ID: 1176166926

View in Genome Browser
Species Human (GRCh38)
Location 20:63679269-63679291
Sequence GAATCCCAGTTGCTTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176166915_1176166926 23 Left 1176166915 20:63679223-63679245 CCGCCGAGGTGGAGCGTGTTCTG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1176166926 20:63679269-63679291 GAATCCCAGTTGCTTCCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 163
1176166920_1176166926 0 Left 1176166920 20:63679246-63679268 CCTGAGCGCCGACCTGGTCGGGG 0: 1
1: 0
2: 2
3: 4
4: 69
Right 1176166926 20:63679269-63679291 GAATCCCAGTTGCTTCCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 163
1176166923_1176166926 -8 Left 1176166923 20:63679254-63679276 CCGACCTGGTCGGGGGAATCCCA 0: 1
1: 0
2: 1
3: 9
4: 62
Right 1176166926 20:63679269-63679291 GAATCCCAGTTGCTTCCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 163
1176166916_1176166926 20 Left 1176166916 20:63679226-63679248 CCGAGGTGGAGCGTGTTCTGCCT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1176166926 20:63679269-63679291 GAATCCCAGTTGCTTCCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176166926 Original CRISPR GAATCCCAGTTGCTTCCAGG TGG Intronic
902442889 1:16442550-16442572 GAACCGCAGGTGTTTCCAGGAGG - Intronic
902729549 1:18360487-18360509 CAATGCCAGGTGCTGCCAGGAGG - Intronic
907623769 1:56009421-56009443 GCATACCAGCTGCTTCCAGTCGG - Intergenic
908430144 1:64048846-64048868 GAACCTTAGTTGCTTCAAGGTGG + Intronic
911773920 1:101783727-101783749 TAATTGCTGTTGCTTCCAGGCGG + Intergenic
913534344 1:119757121-119757143 CAATCCCAGGTCCTTCCACGGGG - Intronic
916345168 1:163781122-163781144 AATTCCCAGTTGATTCCAGATGG - Intergenic
916789520 1:168112990-168113012 AAATCCCAGTCTCTGCCAGGAGG + Intronic
917788788 1:178486707-178486729 GAGTCGCAGTTACTTCCTGGGGG + Intergenic
920419391 1:205821026-205821048 TAATCCCAGCTACTCCCAGGAGG - Intergenic
921777716 1:219121812-219121834 GATTCACAGTTGGTTCCTGGAGG - Intergenic
922493047 1:226034011-226034033 GAATCCCAGGTGCTTGCAGTAGG + Intergenic
923273798 1:232379724-232379746 GATTCACAGTTCCTTCCTGGAGG + Intergenic
923750819 1:236744798-236744820 GAATCCCAGGGGCTCCCGGGAGG - Intronic
923814949 1:237367213-237367235 TAATCCCAGCTACTTTCAGGAGG - Intronic
924425203 1:243944235-243944257 GAATCCCAGCTTCTTCCATCAGG - Intergenic
1064454395 10:15473301-15473323 GAATCCAAGGTGCTTCCTGCTGG - Intergenic
1071387613 10:85138273-85138295 GAGTACAAGTTGCTCCCAGGTGG + Intergenic
1071865383 10:89724405-89724427 AAGTCCCAGCTGCTTTCAGGAGG + Intronic
1073577650 10:104639683-104639705 GAATCCCAGGGGCTTCTCGGAGG + Intergenic
1075671401 10:124266049-124266071 CAGGCCCAGTTGCTTTCAGGTGG + Intergenic
1076298201 10:129403599-129403621 GAATCCAAGAGGCTTCCTGGAGG + Intergenic
