ID: 1176169526

View in Genome Browser
Species Human (GRCh38)
Location 20:63690653-63690675
Sequence TTGGGGGGAGTCTCAGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176169526_1176169537 3 Left 1176169526 20:63690653-63690675 CCCGAGGCTGAGACTCCCCCCAA 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1176169537 20:63690679-63690701 CAGGGAGGACACCCACAGGCAGG 0: 1
1: 0
2: 2
3: 30
4: 322
1176169526_1176169540 17 Left 1176169526 20:63690653-63690675 CCCGAGGCTGAGACTCCCCCCAA 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1176169540 20:63690693-63690715 ACAGGCAGGACCCCAAGTGCTGG 0: 1
1: 1
2: 0
3: 16
4: 267
1176169526_1176169541 18 Left 1176169526 20:63690653-63690675 CCCGAGGCTGAGACTCCCCCCAA 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1176169541 20:63690694-63690716 CAGGCAGGACCCCAAGTGCTGGG 0: 1
1: 1
2: 2
3: 28
4: 547
1176169526_1176169536 -1 Left 1176169526 20:63690653-63690675 CCCGAGGCTGAGACTCCCCCCAA 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1176169536 20:63690675-63690697 ATAGCAGGGAGGACACCCACAGG 0: 1
1: 0
2: 1
3: 31
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176169526 Original CRISPR TTGGGGGGAGTCTCAGCCTC GGG (reversed) Intronic
900423819 1:2567259-2567281 ATGGGGGGAGGCCCAGCCTGGGG - Intergenic
901942930 1:12677610-12677632 TTGCTGGGAGTCTCTGGCTCAGG + Intergenic
903384522 1:22917657-22917679 TTGGGGGGAAACTGAGGCTCAGG + Intergenic
906126554 1:43430654-43430676 TTGGGGGGCGACTCACCCACTGG + Exonic
907170890 1:52463572-52463594 TTGGGGTGAGGCCCAGCTTCTGG - Intronic
912690053 1:111798108-111798130 TTGGGGTGAGGCTCAGGCTTGGG + Intronic
912798572 1:112707113-112707135 CTGGGGTCAGTCTGAGCCTCCGG - Exonic
921832172 1:219740338-219740360 TGGGAGGGAATCTCAGCCTTTGG - Intronic
922181789 1:223241649-223241671 TTGGGGGGACTTTCAGTTTCTGG - Intronic
1063313379 10:4978100-4978122 GTGGGTGGAGTTTCACCCTCTGG + Exonic
1063314573 10:4989617-4989639 GTGGGTGGAGTTTCACCCTCTGG - Exonic
1067552434 10:47245187-47245209 GTGGGGGGAGGCTCAGCAGCTGG + Intergenic
1067788935 10:49273034-49273056 GTGGGCGGCGTCTCAGCCTCGGG + Intergenic
1070162864 10:73876256-73876278 TTGGGGCTGGCCTCAGCCTCAGG - Intergenic
1070607111 10:77906550-77906572 TTGGGAGGAGCCTCAGCCAGTGG - Intronic
1071501056 10:86204670-86204692 TTGATGGGAGCCTCAGCCGCTGG - Intronic
1073117661 10:101100792-101100814 CTGGGGGCAGCCTCAGCATCAGG - Intronic
1074127323 10:110539470-110539492 CTGGGGGGAGTCACAGGCTGTGG + Intergenic
1074365049 10:112850999-112851021 TTGGGAGGAGCTTCAGTCTCAGG - Intergenic
1074956710 10:118397747-118397769 ATGGTGGGTGTCTCGGCCTCTGG + Intergenic
1075119528 10:119654374-119654396 TTGGGGGAGGACTCAGCTTCAGG + Intronic
1075336079 10:121609646-121609668 TTTGGGGCAGCCTCCGCCTCTGG + Intergenic
1077484716 11:2833431-2833453 TGTGAGGGAGTCTCAGCCTTAGG + Intronic
1080063342 11:27981002-27981024 TTGAGGTGTGTCTGAGCCTCAGG - Intergenic
