ID: 1176166933

View in Genome Browser
Species Human (GRCh38)
Location 20:63679304-63679326
Sequence CAGCGTAATGCTCAAGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176166929_1176166933 -3 Left 1176166929 20:63679284-63679306 CCAGGTGGAGCCACTGTCCTCAG 0: 1
1: 0
2: 2
3: 31
4: 294
Right 1176166933 20:63679304-63679326 CAGCGTAATGCTCAAGGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 66
1176166927_1176166933 8 Left 1176166927 20:63679273-63679295 CCCAGTTGCTTCCAGGTGGAGCC 0: 1
1: 0
2: 1
3: 24
4: 169
Right 1176166933 20:63679304-63679326 CAGCGTAATGCTCAAGGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 66
1176166924_1176166933 23 Left 1176166924 20:63679258-63679280 CCTGGTCGGGGGAATCCCAGTTG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1176166933 20:63679304-63679326 CAGCGTAATGCTCAAGGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 66
1176166928_1176166933 7 Left 1176166928 20:63679274-63679296 CCAGTTGCTTCCAGGTGGAGCCA 0: 1
1: 0
2: 0
3: 15
4: 209
Right 1176166933 20:63679304-63679326 CAGCGTAATGCTCAAGGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 66
1176166923_1176166933 27 Left 1176166923 20:63679254-63679276 CCGACCTGGTCGGGGGAATCCCA 0: 1
1: 0
2: 1
3: 9
4: 62
Right 1176166933 20:63679304-63679326 CAGCGTAATGCTCAAGGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176166933 Original CRISPR CAGCGTAATGCTCAAGGCTC TGG Intronic
909136120 1:71802591-71802613 CAGGATAATGCTTAAGGCTATGG + Intronic
916409848 1:164535766-164535788 GAGCATCATGCTCAAAGCTCTGG - Intergenic
923766206 1:236894518-236894540 CAGCATCATGGTCAAGGCGCTGG + Exonic
1071565421 10:86669128-86669150 TAGGGAAATGCTCAAGGCTTGGG - Intronic
1071993523 10:91124690-91124712 CAGCGTGATTCTGCAGGCTCTGG - Intergenic
1073621335 10:105052095-105052117 CAGCATAATCATCAAGGGTCCGG - Intronic
1077190845 11:1255476-1255498 CTGCGTAAGCCTCCAGGCTCTGG - Exonic
1078500210 11:11866315-11866337 CAGGATAAGACTCAAGGCTCAGG + Intronic
1081017923 11:37906670-37906692 CTCCGTAATGGTGAAGGCTCAGG + Intergenic
1084421077 11:69060895-69060917 CAGAGAACTGCTCAGGGCTCTGG - Intronic
1089707104 11:120286369-120286391 CAGCATAACACTCAATGCTCAGG + Intronic
1097173565 12:57130098-57130120 CAGCTTAATGCTTAAAGCTTGGG - Intronic
1097783293 12:63731684-63731706 AATCCTAATGCTCAAGGCACTGG + Intergenic
1103517769 12:121518570-121518592 CAGTGTGATGCTCAGGGGTCCGG + Intronic
1111176949 13:84607346-84607368 CAGTGTAAAGCACAAGGCCCTGG + Intergenic
1111504221 13:89165087-89165109 CAAGGTATTGCTCTAGGCTCTGG + Intergenic
1112283631 13:98084561-98084583 CAGTGTAGTGCTCAAGGTTCTGG + Intergenic
1118412727 14:65499380-65499402 CAGAGTACAGCTCAAGTCTCAGG + Intronic
1120009696 14:79399670-79399692 AAGCGTTGTGCTCAAGGCTATGG + Intronic
1120604538 14:86558160-86558182 AAGTGTAGTGCTCAGGGCTCTGG - Intergenic
1132359262 15:101198931-101198953 CAGCATAAAGGTGAAGGCTCTGG - Intronic
1133899032 16:9955920-9955942 CAGCGTGATGCCCAAGCCCCTGG - Intronic
1139210878 16:65075489-65075511 CACACTAATGCTCAAGGCTGTGG + Intronic
1142079704 16:88142559-88142581 CAGCGTGAGCCTCAAGTCTCAGG + Intergenic
1148379958 17:47189164-47189186 CACCGTCATCCTCGAGGCTCAGG + Exonic
