ID: 1176166923

View in Genome Browser
Species Human (GRCh38)
Location 20:63679254-63679276
Sequence TGGGATTCCCCCGACCAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176166923_1176166926 -8 Left 1176166923 20:63679254-63679276 CCGACCTGGTCGGGGGAATCCCA No data
Right 1176166926 20:63679269-63679291 GAATCCCAGTTGCTTCCAGGTGG No data
1176166923_1176166931 21 Left 1176166923 20:63679254-63679276 CCGACCTGGTCGGGGGAATCCCA No data
Right 1176166931 20:63679298-63679320 TGTCCTCAGCGTAATGCTCAAGG No data
1176166923_1176166933 27 Left 1176166923 20:63679254-63679276 CCGACCTGGTCGGGGGAATCCCA No data
Right 1176166933 20:63679304-63679326 CAGCGTAATGCTCAAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176166923 Original CRISPR TGGGATTCCCCCGACCAGGT CGG (reversed) Intronic