1080223875 11:29937705-29937727 TTTGGGGCAGTGCCAGCCTCTGG + Intergenic
1081866208 11:46361996-46362018 CTGTGGTGAGTCTCAGCCTGGGG + Intronic
1083232618 11:61332845-61332867 TTGGGGGGAGCCGCGGCCTAGGG - Intronic
1083259433 11:61515207-61515229 CTGAGGGGAGGCTCAGCCCCGGG + Intergenic
1083273607 11:61584831-61584853 TTGGGGAGGGCCTGAGCCTCTGG + Intergenic
1083597838 11:63927688-63927710 TTGCTGGGAGAATCAGCCTCAGG + Intergenic
1084266550 11:68008190-68008212 TTGGGGGGAGCCTCACTCCCAGG + Intergenic
1084363593 11:68684342-68684364 TTTGGGGGAGTCTCTCCCGCGGG + Intronic
1090719739 11:129460311-129460333 TTGGGAGGGGTGCCAGCCTCTGG + Intergenic
1091501633 12:1023326-1023348 TTGGGAGGACTCTCAGGCTCTGG + Intronic
1092276846 12:7067943-7067965 TTCAGGGGAGCATCAGCCTCAGG + Intronic
1095671889 12:44871208-44871230 GTTAGGGGAGTCTCAGGCTCAGG - Intronic
1096694168 12:53338287-53338309 TGGGGGGGAGTCTGAGACTGAGG + Intronic
1096760567 12:53838745-53838767 CTGGGTGGAGTCTCTTCCTCTGG - Intergenic
1098479509 12:70942678-70942700 TTGGGAGTAATATCAGCCTCTGG + Intergenic
1103564333 12:121807949-121807971 TTTGGGGGAGTCTCAGCCCCAGG + Intronic
1103948461 12:124539675-124539697 TGGGGGCAAGTCTCAGCCTGTGG - Intronic
1104081723 12:125435405-125435427 TTGGGGGCCGTCCCAGCCCCGGG - Intronic
1104800754 12:131554023-131554045 CCGTGGGGAGACTCAGCCTCTGG + Intergenic
1106005468 13:25766029-25766051 TAAGGAGGAGTCGCAGCCTCAGG + Intronic
1113142912 13:107174772-107174794 GCTGGGGGAGTCTCAGCTTCAGG + Intronic
1113793464 13:113042901-113042923 TGGGGTGGAATTTCAGCCTCTGG - Intronic
1114550333 14:23529138-23529160 CTGAGGGGATTCCCAGCCTCTGG - Intronic
1115443256 14:33460501-33460523 TTGGGAAGAGTCACAGCTTCAGG - Intronic
1118458785 14:65969151-65969173 TAGAGGGGAGCCACAGCCTCAGG - Intronic
1119141138 14:72268446-72268468 TTGGGAGGTGTCTCAGCCTGAGG + Intronic
1119546072 14:75472350-75472372 TCATGGGGAGGCTCAGCCTCAGG - Intronic
1120203502 14:81563340-81563362 TTTGGAGGATTTTCAGCCTCAGG + Intergenic
1122418524 14:101561427-101561449 TTGGCGGGAGACTCCACCTCCGG - Exonic
1122784666 14:104158138-104158160 TTGGGGGGCATCTCATCCTCGGG + Intronic
1123010687 14:105348227-105348249 TGGGAGGGAGGCTCACCCTCAGG + Intronic
1127343526 15:58070000-58070022 TTAGGGGCTGTTTCAGCCTCAGG + Intronic
1128784692 15:70385994-70386016 TGGGGGTGGGTCTCTGCCTCTGG - Intergenic
1129202317 15:74010714-74010736 TTGTGGAGAGTTTCAGCCTATGG + Intronic
1132840743 16:1977480-1977502 GTGGGGAGAGGCTCAGCGTCAGG - Intronic
1134521421 16:14920731-14920753 GTGGGGGGAGTCTGGGCTTCAGG + Intronic
1134709092 16:16319382-16319404 GTGGGGGGAGTCTGGGCTTCAGG + Intergenic
1134716301 16:16359411-16359433 GTGGGGGGAGTCTGGGCTTCAGG + Intergenic
1134950513 16:18349263-18349285 GTGGGGGGAGTCTGGGCTTCAGG - Intergenic
1134958449 16:18392748-18392770 GTGGGGGGAGTCTGGGCTTCAGG - Intergenic
1137354852 16:47751544-47751566 TTACGTGAAGTCTCAGCCTCTGG + Intergenic
1137440387 16:48493883-48493905 TTGGGGGGAGTGTTAGACTTAGG - Intergenic