1076343596 10:129766016-129766038 GAATCCCTGTTCCCTCCAGAGGG - Intronic
1076812282 10:132893444-132893466 GAATCCCAGGTTCACCCAGGAGG - Intronic
1077156434 11:1094071-1094093 GAATCCTGGTGGCTTCCTGGAGG + Intergenic
1078539065 11:12198930-12198952 GAACCCCAGCTCCTTTCAGGAGG + Intronic
1080008337 11:27432727-27432749 GAATCTCAATTTCTTCCAGTGGG - Intronic
1082015248 11:47480914-47480936 TAATCCCAGCTGCTTGCAGTTGG + Intronic
1082656835 11:55867423-55867445 GGATCCCAGGGGCTTCCAAGGGG + Intergenic
1083596383 11:63919852-63919874 TGATCACACTTGCTTCCAGGCGG - Intergenic
1083874068 11:65510903-65510925 CATTTCTAGTTGCTTCCAGGTGG - Intergenic
1084463440 11:69308872-69308894 GTATCCCAGGTGCTGCCTGGCGG - Intronic
1086746812 11:90439028-90439050 CAATTCCAGGTGCTTCCAGTTGG - Intergenic
1090297461 11:125601499-125601521 TAATCCCAGTTACTTTCAGAAGG + Intronic
1091938192 12:4450253-4450275 GATTCCCATTTCCTTCCATGTGG + Intergenic
1094614096 12:32020860-32020882 CAATCCCAGCTAATTCCAGGAGG + Intergenic
1096842027 12:54385531-54385553 GAACCCCTGTTGCTGTCAGGGGG - Intronic
1097169581 12:57105326-57105348 CACTCCCAGTTGCTTCCTGGTGG - Exonic
1099719302 12:86341171-86341193 GACTCCATGTTGCTGCCAGGTGG - Intronic
1100407348 12:94283218-94283240 GAATCCAAGAGGCTTCCTGGAGG + Intronic
1101639321 12:106575913-106575935 GAATCCCGGTTCCTTTCAGTGGG - Intronic
1102549571 12:113681918-113681940 GAATCCCAATGGCCCCCAGGGGG - Intergenic
1103347862 12:120263370-120263392 GACTCCCAGTTGCTTACATCCGG - Intronic
1105985921 13:25567088-25567110 GAATCCCAGTAGCATGTAGGGGG - Intronic
1106872028 13:34031838-34031860 GGTTCCCTGTTGCTTCCAGCAGG - Intergenic
1109406583 13:61908222-61908244 GAATCTCAGTTGCTAGCAGCAGG + Intergenic
1109418420 13:62075575-62075597 GAAACCCAGTAGCTACCAGAGGG - Intergenic
1114764368 14:25353958-25353980 GAATCCCAGTCCTTTCCATGTGG + Intergenic
1115012891 14:28572328-28572350 CAATCCCAGTTGCTGCCATGGGG - Intergenic
1116374418 14:44180482-44180504 GAATACCAGTAGTTTCCATGTGG - Intergenic
1117182961 14:53211353-53211375 TAATCCCAGCTACTTTCAGGAGG + Intergenic
1117195521 14:53336275-53336297 GAATGGCAATTGCTTCTAGGGGG - Intergenic
1118489426 14:66244667-66244689 GACTCCCTGTTACCTCCAGGGGG + Intergenic
1121921143 14:97882789-97882811 GAAGCCCAATTGCTACCGGGGGG - Intergenic
1123450057 15:20354183-20354205 GCATCACAGGTGCTTCCATGTGG - Intergenic
1124205741 15:27718604-27718626 GAATTCCAGTTGCTGCGAGAGGG - Intergenic
1124999525 15:34755352-34755374 GAATTTCAGTTGTCTCCAGGAGG - Intergenic
1129764567 15:78153899-78153921 TAATCCCAGCTACTTTCAGGAGG + Intronic
1130554338 15:84912371-84912393 GAATCCAAGCTGCTTCCTGCTGG + Intronic
1130862215 15:87901096-87901118 GAATCCCAGATGCTGCATGGAGG - Intronic
1137070535 16:35900759-35900781 GAATCCCTGTGGCTTCAAGCAGG + Intergenic
1138132519 16:54493031-54493053 GAAGCCCAGAGGTTTCCAGGGGG + Intergenic