1149979118 17:61295421-61295443 CAGCGTAATCCCCAAGGCAAAGG + Intronic
1151185048 17:72357742-72357764 CATAGAAAGGCTCAAGGCTCAGG - Intergenic
1154564890 18:15881630-15881652 CAACGAAATCCTCAAGGCTAGGG - Intergenic
1154794998 18:19036319-19036341 CAACGAAATCCTCAAGGCTAGGG - Intergenic
1154806302 18:19191630-19191652 CAACGAAATCCTCAAGGCTAGGG - Intergenic
1154810787 18:19253199-19253221 CAACGAAATCCTCAAGGCTAGGG - Intergenic
1160291233 18:77595873-77595895 CAGTGTTTTGCTCAAGGCACTGG - Intergenic
1167240101 19:48338559-48338581 CTGCCTCATCCTCAAGGCTCAGG + Intronic
1167771239 19:51520444-51520466 CAGCGGCATGATCACGGCTCAGG + Intronic
929046470 2:37795455-37795477 CAGGGTAATAGTCAAGGCCCAGG - Intergenic
945512551 2:210720668-210720690 CAGAGTAATGGTTAAGGCTGGGG + Intergenic
1176166933 20:63679304-63679326 CAGCGTAATGCTCAAGGCTCTGG + Intronic
1177097310 21:16852369-16852391 CAGAGTAATGATAAGGGCTCAGG + Intergenic
1184341259 22:43887314-43887336 CAGAGGGATGCTCAAGGCTGTGG - Intronic
1185143052 22:49114066-49114088 CAGGGAAATGCCCAAGGCCCTGG + Intergenic
952822981 3:37500815-37500837 CAGGGGAATTCTGAAGGCTCAGG + Intronic
955837774 3:63076485-63076507 CAGAGAAATGCTCAAAGGTCTGG - Intergenic
958526726 3:95270023-95270045 CAGCCTAATACTCAAGTGTCTGG - Intergenic
961438223 3:126934028-126934050 CAGGGAAATGCTCAAGGCTGAGG - Intronic
962409181 3:135126564-135126586 CAGCCCCATGCTCAAGGCTAAGG + Intronic
966843116 3:184105563-184105585 CATCCTAAAGCTCAGGGCTCTGG + Intronic
967969249 3:194986960-194986982 CAGCGTCAAGCCCACGGCTCTGG - Intergenic
970196753 4:13558679-13558701 CAGTGTGATGCTGAAGGCTCTGG + Intergenic
971623376 4:28886302-28886324 CAGAATAACACTCAAGGCTCTGG - Intergenic
981148986 4:141359357-141359379 AAAGGTAATGCTGAAGGCTCAGG + Intergenic
983376781 4:166939741-166939763 CAGTGTTATGATCAAGACTCTGG - Intronic
984647617 4:182236224-182236246 CAGTGTAAAGCACAAAGCTCAGG - Intronic
988508818 5:31848245-31848267 CAGCATGGTGGTCAAGGCTCTGG - Intronic
997212722 5:132086923-132086945 CAGGGTATGGCTCGAGGCTCTGG - Intergenic
997629131 5:135353423-135353445 CAGCCTAGTGCTCAAGGATGAGG - Intronic
1002183251 5:177442221-177442243 CAGCACAGTGCTGAAGGCTCAGG - Exonic
1004971430 6:20914556-20914578 CAGAGTACTGTTCTAGGCTCTGG - Intronic
1006815851 6:36849323-36849345 CTGCGTAAGGCTCAAGTGTCAGG + Intergenic
1013730546 6:113159926-113159948 CAGCATAATGTTCAGGGTTCTGG + Intergenic
1032699473 7:134366187-134366209 AAGCCAAATGCTTAAGGCTCTGG - Intergenic
1046897633 8:119489677-119489699 AAGAGTAATACTCAAGGCTGTGG + Intergenic
1048285317 8:133136926-133136948 CAGGGTAAGGCTCCAGGATCTGG + Intergenic
1050052352 9:1616412-1616434 CACCCCAAGGCTCAAGGCTCAGG + Intergenic
1052175206 9:25452880-25452902 CAGTGTAGTGCACAAAGCTCTGG - Intergenic
1057700921 9:97362540-97362562 CACCACAATGCTCATGGCTCTGG + Intronic
1057855188 9:98596087-98596109 TAGCTTAATGGTCAAGGGTCTGG + Intronic
1062364074 9:136200691-136200713 CCGCTTCATCCTCAAGGCTCTGG - Exonic
1195943316 X:110182772-110182794 CAGTGAAATGCCCATGGCTCAGG - Intergenic
1199504246 X:148543527-148543549 CAGGGTAATTGTCAAGGCTGGGG + Intronic
1200206041 X:154317057-154317079 CAGCTTAATGAGCCAGGCTCGGG - Intronic