1137911644 16:52383901-52383923 GAAGGGGGAGTTTCAGCCTCTGG - Intergenic
1138416840 16:56876490-56876512 TTGGGTGGAGTCTCCACCCCAGG - Intronic
1142804976 17:2366744-2366766 CTTGGTGGAGTTTCAGCCTCTGG - Intronic
1143453242 17:7049359-7049381 TTTGGAGTAGTATCAGCCTCTGG - Intergenic
1143497521 17:7321001-7321023 TTGGGTGGAGGCTCACACTCAGG - Intronic
1143627675 17:8120645-8120667 TTGGGGGGTGTTTCCGGCTCAGG - Exonic
1143755228 17:9062142-9062164 TTGTTGGCAGTCTGAGCCTCGGG - Intronic
1144829138 17:18121903-18121925 TTGGGGGGAGTGACATCCTTGGG - Exonic
1147475092 17:40703443-40703465 TTTGGGGGAGCTTCAGGCTCTGG - Exonic
1148332428 17:46820439-46820461 TCGGGGGGAGGCTGAGCCACCGG + Intronic
1149638339 17:58187337-58187359 TTGAGGGAAGTATCAGCATCAGG + Intergenic
1151664231 17:75536260-75536282 TTGGGGGGCTCCTCAGCCTGTGG + Intronic
1152241735 17:79164582-79164604 TTGGTGGGAGGCCCAGCGTCAGG + Intronic
1152244476 17:79177926-79177948 TTGGGAGGAGCCCCAGTCTCTGG + Intronic
1152613133 17:81325400-81325422 TAGAGGGGAGTCTCAGACTGTGG - Intronic
1152714257 17:81891107-81891129 CTGGGAAGGGTCTCAGCCTCCGG + Intronic
1155933648 18:31731959-31731981 TTTGGGAGAGTCTTAGACTCCGG + Intergenic
1156460435 18:37318685-37318707 TTGGGGCGAGTGTTAGCCACAGG + Intronic
1159506929 18:69350783-69350805 TTAGGGGGAATATCAGCTTCAGG - Intergenic
1160838838 19:1137246-1137268 GTGGGGGGAGGCTCAGGCTGGGG + Intronic
1160839025 19:1137689-1137711 GTGGGGGGAGGCTCAGGCTGGGG + Intronic
1160839079 19:1137814-1137836 GTGGGGGGAGGCTCAGGCTGGGG + Intronic
1160839156 19:1137993-1138015 GTGGGGGGAGGCTCAGGCTGGGG + Intronic
1160839222 19:1138145-1138167 GTGGGGGGAGGCTCAGGCTGGGG + Intronic
1161762874 19:6187443-6187465 TTGGGGGAAGTCTCTGCAGCCGG + Intronic
1162729844 19:12711662-12711684 TTGGGGGGAGGCACAGCTTGGGG + Intronic
1162924969 19:13926378-13926400 TTCGGGGGTGTCTCAGCTCCTGG - Intronic
1165117445 19:33537418-33537440 TTGGGCTGAGTCTCAGCAGCTGG - Intergenic
1166307163 19:41941255-41941277 TTTGGGGGAATCTCAGTCTAGGG - Intergenic
1167334264 19:48874866-48874888 TTTAGGGGAGTCTCAGGGTCCGG - Exonic
926326434 2:11788209-11788231 GTGGGGGGAGCCTCTGCCTAGGG + Intronic
926772023 2:16386733-16386755 TTAGGTTGAGTGTCAGCCTCTGG - Intergenic
927614769 2:24581588-24581610 TTGGGGGGAGTCTGGGCCTATGG + Intronic
927890393 2:26744437-26744459 GTGGGAGGAGTGTCTGCCTCAGG - Intergenic
928366247 2:30705720-30705742 GTGGGGGAAGCCACAGCCTCAGG - Intergenic
932497884 2:72155822-72155844 TGGGCAGGAGTCTCAGCCTCAGG - Intergenic
933812098 2:86039211-86039233 TTGGTGGGAATCTGAGCCTAGGG + Intronic
942516137 2:176755303-176755325 CTGGGGAGAGTCTGAGCTTCTGG + Intergenic
943106140 2:183546786-183546808 TTGGGGGGAGGCTCAGGCATGGG + Intergenic
946176097 2:217922734-217922756 TTAGGGGGTGCCTCTGCCTCGGG - Intronic
949052313 2:241903809-241903831 CTGGGGGGAGTCTGAGCTGCTGG - Intergenic
1172502669 20:35437913-35437935 GTTTGGGGAGTCTCATCCTCTGG + Exonic