1138211577 16:55167440-55167462 TAATCCCAGCTACTCCCAGGAGG + Intergenic
1140232004 16:73124967-73124989 GAAGCCCAGTGGCTTCCAGTTGG - Intergenic
1141878331 16:86841630-86841652 GAATGGGAGTAGCTTCCAGGGGG + Intergenic
1142654862 17:1384825-1384847 TAATCCCAGCTACTCCCAGGAGG - Intronic
1144632133 17:16879607-16879629 TAAGCTCAGTTGCTTCCAGGTGG + Intergenic
1145208876 17:20998576-20998598 TAAGTCCAGTTGCTTCCAGGCGG - Intergenic
1145797633 17:27665037-27665059 GAAGCCAAGATGATTCCAGGAGG + Intergenic
1145812023 17:27769984-27770006 GAAGCCAAGATGATTCCAGGAGG + Intronic
1146094697 17:29918094-29918116 GAATCCCACTTGAGCCCAGGAGG + Intronic
1146686501 17:34844787-34844809 GAATCCGAGTTCCTGACAGGAGG + Intergenic
1147722381 17:42547127-42547149 GGAGCCCATATGCTTCCAGGAGG - Intergenic
1147723568 17:42553297-42553319 GGAGCCCATATGCTTCCAGGAGG - Intronic
1149425086 17:56547297-56547319 GAATCTCTGGTCCTTCCAGGTGG - Intergenic
1149804771 17:59606006-59606028 GAATCCCCTTTGTTTCCAAGGGG + Intronic
1150899005 17:69249294-69249316 GAATACCTGATTCTTCCAGGAGG + Intronic
1152811261 17:82383843-82383865 AAATTCCAGGTGCTTGCAGGGGG - Intergenic
1157560342 18:48640992-48641014 GAATCCCAGTTGCCGGCAGCTGG - Intronic
1163552334 19:17972559-17972581 GAATCCAAATGGTTTCCAGGAGG - Intronic
1165106324 19:33471658-33471680 GATTCTCTGTTGCTTCCTGGAGG - Intronic
1167949019 19:53011715-53011737 AAATCCCTGTTCCTTCCAGATGG - Intergenic
925003120 2:421940-421962 GAATCACTGTTGCCTCCATGGGG + Intergenic
926192815 2:10741444-10741466 GAGGCCCAGAAGCTTCCAGGGGG - Intronic
926566643 2:14482797-14482819 AAATCTCAGCTGCTTCCATGTGG - Intergenic
926923228 2:17960249-17960271 GTTTCCCAGATGCTTCCATGTGG + Intronic
927637452 2:24826340-24826362 GAATACCAGGTGCAGCCAGGAGG - Intronic
930601108 2:53444226-53444248 GAATCCCTGTTCTCTCCAGGTGG + Intergenic
931814554 2:65887980-65888002 GACTCCCAGTCTCTTCCAGATGG + Intergenic
933970660 2:87467502-87467524 CAATCCCTACTGCTTCCAGGAGG - Intergenic
935121307 2:100185872-100185894 GAATTCCTGCAGCTTCCAGGAGG - Intergenic
935561377 2:104563560-104563582 GAATCCCAGGTACTACCTGGGGG + Intergenic
936350184 2:111706682-111706704 CAGTCCCAGTTCCTTCCAGGTGG - Intergenic
937217208 2:120320426-120320448 GCTCCCCAGTTGCTTCCAGCAGG + Intergenic
937801394 2:126084530-126084552 AGATCACAGTTGGTTCCAGGGGG + Intergenic
942501213 2:176592676-176592698 GAATCTCAGTTACTGACAGGGGG - Intergenic
946496529 2:220201338-220201360 GAAACCCAGTTTCTTCCATTAGG - Intergenic
1168897130 20:1331312-1331334 GGATCCCAGAGGCTTCCTGGAGG - Intronic
1171970363 20:31561046-31561068 AAATGCCAGTGGCTTCCTGGAGG - Intronic
1172240850 20:33411574-33411596 GAATCCCTGTGGCTGCCACGTGG - Intronic
1174239690 20:49123674-49123696 GAATCCCAGTTACTTCCTTGAGG + Intronic
