ID: 1176166931

View in Genome Browser
Species Human (GRCh38)
Location 20:63679298-63679320
Sequence TGTCCTCAGCGTAATGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176166929_1176166931 -9 Left 1176166929 20:63679284-63679306 CCAGGTGGAGCCACTGTCCTCAG 0: 1
1: 0
2: 2
3: 31
4: 294
Right 1176166931 20:63679298-63679320 TGTCCTCAGCGTAATGCTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1176166928_1176166931 1 Left 1176166928 20:63679274-63679296 CCAGTTGCTTCCAGGTGGAGCCA 0: 1
1: 0
2: 0
3: 15
4: 209
Right 1176166931 20:63679298-63679320 TGTCCTCAGCGTAATGCTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1176166924_1176166931 17 Left 1176166924 20:63679258-63679280 CCTGGTCGGGGGAATCCCAGTTG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1176166931 20:63679298-63679320 TGTCCTCAGCGTAATGCTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1176166927_1176166931 2 Left 1176166927 20:63679273-63679295 CCCAGTTGCTTCCAGGTGGAGCC 0: 1
1: 0
2: 1
3: 24
4: 169
Right 1176166931 20:63679298-63679320 TGTCCTCAGCGTAATGCTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1176166923_1176166931 21 Left 1176166923 20:63679254-63679276 CCGACCTGGTCGGGGGAATCCCA 0: 1
1: 0
2: 1
3: 9
4: 62
Right 1176166931 20:63679298-63679320 TGTCCTCAGCGTAATGCTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1176166920_1176166931 29 Left 1176166920 20:63679246-63679268 CCTGAGCGCCGACCTGGTCGGGG 0: 1
1: 0
2: 2
3: 4
4: 69
Right 1176166931 20:63679298-63679320 TGTCCTCAGCGTAATGCTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176166931 Original CRISPR TGTCCTCAGCGTAATGCTCA AGG Intronic
900393948 1:2445495-2445517 TGACCCCAGCCTCATGCTCAGGG - Intronic
903356529 1:22751530-22751552 TGTCCTCAGCCTGCTGGTCAGGG + Intronic
904273407 1:29365006-29365028 TGCCCTTAGCCTAGTGCTCAGGG + Intergenic
907965139 1:59321699-59321721 TGTCCTCGGAGGACTGCTCATGG - Exonic
908127022 1:61042474-61042496 TGACTTCAGAGTAATCCTCAAGG - Intronic
908839665 1:68266220-68266242 TGTCATCATCTTAATGGTCAAGG - Intergenic
921171827 1:212557547-212557569 TTTCCTCAATGTAATGCTTATGG - Intergenic
1066422295 10:35274466-35274488 TGACATCAGGGTAATGCTTAGGG - Intronic
1067526089 10:47039486-47039508 TGGCCTCATCGTCATGCTCATGG + Intergenic
1074175368 10:110995434-110995456 TGTCCTCACTGTTGTGCTCATGG - Intronic
1076774786 10:132689177-132689199 TGTCCTCAGCTGAAAGCACAGGG - Intronic
1078584728 11:12573338-12573360 TGTCCTCAGCTGAAGACTCAAGG - Intergenic
1078944823 11:16052986-16053008 AGTACTCAGCTAAATGCTCAGGG + Intronic
1080227785 11:29979458-29979480 TGTCCTAAACTTAATTCTCAGGG + Intergenic
1084572143 11:69966255-69966277 TGTCCACAGCTAAATGATCATGG + Intergenic
1088594223 11:111427921-111427943 TGTCCTCAGTCTAATGTTCGGGG - Intronic
1090227301 11:125079429-125079451 TGACCACAGCGTTGTGCTCAAGG - Intronic
1102423693 12:112824178-112824200 TGGCCTCAGCCCAATCCTCAGGG + Intronic
1110433130 13:75449156-75449178 TGTCCTCAGGGATATGCTCTAGG + Intronic
1111609585 13:90585885-90585907 AGTGCTCAGCTTAAGGCTCAAGG + Intergenic
1112998869 13:105608136-105608158 TGTCCTCAGCATAATAATCTAGG - Intergenic
1124179523 15:27459268-27459290 TGTGCTCACCTTGATGCTCAGGG - Intronic
1125004615 15:34803125-34803147 TGTCCTTTGGGTCATGCTCAAGG - Intergenic
1129237594 15:74233073-74233095 TGTTCTCAGGGTCCTGCTCAAGG + Intergenic
1133534030 16:6683152-6683174 AGTCCTCTGTGTAATGCCCAAGG - Intronic
1134813752 16:17188939-17188961 TGCCCTCATCGTAGTGGTCAAGG - Intronic
1139035726 16:62944011-62944033 TGTCCCCAGCCTCATGCTGAAGG + Intergenic
1143339233 17:6196123-6196145 TGTCCTCATCGTCAAGCTGAGGG - Intergenic
1151831977 17:76558139-76558161 TGTGCTGAGCGTCATGCCCAGGG + Intergenic
1156499995 18:37551502-37551524 TGTCCTCAGCTTCATCCCCATGG + Intronic