1173334072 20:42098956-42098978 TTTGGGAGAATCTCGGCCTCAGG - Intronic
1173497216 20:43528472-43528494 CTGAGGGGAGGCTCAGTCTCAGG - Intronic
1176117344 20:63438838-63438860 TTGGGGGGTGTGTGAGTCTCTGG - Intronic
1176169526 20:63690653-63690675 TTGGGGGGAGTCTCAGCCTCGGG - Intronic
1178992588 21:37367575-37367597 CTCCGGTGAGTCTCAGCCTCGGG - Intronic
1179930826 21:44569859-44569881 GTGGGGGGATTCTGTGCCTCAGG + Intronic
1180132218 21:45834101-45834123 TCGGTGGCAGTCTCAGCCTGTGG - Intronic
1180193542 21:46180852-46180874 TTGGGAGGAGCCTCAACCTGAGG - Intronic
1181586903 22:23857585-23857607 TGGGGGGGAGTCGCCGCCGCGGG - Intronic
1181813543 22:25420539-25420561 TTGGGGGGATGTTCAGGCTCAGG + Intergenic
1181831465 22:25564260-25564282 TTGGGGGGATGTTCAGGCTCAGG + Intergenic
1182033513 22:27179582-27179604 TTGGGGGGTCTCTCAACCGCAGG - Intergenic
1183986978 22:41575397-41575419 TTGGGGAGCCTCTCAGCCTCTGG + Exonic
1185030199 22:48438771-48438793 TTGGGGGTAGTCACAGCATCAGG + Intergenic
952923798 3:38307185-38307207 CTGGGATGAGTCTCAGTCTCTGG + Intronic
953576815 3:44119440-44119462 TTGGGAGCAGCCTCAGCTTCGGG + Intergenic
954939835 3:54361699-54361721 TTGGGTGGGGTCTGAGCCTCAGG + Intronic
959392295 3:105791268-105791290 TTTGGCGGAGTCTCAGCCCCTGG + Intronic
960056567 3:113280070-113280092 TTCGGGGGAGTCTAATCCCCAGG - Intronic
962628293 3:137249441-137249463 TTTGTGGGAGTCTCAGATTCAGG + Intergenic
970484206 4:16507989-16508011 TAAGGGGGAGGATCAGCCTCTGG - Intronic
976040205 4:80875144-80875166 TTGGGGTGAGATTGAGCCTCTGG - Intronic
976709932 4:88059151-88059173 TTCCGGGGAGACACAGCCTCTGG + Intronic
981169017 4:141599484-141599506 TAGGTGGGAGTCTTAGCCCCTGG + Intergenic
981550015 4:145934573-145934595 CTGGGGTGAGCCTCAGCCCCTGG - Intronic
986454304 5:7900258-7900280 TTGGGGAGAGTCACAGGCACAGG - Exonic
990088753 5:52013774-52013796 TTGGGTGGACTCTTAGGCTCAGG - Intronic
994756388 5:103798673-103798695 TTGGGGGAAGTTTCAGACTGGGG + Intergenic
997234858 5:132266908-132266930 TTGGTGGCAGTCTCAGGCTGTGG + Intronic
997235369 5:132269335-132269357 TGGGGGTGGGGCTCAGCCTCCGG - Intronic
997694016 5:135847330-135847352 TTGGTGGGAGTAGCAGCCTCTGG + Intronic
999313477 5:150568896-150568918 GTGGGGGGAGTCCCAGGCTTGGG + Intergenic
1001933148 5:175687215-175687237 TTGGTGGGAATATCAACCTCTGG - Intergenic
1002607030 5:180389582-180389604 TGGGAGGGTCTCTCAGCCTCAGG + Intergenic
1002769787 6:281173-281195 CTGGGAGGAGTATCAGCTTCTGG + Intergenic
1006150184 6:31982915-31982937 GCGGGGTGAGTCTCAGCCCCAGG + Exonic
1006156485 6:32015653-32015675 GCGGGGTGAGTCTCAGCCCCAGG + Exonic
1006403400 6:33830743-33830765 CTGGCGGGAGCCTCACCCTCTGG + Intergenic
1006787181 6:36676353-36676375 ATGGAGGGAGGCTCAGCCTGGGG - Intergenic
1012169797 6:96003047-96003069 TTGGTGGGAGGCTCAGCGTGGGG - Intergenic
1016434510 6:144022055-144022077 TTTTGGTGATTCTCAGCCTCTGG - Intronic
1016801836 6:148176746-148176768 TTTGTGGGAGTTTCACCCTCAGG - Intergenic