1175508484 20:59504585-59504607 GGACTCCAGTTGCTTACAGGTGG - Intergenic
1176027643 20:62993972-62993994 GAATCCCAGGGGTTTCCAGGTGG + Intergenic
1176166926 20:63679269-63679291 GAATCCCAGTTGCTTCCAGGTGG + Intronic
1178962867 21:37083817-37083839 GACTCCCAAATCCTTCCAGGCGG - Exonic
1182154906 22:28062143-28062165 GAATCTCACTTGAATCCAGGAGG - Intronic
1183547022 22:38459914-38459936 AAGTCCCAGGAGCTTCCAGGGGG + Intergenic
1184608685 22:45588927-45588949 GGATGTCAGGTGCTTCCAGGCGG + Intronic
1185077650 22:48691870-48691892 GGCTCCCAACTGCTTCCAGGAGG + Intronic
1185183661 22:49379453-49379475 GACTCCCACTTGCTTCCTGGAGG + Intergenic
949931810 3:9084450-9084472 GTAGCCCAGTTGCTACCAGCAGG + Intronic
950649914 3:14401033-14401055 GATCCCCAGGTGCTTCCTGGAGG + Intergenic
954844750 3:53545748-53545770 GAATCCCAATTGCTTTGAGAAGG - Intronic
960685032 3:120287087-120287109 GGTTCCCTGTTGCTCCCAGGTGG - Intergenic
960844894 3:121996143-121996165 GAATCCTAGCTTCTTCCAGATGG + Intronic
960991173 3:123312558-123312580 GATTCCCAGTGGCTGGCAGGAGG - Intronic
968229263 3:196995695-196995717 GAATCCCAGAGGCTTCGTGGTGG + Intronic
969387436 4:6863964-6863986 GAATCCCAGTTGATTCCTCCTGG - Exonic
969853736 4:9982629-9982651 GAATCTCAGTTGCCTCCACTAGG + Intronic
971221844 4:24716103-24716125 TAATCCCAGCTGATTCCAGGAGG - Intergenic
975182303 4:71361001-71361023 GAATCCCAGGTACACCCAGGAGG + Intronic
977022721 4:91776401-91776423 GAATCCACGTGGCCTCCAGGTGG - Intergenic
979004161 4:115267879-115267901 GAATTCCTGTTGCTTCCTTGAGG + Intergenic
979179398 4:117707033-117707055 GAACCACAGTTGCTTCTAGTTGG - Intergenic
979531840 4:121776632-121776654 GATTCACAGTGGCTTCCAGATGG - Intergenic
979899351 4:126198413-126198435 AAATCCCCTTTGCTTCCAGCAGG - Intergenic
981719316 4:147785369-147785391 GATTCCCAGTTGCTTTCAAAAGG + Intronic
985858287 5:2448289-2448311 CAATCCCTTTTGCTTCCAGCTGG - Intergenic
987919315 5:24257858-24257880 GAATCTCAGGGTCTTCCAGGAGG + Intergenic
993537350 5:89103278-89103300 CAATGCCAGATGCTTCCATGAGG + Intergenic
994897099 5:105720891-105720913 GACTCTCTGTTGCTCCCAGGTGG - Intergenic
995161257 5:108985727-108985749 GGTCCCCAGTTGCATCCAGGTGG + Intronic
995861789 5:116648555-116648577 TAATCCCAGCTACTTTCAGGAGG - Intergenic
996569571 5:124917781-124917803 TAATCCCAGCTGCTCTCAGGAGG + Intergenic
998360806 5:141585074-141585096 TAATCCCAGCTACTGCCAGGAGG - Intronic
999474587 5:151886920-151886942 GAATCCCAGGTGCTTGGGGGTGG - Intronic
999938337 5:156513217-156513239 GAACCCCAGTTTCTTTCAGCTGG - Intronic
1000978161 5:167787540-167787562 GGATGCCAGGAGCTTCCAGGTGG - Intronic
1000989044 5:167893118-167893140 CAAACCCAGTTACTTACAGGAGG - Intronic
1001875440 5:175196102-175196124 AGATCCCCATTGCTTCCAGGAGG + Intergenic
1003461534 6:6333385-6333407 GAATGCCAGTGGCCTTCAGGAGG + Intergenic
