGCTCAAGGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 66
1176166923_1176166931 21 Left 1176166923 20:63679254-63679276 CCGACCTGGTCGGGGGAATCCCA 0: 1
1: 0
2: 1
3: 9
4: 62
Right 1176166931 20:63679298-63679320 TGTCCTCAGCGTAATGCTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1176166923_1176166926 -8 Left 1176166923 20:63679254-63679276 CCGACCTGGTCGGGGGAATCCCA 0: 1
1: 0
2: 1
3: 9
4: 62
Right 1176166926 20:63679269-63679291 GAATCCCAGTTGCTTCCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176166923 Original CRISPR TGGGATTCCCCCGACCAGGT CGG (reversed) Intronic
902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG + Exonic
902913515 1:19620282-19620304 TTGGTGTCCCCCGATCAGGTGGG + Intronic
903125469 1:21244571-21244593 TGGGAAACCCCAGGCCAGGTGGG - Intronic
905344593 1:37302641-37302663 TTGGTTTCCCTCCACCAGGTAGG + Intergenic
912630578 1:111243288-111243310 TGGGATTCCCCTTGCCAGGCTGG + Exonic
918478578 1:184952481-184952503 TGGGATTCCCCGGGCCACATTGG + Intronic
922504831 1:226120503-226120525 TGGGAGTCCCCAAGCCAGGTGGG + Intergenic
1072710780 10:97714422-97714444 GGGGATTCCCCCGCCCCGATCGG - Exonic
1072722904 10:97791879-97791901 TGGGAGTCCTCAGACCAGGAAGG - Intergenic
1077180500 11:1210486-1210508 TAGGATCTCCCCGACCAAGTTGG + Intergenic
1077424890 11:2470665-2470687 TGGGGTTCCCTCGGCCAAGTGGG + Intronic
1078602583 11:12746882-12746904 TGGGATGCCACAGACCAGGCGGG + Intronic
1081560400 11:44209181-44209203 TGGGATTCCCCAGTCTAGGTTGG + Intronic
1104559870 12:129833984-129834006 AGTGATTCCCCCAACCAGGCTGG - Intronic
1112179888 13:97068323-97068345 TGGGATTCCCCCTACCAGCGGGG + Intergenic
1115546683 14:34470531-34470553 TGGGATTCCCCCTGCCTGCTAGG + Intergenic
1122987957 14:105221289-105221311 TGACGTTCCCCCGACCATGTTGG + Intronic
1124707467 15:31977725-31977747 GGGGATACCCCTGAGCAGGTGGG + Intergenic
1126574118 15:50181575-50181597 CAGGACTCCCCCGACCAGGCAGG + Intronic
1130092747 15:80834821-80834843 TGGGATTCTCCCTATCAGTTTGG + Intronic
1131086818 15:89582689-89582711 TGGGAATCCCCAGACCACCTTGG + Exonic
1132493731 16:249637-249659 GGGCACTCCCACGACCAGGTAGG + Exonic
1133215297 16:4288561-4288583 TGGGGCTCCCCCGACCAGTAGGG + Intergenic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1141008372 16:80374236-80374258 TTGGATTCCCATGACCAGTTTGG - Intergenic
1141202029 16:81905490-81905512 TGGGATTCCATTGACCAGGTGGG + Exonic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1144874630 17:18390979-18391001 TGGGCTTCCCTGGACCAGGGTGG - Intergenic
1146643855 17:34563338-34563360 TGGGCATCCCCAGATCAGGTGGG + Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1148578738 17:48728659-48728681 TTGGATTCCCCCGGCCTGGGTGG - Exonic
1152356958 17:79812162-79812184 ATGGATTCCTCCGCCCAGGTGGG + Intergenic
1155671278 18:28374698-28374720 TGGAATTCTCCAGACCAGGAGGG - Intergenic
1163611021 19:18301639-18301661 TGTTATCCCCCCGACCAGGGAGG + Intergenic
1163834100 19:19562894-19562916 TGTGCTTCCCAGGACCAGGTGGG + Intronic
1165306510 19:35005956-35005978 TGGGATTCCCTCCACCACCTGGG - Intronic
1165830876 19:38729612-38729634 GGAGGTTCCCCCGACCAGGTTGG + Exonic
1166169819 19:41019747-41019769 TGGGATTCCACAGACAAGCTTGG + Intergenic
926799676 2:16649035-16649057 TGGAATTCAACCGACCAGGTTGG + Intronic
929224078 2:39495021-39495043 TGGGCTTCCCCCACCCAGCTTGG + Intergenic
934636672 2:95995641-95995663 TGGGACTCCCCCCAATAGGTGGG + Intergenic
934796978 2:97109781-97109803 TGGGACTCCCCCCAATAGGTGGG - Intergenic
936545365 2:113387801-113387823 TGGGATTCCCCCCAATAGGTGGG - Intergenic
944329204 2:198445477-198445499 TGGGATACCCCAGCCCAGGGTGG + Intronic
1169118440 20:3082052-3082074 TGGGAATCCCGGGACCAGGGTGG + Intergenic
1173162587 20:40663710-40663732 TGTGAGTCCCTCGACCAGGGAGG + Intergenic
1174169455 20:48606997-48607019 TGGGCTCCCCCAGCCCAGGTGGG - Intergenic
1176141022 20:63545152-63545174 TGGGTCTCCCCTGTCCAGGTGGG + Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1178661692 21:34511947-34511969 TAGAATTCCCCTGACCAGGGTGG + Intergenic
1179424729 21:41266747-41266769 TGGGGTTCCCACGACCAGGAGGG - Intronic
1185156050 22:49194150-49194172 TGGGATCCCCCGGAGGAGGTGGG - Intergenic
1185422845 22:50744699-50744721 TGTGATTCCCACGACCACATAGG - Exonic
961535794 3:127569734-127569756 TGGGATTCCCCCCGCTATGTGGG - Intergenic
969256069 4:6002644-6002666 AGAGCTTCCCCCCACCAGGTGGG + Intergenic
979099815 4:116599794-116599816 GGAGGTTCCCCCGACCAGGTTGG + Intergenic
998104013 5:139456950-139456972 TGGGCTCTCCCCGACCTGGTTGG - Intronic
1007219080 6:40264398-40264420 TGGGCTTGCACAGACCAGGTTGG + Intergenic
1017990821 6:159488499-159488521 TGGGATTCTCCCGAATAGATTGG + Intergenic
1022524743 7:31029661-31029683 AGGCATTCCCCCATCCAGGTTGG + Intergenic
1029156261 7:98520170-98520192 TGGGATGGCCCCAAACAGGTGGG + Intergenic
1029362949 7:100100574-100100596 CGGGATTCCTCCGCCCAGGGCGG + Intronic
1032778097 7:135136551-135136573 TGGGATGCCCTCTGCCAGGTAGG + Intronic
1036851627 8:12205914-12205936 TGGGATGCCCCTGCCCAAGTTGG - Intergenic
1036872993 8:12448168-12448190 TGGGATGCCCCTGCCCAAGTTGG - Intergenic
1038021064 8:23552185-23552207 TGGTTTTCTCCCTACCAGGTAGG + Intronic
1038208299 8:25490537-25490559 TGGGATTCCCATGAACAGGCCGG - Intronic
1040408480 8:47132776-47132798 TGGGCTTCCCCCCGCCGGGTGGG - Intergenic
1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG + Intronic
1195165442 X:102215255-102215277 TGGTACTTCCCAGACCAGGTTGG + Intergenic
1195193416 X:102471836-102471858 TGGTACTTCCCAGACCAGGTTGG - Intergenic