1017260874 6:152385154-152385176 TCTGGGGGAGTTTCAGACTCTGG - Intronic
1017810683 6:157981675-157981697 CTGCGGGGAGCCTCAGCCCCGGG + Intergenic
1018033622 6:159863907-159863929 GGGGAGGGAGCCTCAGCCTCAGG - Intergenic
1019148506 6:169988875-169988897 TTGTGGGGAGGCTGAGCCTGGGG - Intergenic
1019324696 7:432356-432378 TGGCGGTGAGGCTCAGCCTCGGG + Intergenic
1019933152 7:4236819-4236841 TTGGGGGGTGTCCCAGCACCAGG + Intronic
1022740410 7:33114644-33114666 TTGGGGAAAATCCCAGCCTCTGG + Intergenic
1023515447 7:40997033-40997055 CTTGGGGCAGGCTCAGCCTCAGG - Intergenic
1024241982 7:47442796-47442818 TTGGGGGGACACAGAGCCTCCGG + Intronic
1025051808 7:55739170-55739192 GTGGGAGGAGCCTCAGCCTCGGG + Intergenic
1029112787 7:98222276-98222298 CTGGGGGAAGTCCCAGCTTCTGG + Intronic
1030486440 7:110174524-110174546 TTCAAGGGATTCTCAGCCTCTGG - Intergenic
1031561106 7:123239806-123239828 TTGGGGAGAATCTTAGCCTCAGG + Intergenic
1038186307 8:25278146-25278168 CTGGGTGGAGTCACAGCCCCAGG + Intronic
1041427716 8:57741524-57741546 TTGGGGGCAGCCTGAGCCTCAGG - Intergenic
1042132725 8:65604497-65604519 TTTGTGGGACTCTCATCCTCAGG + Exonic
1045326344 8:101120282-101120304 TTGGGGGCTGACACAGCCTCAGG + Intergenic
1048051403 8:130820470-130820492 TTGGGGAGATTCTCACCCCCTGG - Intronic
1048522463 8:135169490-135169512 TTGGAGGGAGGATCAGCCCCAGG + Intergenic
1049820269 8:144629248-144629270 TTAGGGGCAGCCTCAGCCTAAGG + Intergenic
1051244266 9:15093259-15093281 TGTGGGGGTGTCTCAGCCTATGG - Intergenic
1052464328 9:28810860-28810882 TGGGGGTGAGTCACATCCTCTGG + Intergenic
1053270246 9:36744681-36744703 TTGGGGAGGGGCTCTGCCTCAGG + Intergenic
1054786602 9:69216370-69216392 GTGGGGGTTGTCTCTGCCTCCGG - Exonic
1057199713 9:93133705-93133727 CGGAGGGGAGTCACAGCCTCCGG - Intronic
1057255734 9:93545517-93545539 TTGGGGCCTGTCTCACCCTCTGG + Intronic
1059852627 9:118361538-118361560 TTTGGGGGACTCTCAGCCTTCGG - Intergenic
1060403663 9:123362316-123362338 GTGGGAGGAGCCTCACCCTCTGG + Intronic
1061576408 9:131509804-131509826 GTGGGGTGAGTTTGAGCCTCTGG + Exonic
1061895323 9:133643978-133644000 TTGGGGGAAGGCTCAGCCCTAGG + Intronic
1062630310 9:137460323-137460345 TTGGCAGGAGCCTCAGCCTTGGG + Exonic
1185579237 X:1197792-1197814 TTAGAGGGAGTCTCAGTCTGTGG - Intronic
1186676478 X:11822617-11822639 CCTGGTGGAGTCTCAGCCTCAGG - Intergenic
1187400094 X:18951475-18951497 CTGGGGGGAGTCTCATCTGCAGG + Intronic
1190552044 X:51594111-51594133 TTGGGGGGAGGGACAGCATCAGG - Intergenic
1190692280 X:52921425-52921447 GAGGGCGGAATCTCAGCCTCCGG - Intergenic
1190701725 X:52994347-52994369 TTGGGGGGGGTCTCTGTCTAGGG - Intronic
1191785894 X:64916965-64916987 CTGGGGGCACTCTCAGCCTAAGG + Exonic
1196263063 X:113608447-113608469 TTGGGCAAAGTCTCAGCCTCAGG - Intergenic
1197050150 X:122047380-122047402 TGAGGGGGAGGCACAGCCTCTGG - Intergenic
1198744825 X:139879015-139879037 CTGGGAGGAGGCTCAGCCTGGGG + Intronic
1201730873 Y:17201402-17201424 TGGGAGGGAGTCTCAGCTTTAGG + Intergenic