1003861828 6:10329457-10329479 GAATGCCAGTTTGTGCCAGGAGG - Intergenic
1004878182 6:19977469-19977491 GAATACTACTTGCTACCAGGAGG + Intergenic
1007648520 6:43401249-43401271 TAATCCCAGCTACTTCCGGGAGG + Intergenic
1010158704 6:72825955-72825977 CAATCACAGTTGCCTCCATGGGG + Intronic
1011051351 6:83154002-83154024 GGATCCCAGTTTCTTTCAGATGG + Exonic
1015176741 6:130317697-130317719 GTTTTCCAGTTGCTTCCAGTGGG - Intronic
1015963165 6:138671031-138671053 GAGTCCCAGATACTCCCAGGAGG + Intronic
1016103779 6:140136497-140136519 GAACCCCAGTTCCATCCATGTGG - Intergenic
1018862297 6:167720007-167720029 GAAACCCAGCTGGTTCCACGCGG - Intergenic
1019500203 7:1360819-1360841 GAATCCCCGCTGCTCCCAGAGGG - Intergenic
1019575886 7:1737425-1737447 GAATCCCAGCAGATTCCAGCTGG + Intronic
1022994054 7:35736159-35736181 GAATCCCAGTTGCTAAGAGGAGG - Intergenic
1023067313 7:36390382-36390404 GCATTCCAGCTGCTTCCAGCAGG - Intronic
1026384289 7:69830596-69830618 AAATCCAAGGTACTTCCAGGAGG - Intronic
1026611286 7:71862153-71862175 GAATCCCAGCTGCTTACAGCAGG - Intronic
1029411038 7:100410847-100410869 GAATGAAAGTTGCTTCCAGATGG - Intronic
1031142796 7:117963256-117963278 AAATCACAGTTGTTTCCAGTTGG + Intergenic
1033566188 7:142580451-142580473 GAGGTCCAGATGCTTCCAGGAGG + Intergenic
1033938171 7:146615596-146615618 GAGTCTCAGGTGCTTCCAGTTGG - Intronic
1034746820 7:153530241-153530263 GAAGCGCAGAGGCTTCCAGGGGG + Intergenic
1035841998 8:2822963-2822985 GAGTCACTGTTGTTTCCAGGAGG - Intergenic
1038497455 8:28013632-28013654 GAATCCACGTTTCTTCCAGAGGG + Intergenic
1041551339 8:59104815-59104837 GAATCCCTGTTGCTTCCTGGAGG - Intronic
1041813265 8:61936732-61936754 AAATCCCAGTTTCCTCCAGGTGG - Intergenic
1043567990 8:81570030-81570052 GCATGCCAGTTGCTGCCACGGGG + Intergenic
1045656237 8:104390091-104390113 CAGTTCCAGTTGCTTCCAGAAGG - Intronic
1046027318 8:108740322-108740344 GAAGCCTAGTAGCTTCCAGCTGG - Intronic
1049269144 8:141684906-141684928 GAATCCCTGGAGCTTCCTGGAGG - Intergenic
1049306304 8:141906114-141906136 GAATGCCATCTGCTTCCTGGTGG + Intergenic
1049479078 8:142811432-142811454 GAATCCCAGTTCCTTCCGCAGGG + Intergenic
1060660573 9:125402849-125402871 TAATCCCAGCTACTGCCAGGAGG - Intergenic
1187250430 X:17593359-17593381 GAATCCCAGTGGATTCCAGTGGG + Intronic
1192812248 X:74557755-74557777 GAATCACAGTTTTTTCCATGGGG - Intergenic
1193338471 X:80318662-80318684 GTTTCCCAGATCCTTCCAGGAGG - Intergenic
1193739905 X:85204207-85204229 GGCTCCCTGTTGCTCCCAGGTGG + Intergenic
1195473777 X:105261237-105261259 GGCTCCATGTTGCTTCCAGGTGG + Intronic
1195766997 X:108306562-108306584 GAATGCCAGATGTTTGCAGGAGG + Intronic
1197195547 X:123696636-123696658 GAATCCTAGTAGCTTCTAAGGGG - Intronic
1201480451 Y:14432835-14432857 AAATCCCACTTGCTTACAGGGGG - Intergenic
1202027232 Y:20537478-20537500 GCATCCCAGATGCTTTCTGGGGG - Intergenic