1157474314 18:48011666-48011688 TGTCCTCAGGGCAATGTTCTGGG + Intergenic
1166341268 19:42138667-42138689 TATCCTCATCCTAATCCTCATGG - Intronic
928796455 2:35027623-35027645 TGTCCTTGCCTTAATGCTCAGGG - Intergenic
929794893 2:45051556-45051578 TTCCCTCAGGGTAATGGTCATGG - Intergenic
932763148 2:74453168-74453190 TGTCATCAGCGTAATACTGGAGG - Intergenic
947522708 2:230860884-230860906 TGTCCTCAGAGTTCTTCTCAAGG - Intergenic
1172450799 20:35021207-35021229 TGTCCTCTGCGTGCTGCTGATGG - Exonic
1176166931 20:63679298-63679320 TGTCCTCAGCGTAATGCTCAAGG + Intronic
1178259060 21:31082209-31082231 TGTCTTCAGTGAAATCCTCAAGG + Intergenic
1183687047 22:39367192-39367214 TGTCCTCAGCCTCTTGCACAGGG + Intronic
1184107230 22:42375024-42375046 TGTCCTAAGGGTAATGAACAGGG + Intergenic
1185019477 22:48365788-48365810 AATCCTCACAGTAATGCTCAGGG - Intergenic
1185051057 22:48554187-48554209 TGTCCCCAGGGAAATGCTCCCGG + Intronic
1185163181 22:49241770-49241792 TGTCCACGGTGTAATGGTCACGG + Intergenic
1185322238 22:50206907-50206929 TGTCCCCAGCCTCAGGCTCAGGG - Intronic
953649398 3:44786950-44786972 TGTCCTGAGCTGAATGCTCAAGG - Intronic
953740725 3:45536558-45536580 TGTCCTCAGGGCACTGCTCCTGG + Intronic
957857490 3:85896518-85896540 TGTACACAGCATAATTCTCAGGG - Intronic
963037110 3:141040299-141040321 TGTACTCAGCTGAATCCTCAAGG - Intergenic
970514048 4:16810068-16810090 TGTTCTCAGCCTAATGTTCATGG + Intronic
973631557 4:52825184-52825206 TGTCCTCAGCCCACTGCTCCTGG - Intergenic
991592942 5:68273192-68273214 TCTACTCAGAGTAATGCTCCAGG - Intronic
995241979 5:109895648-109895670 AATCCTCAGCGTAATGACCAAGG + Intergenic
997407465 5:133662950-133662972 TTAACTCAGGGTAATGCTCATGG - Intergenic
998057758 5:139093509-139093531 TATCCTCAGCGCAATGGCCAGGG - Intronic
1001029242 5:168250009-168250031 TGTCCTCAGGGAAATGAGCAAGG + Intronic
1009462029 6:63925142-63925164 TGTCTTTAGCTTAATTCTCAGGG - Intronic
1014927257 6:127287701-127287723 TGTCTTCAGCTCCATGCTCAAGG + Exonic
1017494926 6:154975186-154975208 TGTCTTCAGGGTCGTGCTCAAGG - Intronic
1017765926 6:157607171-157607193 GGGCCTCAGCGGAATGCTGAGGG + Intronic
1019003382 6:168775360-168775382 TGTCCTCAGGGTAATTTCCAGGG + Intergenic
1020106814 7:5426024-5426046 AGACCTCTGCGTAAGGCTCAAGG - Intergenic
1023622870 7:42090718-42090740 TGTCCTCAGCTTAACCTTCAGGG + Intronic
1024797639 7:53037169-53037191 TGTCCTCTGCTTAACACTCATGG - Intergenic
1031993666 7:128213989-128214011 TATCTTCAGTGAAATGCTCATGG - Intergenic
1034489442 7:151385504-151385526 TGTCCACATCCTAATCCTCAGGG - Intronic
1037677356 8:21063176-21063198 TGTCTTCACTGTAATTCTCAAGG + Intergenic
1038757908 8:30359071-30359093 TGTCCTCAGCTAAACACTCAAGG + Intergenic
1042454784 8:68988580-68988602 TGACCTCAGAGCAATGTTCATGG + Intergenic
1049011601 8:139891205-139891227 TATCCTCATTTTAATGCTCAAGG + Intronic
1049433351 8:142575335-142575357 TGGCATCAGCCTCATGCTCAGGG + Intergenic
1050426680 9:5518580-5518602 TTTCCACAGGGAAATGCTCATGG - Intronic
1050935997 9:11395806-11395828 TGTCCTTAGTATAATGTTCATGG + Intergenic
1056741669 9:89261532-89261554 AGTGCTCAGCTTAATGCTGAGGG - Intergenic
1058777816 9:108302495-108302517 TGTCATCAGGGAAATGATCAGGG - Intergenic
1059551230 9:115231506-115231528 TGCCCTCAGGGTACTGCTGAGGG + Intronic
1186871381 X:13777303-13777325 TTTTCTCAGCCTAATACTCAAGG + Intronic
1187969845 X:24648107-24648129 TGCTCTCAGCCAAATGCTCATGG + Intronic
1189931122 X:46012254-46012276 AATCCTAAGTGTAATGCTCAAGG + Intergenic
1194377732 X:93155814-93155836 TGTCCTAAAAGAAATGCTCAAGG + Intergenic
1198033779 X:132781265-132781287 TGTCCTAAGTGTAATATTCAAGG + Intronic
1198770321 X:140123983-140124005 TGTCCTGTGAGAAATGCTCAAGG - Intergenic
1198984316 X:142431783-142431805 TGTCCTCACAGTAATGCTGGGGG + Intergenic